ID: 1083847676

View in Genome Browser
Species Human (GRCh38)
Location 11:65345481-65345503
Sequence GCCCCACGGCCTGATGCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 150}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083847672_1083847676 -7 Left 1083847672 11:65345465-65345487 CCCCAGAAGCTAGAGAGCCCCAC 0: 1
1: 0
2: 1
3: 10
4: 135
Right 1083847676 11:65345481-65345503 GCCCCACGGCCTGATGCTCCTGG 0: 1
1: 0
2: 1
3: 16
4: 150
1083847673_1083847676 -8 Left 1083847673 11:65345466-65345488 CCCAGAAGCTAGAGAGCCCCACG 0: 1
1: 0
2: 0
3: 7
4: 112
Right 1083847676 11:65345481-65345503 GCCCCACGGCCTGATGCTCCTGG 0: 1
1: 0
2: 1
3: 16
4: 150
1083847674_1083847676 -9 Left 1083847674 11:65345467-65345489 CCAGAAGCTAGAGAGCCCCACGG 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1083847676 11:65345481-65345503 GCCCCACGGCCTGATGCTCCTGG 0: 1
1: 0
2: 1
3: 16
4: 150
1083847669_1083847676 24 Left 1083847669 11:65345434-65345456 CCATGGGGTTGGAGTTCAGGAGG 0: 1
1: 0
2: 0
3: 23
4: 299
Right 1083847676 11:65345481-65345503 GCCCCACGGCCTGATGCTCCTGG 0: 1
1: 0
2: 1
3: 16
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083847676 Original CRISPR GCCCCACGGCCTGATGCTCC TGG Intronic
900550182 1:3250677-3250699 GCCCCAGGGCCTGAGGGTGCAGG + Intronic
901320938 1:8339443-8339465 GCCACACGGCCAGAGCCTCCGGG - Intronic
902097808 1:13960844-13960866 GCCCCAGGTCCTGAAGCCCCAGG - Intergenic
902642751 1:17777239-17777261 GTCCCACATCCTGATTCTCCAGG + Intronic
903170206 1:21547911-21547933 GCCCCACTCCAGGATGCTCCCGG + Intronic
905227954 1:36492346-36492368 GCCCCAAGGCCTGAAAATCCAGG - Intergenic
906075708 1:43050468-43050490 ACCACACTGCTTGATGCTCCAGG - Intergenic
906535820 1:46550485-46550507 GCCCCCTAGCCTGATGCTTCTGG + Intronic
907241126 1:53081643-53081665 ACCCCAAGGCCTGAGGCTCCTGG - Intronic
911312943 1:96318837-96318859 TCCCCACAGCCTCAGGCTCCAGG + Intergenic
913694889 1:121315216-121315238 GCACTATGGCCTGAAGCTCCTGG + Intronic
917781450 1:178401564-178401586 GCACTACGGCCTGAAACTCCTGG - Intronic
922969591 1:229724795-229724817 TGCCCAGGTCCTGATGCTCCAGG - Intergenic
923046935 1:230362451-230362473 GCCTCAAGGCCTGATCCTCCTGG + Intronic
923251101 1:232180367-232180389 CCCCCACAGCCTGTTGCTCCTGG - Intergenic
1063549694 10:7019008-7019030 GCCCCATGGCCCTAGGCTCCAGG + Intergenic
1067279542 10:44860963-44860985 GCCCCAGGGCCTGAGCCTTCAGG - Intergenic
1069716476 10:70524264-70524286 GCCCCACATACTGATGGTCCAGG - Intronic
1075025504 10:118980434-118980456 GCCCCACAACCTGTTCCTCCTGG - Intergenic
1075025522 10:118980478-118980500 GCCCCCCTGCCTGTTCCTCCTGG - Intergenic
