ID: 1083847680

View in Genome Browser
Species Human (GRCh38)
Location 11:65345487-65345509
Sequence CGGCCTGATGCTCCTGGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 211}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083847674_1083847680 -3 Left 1083847674 11:65345467-65345489 CCAGAAGCTAGAGAGCCCCACGG 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1083847680 11:65345487-65345509 CGGCCTGATGCTCCTGGCTGAGG 0: 1
1: 0
2: 1
3: 19
4: 211
1083847672_1083847680 -1 Left 1083847672 11:65345465-65345487 CCCCAGAAGCTAGAGAGCCCCAC 0: 1
1: 0
2: 1
3: 10
4: 135
Right 1083847680 11:65345487-65345509 CGGCCTGATGCTCCTGGCTGAGG 0: 1
1: 0
2: 1
3: 19
4: 211
1083847669_1083847680 30 Left 1083847669 11:65345434-65345456 CCATGGGGTTGGAGTTCAGGAGG 0: 1
1: 0
2: 0
3: 23
4: 299
Right 1083847680 11:65345487-65345509 CGGCCTGATGCTCCTGGCTGAGG 0: 1
1: 0
2: 1
3: 19
4: 211
1083847673_1083847680 -2 Left 1083847673 11:65345466-65345488 CCCAGAAGCTAGAGAGCCCCACG 0: 1
1: 0
2: 0
3: 7
4: 112
Right 1083847680 11:65345487-65345509 CGGCCTGATGCTCCTGGCTGAGG 0: 1
1: 0
2: 1
3: 19
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083847680 Original CRISPR CGGCCTGATGCTCCTGGCTG AGG Intronic
900158089 1:1211584-1211606 CGGCCTGCTCCTCTTGGATGGGG + Exonic
900522121 1:3110894-3110916 CCGCCTGATGCCCCGGGGTGGGG + Intronic
900582483 1:3415920-3415942 AGCCCTGCTGCTCCGGGCTGCGG + Intronic
901318427 1:8324337-8324359 CGGCGGGGTGCTGCTGGCTGCGG - Exonic
903144588 1:21362787-21362809 CGTCCTGCTTCTCCAGGCTGCGG + Intergenic
903218483 1:21855737-21855759 AGGCCTGACTCTCCTGGGTGTGG - Intronic
905523001 1:38614522-38614544 GGCCCCCATGCTCCTGGCTGTGG + Intergenic
905710370 1:40097202-40097224 CTGCCTGTGGCTCTTGGCTGTGG - Exonic
906231958 1:44171801-44171823 GGGCCTGCTGCTCCTGCCTCAGG - Intergenic
907471977 1:54679929-54679951 GGGCCCGAGGCTCCTGGATGTGG - Exonic
907657658 1:56360513-56360535 CAGCCTGAGTCTCCTAGCTGAGG - Intergenic
907751552 1:57268129-57268151 TGGCCAGATGCTCCTTGCTTTGG - Intronic
908140473 1:61179245-61179267 CAGACTGATGCACCTGGCTTTGG + Intronic
910759246 1:90718670-90718692 AGGCCTGAGGCTCCAAGCTGGGG + Intergenic
911100984 1:94095602-94095624 CTGCCTGATGCTCCTTTCAGAGG + Intronic
911757730 1:101579387-101579409 CAGCCTCATCCTCCTGGCTTAGG - Intergenic
914323479 1:146587831-146587853 AACCCTGATGCTGCTGGCTGAGG + Intergenic
916083282 1:161250412-161250434 CGGGTTGCTGCTGCTGGCTGGGG - Intergenic
917966595 1:180182876-180182898 TGGCCCAATGCTCCTGCCTGCGG - Intronic
919201247 1:194358022-194358044 CGGGCTGACGCTGCTGGCTCGGG + Intergenic
920034171 1:203055375-203055397 CCTCCTGCTGGTCCTGGCTGGGG + Intronic
921029726 1:211326825-211326847 GCGGCTGCTGCTCCTGGCTGCGG - Exonic
921149326 1:212386993-212387015 CTACCTGCTGCTCATGGCTGTGG - Exonic
921938645 1:220817408-220817430 TGGGCTGCTGCTGCTGGCTGGGG + Exonic
923458391 1:234186286-234186308 TGGCCAAATGCTCCTGGCTTTGG + Intronic
924794270 1:247281286-247281308 CTGTCTGCTGCTCCAGGCTGAGG + Intergenic
1067718654 10:48709651-48709673 CTTCCTGATGATTCTGGCTGTGG - Intronic
1067753131 10:48984971-48984993 GGGGCTGCTGCTCCTGGCTGTGG + Intergenic
1069526382 10:69175689-69175711 CGGGTTGCTGCTGCTGGCTGGGG - Intergenic
1071427826 10:85576985-85577007 CCCCATGATGCTCCTGCCTGAGG - Intergenic
1074318822 10:112382209-112382231 TGGCATGAAGCCCCTGGCTGTGG + Intronic
1076116453 10:127905150-127905172 CTGTCTGCTGCTGCTGGCTGGGG + Intergenic
1076836293 10:133022639-133022661 GGGTCTGAGGCTCCTGGCTCTGG + Intergenic