1075602067 10:123777154-123777176 TCCCCACAGCCTGATGTCCCCGG + Intronic
1076610285 10:131722147-131722169 GCCCCACCTCCTGAGGCTCATGG + Intergenic
1076846795 10:133073172-133073194 GGCCCACGGCCGGAGGCTCCAGG + Intronic
1076988047 11:253543-253565 GCCCCACGGCCTGCTCCTGTTGG + Intergenic
1077033168 11:479387-479409 GCCCCACCAGCAGATGCTCCTGG - Intronic
1077101847 11:825956-825978 GCCCCATGGCCTGAGGGTGCTGG + Intergenic
1083255316 11:61491818-61491840 GCCCCCAGGCCTGCTGCTCAAGG - Intergenic
1083847676 11:65345481-65345503 GCCCCACGGCCTGATGCTCCTGG + Intronic
1085519260 11:77128576-77128598 GCCCCACAGCCACTTGCTCCTGG + Intronic
1086398758 11:86443526-86443548 GCCACAGGGCCTGATCCTCCAGG + Intronic
1089401774 11:118168520-118168542 GCCCCATGGCATGAAGCCCCTGG - Intronic
1089495003 11:118903317-118903339 GGCCTTCGGCCTGATGCCCCTGG - Exonic
1091218713 11:133918593-133918615 GCCCCACCGCGGGCTGCTCCGGG - Intronic
1094737359 12:33249940-33249962 TCCCCACAGCCTCAGGCTCCTGG - Intergenic
1095289649 12:40463198-40463220 GCCCCAGTGCCTGACACTCCAGG - Intronic
1095289735 12:40464170-40464192 GCTCCAGGGCCTGCTTCTCCAGG - Exonic
1096670182 12:53193835-53193857 GCCCCATCTCCTGAGGCTCCGGG - Exonic
1097516544 12:60615676-60615698 GCCCCACAGGCTTAGGCTCCAGG + Intergenic
1099478699 12:83140363-83140385 TCCCCACGGCCTGAGCCTCCAGG + Intergenic
1100508259 12:95242506-95242528 GCCCTACGGCCTCAAACTCCTGG + Intronic
1102491446 12:113291747-113291769 GCCCCACTCCCTGACGCTGCAGG - Intronic
1103830642 12:123776245-123776267 GTCCCATGGCCTGATCCTCAAGG - Intronic
1104718873 12:131033656-131033678 GGCCCACGGCCTGCCCCTCCAGG - Intronic
1105409497 13:20160498-20160520 GCCCTACAGCCTGACGGTCCGGG + Intronic
1112325367 13:98439990-98440012 GCCCCACTGCCTGACCCTCCGGG + Exonic
1112505142 13:99970826-99970848 GCTCAACGGCCAGATGCGCCTGG - Exonic
1113817299 13:113182162-113182184 ACCCCAGGGCCTGCTGCTTCTGG - Intronic
1113931011 13:113968925-113968947 GCCCCACAGCCTGGCCCTCCTGG + Intergenic
1120215397 14:81676682-81676704 GCCCCACTGTCTGATGCTTCTGG + Intergenic
1121544295 14:94752129-94752151 TCCCCACCTCCTGATGCTCTGGG + Intergenic
1122716746 14:103700732-103700754 GTCCCACGGCCTGCAGCCCCAGG + Intronic
1124657571 15:31521559-31521581 ACACCACAGCCTGGTGCTCCCGG - Intronic
1129105081 15:73301503-73301525 GCCCCAGGGCCTGAGACTGCTGG + Intronic
1130705582 15:86230143-86230165 GCCCGTCAGCCTGTTGCTCCAGG + Intronic
1131768360 15:95705794-95705816 GCTCCAGGGCCTTCTGCTCCTGG + Intergenic
1132544587 16:527503-527525 GCCCCACTCCCTGATAATCCTGG + Intergenic
1132669326 16:1096248-1096270 GCCTCTCGGCCTGTTGCTCTTGG - Intergenic
1134413995 16:14028345-14028367 GTCCCATGGCCTTAGGCTCCTGG + Intergenic
1137562331 16:49510863-49510885 GGCCACCGGCCTGAGGCTCCTGG + Intronic
1138360825 16:56425654-56425676 GCCCCCCGGCCTGAGGCCCGGGG - Intergenic
1142156553 16:88535047-88535069 GCCGCACGGACTGCCGCTCCTGG + Exonic
1142373856 16:89696987-89697009 GCCCCAAGGCCCGTGGCTCCTGG - Exonic
1143101131 17:4505435-4505457 GCCTCAGGGCCTGAGTCTCCAGG + Intronic
1143620517 17:8077600-8077622 GCCCCAGAGCCTGATGCTCCTGG - Intronic
1143765514 17:9135118-9135140 CCCCCAGCCCCTGATGCTCCCGG + Intronic
1147120565 17:38333009-38333031 GCCACATGGCCTGAGCCTCCGGG + Intronic
1148406959 17:47424024-47424046 GCCCGAGGGCCCGCTGCTCCGGG + Intronic
1151215065 17:72571628-72571650 GCCCCAGGGCCAGATCATCCAGG + Intergenic
1152463357 17:80452590-80452612 ACCCCACAGCCAGATGCTTCTGG - Intergenic
1153811956 18:8759909-8759931 GCCCCAGGGGCTCATGCTCATGG + Intronic
1154133095 18:11752556-11752578 TACCCACCGCCTGCTGCTCCTGG + Intronic
1156263601 18:35466992-35467014 GACCCACAGACTGCTGCTCCTGG - Intronic
1158725677 18:59969576-59969598 GCCCGAGGGCCAGCTGCTCCGGG + Intergenic
1160386702 18:78501335-78501357 GCCTCACGGGCTGATGGTCCAGG - Intergenic
1160592522 18:79952126-79952148 GCCCCACGAGCAGATGCGCCGGG + Intergenic
1160706490 19:532408-532430 GCCCCACGCCCAGATGCTACAGG - Intronic
1161507585 19:4652244-4652266 GACCCACGGCCTGGTGCAGCAGG - Exonic
1161706934 19:5826589-5826611 GCCCCCCGGGCTGGTGCACCTGG - Intronic
1161952874 19:7477423-7477445 GCCCCACAGCCCGCTGCCCCGGG - Exonic
1162730042 19:12712958-12712980 TCACCACAGCCTCATGCTCCTGG + Intronic
1163655301 19:18542368-18542390 GCCACAGGGCCTGAAGCCCCAGG - Intronic
1165132602 19:33642027-33642049 GCCCCAGGCCCTCATCCTCCAGG - Intronic
1165371253 19:35407785-35407807 GCACCACGGCCAGCTGCTCTTGG - Intergenic
1166328511 19:42065646-42065668 GCCCCAGGGCCTGAGGATGCAGG + Intronic
927155907 2:20221399-20221421 GCCCCTCTGCCTGGTGCCCCAGG - Intronic
932132309 2:69199046-69199068 GCCCCAGAGACTAATGCTCCAGG + Intronic
934769117 2:96896640-96896662 GCCACACAGCATGTTGCTCCTGG + Intronic
937223055 2:120353140-120353162 GCCCCAAGGCCTTGTGCCCCTGG - Intergenic
937346147 2:121126867-121126889 GCCCCTTGGCATGAAGCTCCTGG - Intergenic
937430206 2:121831920-121831942 ACCAGACGGCCTGATGCTGCTGG + Intergenic
937952238 2:127397625-127397647 TCCCCACTGCCTAATGCACCAGG + Intergenic
938115763 2:128602138-128602160 GCCCCACGCCCTGGTGCCACAGG + Intergenic
938577582 2:132619012-132619034 GCCCCACTGCCTGGTGCTACTGG - Intronic
943480011 2:188405429-188405451 GCCCTATGGACTGAGGCTCCAGG + Intronic
948464465 2:238145617-238145639 ACCCCATGGCCTGGTGCCCCAGG + Intronic
948574010 2:238938218-238938240 GACCCACAGCTTGAGGCTCCTGG - Intergenic
1169907041 20:10614705-10614727 GCCCCAGGGTCAGATGCTGCTGG - Intronic
1170165126 20:13353751-13353773 GGCCCACTGCCTGATTCTACTGG + Intergenic
1171414714 20:24969758-24969780 CACCCAGGGCCTGTTGCTCCGGG - Intronic
1172701065 20:36854068-36854090 GCCACAAAGCCTGAAGCTCCAGG + Intronic
1173155687 20:40606644-40606666 TCCCCACTGCCTGATGTTCATGG - Intergenic
1173819020 20:46008941-46008963 GCCCCTGGTCCTGGTGCTCCTGG + Exonic
1175842854 20:62041368-62041390 GCCTCACATCATGATGCTCCTGG + Intronic
1175908593 20:62393917-62393939 GCCCCACAGCCAGGTGCTCCTGG - Intronic
1180875839 22:19174983-19175005 GCCCCACCTCCTGCTGCCCCAGG + Intergenic
1182098130 22:27639451-27639473 CCCCCACGGGCTGATGCAGCTGG - Intergenic
1183548900 22:38469618-38469640 TCACCAGGGCCTGCTGCTCCGGG - Intronic
1183956312 22:41382341-41382363 GCCCCCCGGCCTCGTCCTCCAGG - Intronic
1184679426 22:46062091-46062113 GCCCCGGGGCCGGGTGCTCCTGG + Intronic
950425694 3:12923745-12923767 GCTCCAGGGGCTGCTGCTCCCGG + Intronic
953993650 3:47503047-47503069 GGCCTACTGCCTTATGCTCCAGG + Intronic
954454542 3:50590675-50590697 CCCCCATAGCCTGAGGCTCCCGG + Intergenic
956748655 3:72329387-72329409 GACCCCAGGCCTGGTGCTCCGGG - Intergenic
959323160 3:104904422-104904444 TCCCCACAGACTGAGGCTCCAGG - Intergenic
960047613 3:113212428-113212450 GCGCCCCGGCCCCATGCTCCAGG + Intronic
960639086 3:119809994-119810016 GGCCCTCGGCCTGGGGCTCCGGG - Intronic
961356119 3:126341065-126341087 GCCGCACTGCCTGTTGATCCTGG - Intergenic
964385160 3:156139432-156139454 GCACCACTGCCTGAACCTCCAGG + Intronic
969240622 4:5894648-5894670 GCCCCATGGACTGAGGATCCTGG + Intergenic
969325668 4:6442423-6442445 GCCCCACGGACTGAAGCACGTGG - Intronic
969705119 4:8787524-8787546 GCCCCACTGCCCGGTGCTCAGGG + Intergenic
972762858 4:42124001-42124023 GCCACAGGGACTGATGCTCTAGG + Intronic
974055213 4:56977201-56977223 GCCCCACGACCGGGTGCTCCCGG + Exonic
984386040 4:179059615-179059637 GCCCCACAGCGTCAGGCTCCAGG + Intergenic
985632615 5:1021913-1021935 GGCCCTCTGCCTGCTGCTCCGGG + Intronic
985720134 5:1484632-1484654 GCCCTAGGGACAGATGCTCCTGG - Intronic
986716866 5:10531141-10531163 CCCCCACAGCCTGATCCTCAGGG + Intergenic
988676675 5:33440434-33440456 GCCCCATGTCCTGTTGATCCGGG - Intergenic
1002449619 5:179311212-179311234 CCCCCAGGGCCTGGCGCTCCTGG + Intronic
1007075538 6:39063855-39063877 GCCCCAGGGCCTGACCCTCAGGG - Intronic
1011303552 6:85901896-85901918 GCCACAAGGCTTGATCCTCCTGG + Intergenic
1018604728 6:165584842-165584864 GCACCACAGCCTGTTGCTCAGGG - Intronic
1019648501 7:2143680-2143702 ACCACACGGCCAGGTGCTCCAGG + Intronic
1020071080 7:5227376-5227398 GCCCCTCGGCCTGAGGCACACGG - Intronic
1021992683 7:26152756-26152778 GCCCGAGGGCCAGCTGCTCCGGG + Exonic
1023054230 7:36278814-36278836 TCCCCCTGGCCAGATGCTCCTGG - Intronic
1029705882 7:102275344-102275366 GACTCACGGCCTCAAGCTCCTGG - Intronic
1032445027 7:131974860-131974882 GTCCCAGGGCCTCATGCTCAGGG + Intergenic
1032970443 7:137156886-137156908 TCCCCACAGCCTCATACTCCAGG + Intergenic
1033545644 7:142397727-142397749 GCCAGAGGTCCTGATGCTCCTGG + Intergenic
1034225475 7:149477666-149477688 CGCCCAGGGCCTGCTGCTCCTGG + Exonic
1034383642 7:150720382-150720404 GCCTCACCGCCTGCTGGTCCTGG - Exonic
1034879964 7:154756038-154756060 GCCCCAAGGCCTGTGGCTGCTGG + Intronic
1035448325 7:158957957-158957979 GCCCCTCGGCCTTCCGCTCCGGG + Intergenic
1035792217 8:2317373-2317395 GCCTCACGCCCTGTTCCTCCGGG - Intergenic
1035800588 8:2404332-2404354 GCCTCACGCCCTGTTCCTCCGGG + Intergenic
1037673145 8:21032573-21032595 GGCCCACAGCTTGGTGCTCCCGG - Intergenic
1039919320 8:41882278-41882300 GCCCCACGCCCTGGGGCTCCTGG + Intronic
1045657888 8:104405872-104405894 CCGCCACAGCCAGATGCTCCGGG + Intronic
1045673935 8:104588501-104588523 CCCCCGCGGCCAGTTGCTCCAGG - Intronic
1048956777 8:139543822-139543844 GTTCCACGGCCTGAGGTTCCTGG + Intergenic
1049602468 8:143514276-143514298 GACACACGGCCTGAGGCTCCTGG - Intronic
1049651494 8:143771821-143771843 GCCGCGCGGCCTCCTGCTCCCGG - Intergenic
1049731580 8:144181111-144181133 AGCCCACGGCCTCGTGCTCCCGG + Intronic
1052234054 9:26188887-26188909 ACCCCAAGGCCCCATGCTCCAGG + Intergenic
1054738504 9:68780365-68780387 CCGCCACGGCCTGCTGCTGCCGG + Exonic
1058282435 9:103132023-103132045 CCCCCACTCCCTGTTGCTCCTGG - Intergenic
1060792930 9:126497986-126498008 GCCCCACGGCCCCATCCTGCAGG - Intronic
1189380930 X:40501653-40501675 GCCCCTCTGCCTCAGGCTCCAGG + Intergenic
1193945484 X:87728337-87728359 CCCCCACGCTCTGTTGCTCCTGG - Intergenic
1193970162 X:88040201-88040223 GGCCCAAGGACTGATGCCCCTGG + Intergenic
1195025510 X:100873023-100873045 GCCCCCCGACCAGGTGCTCCAGG - Intronic
1197082927 X:122440729-122440751 GCCCCATGGACTCAGGCTCCAGG - Intergenic
1197293110 X:124684557-124684579 GCCTCAAGGCCTGAGACTCCAGG + Intronic
1197634828 X:128903284-128903306 CCCCCATAGCCTGATGCTCTGGG + Intergenic
1200710573 Y:6481318-6481340 GCCCCAAGGCCTCCTGCTGCAGG - Intergenic
1200873594 Y:8128579-8128601 CCCCCACGGCCTGAGCCTCCTGG - Intergenic
1201023362 Y:9680669-9680691 GCCCCAGGGCCTCCTGCTGCAGG + Intergenic