1077106263 11:843792-843814 CGGCCTGGGGCTTCTGGCTGGGG + Intronic
1077341075 11:2026628-2026650 CTTCCTGATGCCCCTGCCTGGGG + Intergenic
1077413985 11:2415992-2416014 AGTCCTGAGGCTCCTGGCTGTGG + Exonic
1078497323 11:11831505-11831527 CGGCTTGCCGCTTCTGGCTGGGG + Intergenic
1080331981 11:31149489-31149511 CGGGTTGCTGCTGCTGGCTGGGG - Intronic
1083267299 11:61552631-61552653 CTCCCTGATGCTCCTGCCAGGGG + Intronic
1083826139 11:65205120-65205142 CGGCCTGCTGCTCTTGGAGGAGG + Intronic
1083847680 11:65345487-65345509 CGGCCTGATGCTCCTGGCTGAGG + Intronic
1083932845 11:65855301-65855323 CTGCCAGATGCTCCAGGCAGGGG + Exonic
1084360341 11:68664949-68664971 AGGCCTGGAGCTCCTGTCTGTGG - Intergenic
1084693547 11:70740617-70740639 CTGACTGATGCTGCTTGCTGGGG - Intronic
1084783664 11:71429114-71429136 TGTCTTGATGATCCTGGCTGTGG + Intronic
1084860238 11:72013386-72013408 CGGCCTGCAGCTGCTGGCAGAGG + Exonic
1086324558 11:85685341-85685363 TGGCCTGCAGCTCCTGGCTCAGG + Exonic
1086802406 11:91193396-91193418 CTGCCTGATCCTCCTTGCTTGGG + Intergenic
1086802655 11:91196002-91196024 CTGCCTGATCCTCCTTGCTTGGG + Intergenic
1089199427 11:116714887-116714909 CGGCCCAGTGCTCCTGGCTCAGG - Intergenic
1089467120 11:118692538-118692560 CTGCCTGATGCCCATGGTTGGGG + Intergenic
1089494998 11:118903311-118903333 CGGCCTGATGCCCCTGGGGGCGG - Exonic
1090167874 11:124570539-124570561 CTGCCTGCTGCTGGTGGCTGTGG + Exonic
1090254098 11:125271066-125271088 GGGGCTGATGATCCTGTCTGTGG + Intronic
1090851215 11:130572208-130572230 TGGCCTCATGGTGCTGGCTGTGG + Intergenic
1091282788 11:134391449-134391471 CAGCCTGCTGCTTCTGCCTGGGG + Exonic
1202824060 11_KI270721v1_random:81817-81839 CTTCCTGATGCCCCTGCCTGGGG + Intergenic
1092596315 12:10009137-10009159 CGGGTTGCTGCTGCTGGCTGGGG - Intronic
1095959389 12:47824557-47824579 TCTCCTGATGCTCCTGGCTGGGG - Intronic
1096108852 12:49016937-49016959 CGGCATGATGTTGCTGGCTTTGG - Intronic
1100529186 12:95448545-95448567 CGGGTTGCTGCTACTGGCTGGGG + Intergenic
1100530613 12:95458012-95458034 CGGGTTGCTGCTGCTGGCTGGGG + Intergenic
1102222262 12:111202488-111202510 CTGCCTGATGCTTGTGGCAGGGG + Intronic
1104061866 12:125275401-125275423 AGGCCTGATGATCATGGCTGAGG + Intronic
1104109234 12:125689748-125689770 CTGCTTGTTGCTCCTGCCTGGGG + Intergenic
1104163079 12:126199485-126199507 CGATCTCATGCTCCTGGCTAAGG + Intergenic
1105280878 13:18961933-18961955 AAGCCTGAGGCTCTTGGCTGTGG - Intergenic
1105844167 13:24280636-24280658 TATCCTGATGCTCCTGGGTGAGG - Intronic
1106034547 13:26031856-26031878 CGGGTTGCTGCTGCTGGCTGGGG + Intergenic
1106471083 13:30054872-30054894 CGGGTTGCTGCTGCTGGCTGGGG - Intergenic
1106938789 13:34753503-34753525 CGGGTTGCTGCTGCTGGCTGGGG - Intergenic
1113708562 13:112449364-112449386 CGGCCGGATGCTCCTGACTTGGG - Intergenic
1114662413 14:24355772-24355794 CGGCCTCAGCCTCCTGGCTTAGG + Intergenic
1119967614 14:78934569-78934591 AGACCTGTTGCTACTGGCTGAGG - Intronic
1120649291 14:87112219-87112241 TGGCCTGATGCTAATGGCAGTGG - Intergenic
1122541572 14:102500598-102500620 CGGCCTGAGGTTTCTTGCTGAGG - Exonic
1124577511 15:30922932-30922954 CGGCCTCACCCGCCTGGCTGTGG - Intronic
1129109491 15:73329305-73329327 GGGCCTGTGGCTCCTGGCTGAGG - Intronic
1129350985 15:74955969-74955991 CGGCCTGAAACTCCGGACTGTGG - Exonic
1129607475 15:77031843-77031865 CTGCCTGACGCTCCTGTCCGGGG + Intronic
1129879186 15:78995964-78995986 GGTCCTGGCGCTCCTGGCTGTGG + Intronic
1130656745 15:85796664-85796686 TGGGTTGCTGCTCCTGGCTGGGG - Intergenic
1134290875 16:12902172-12902194 CGGCGTGTTGCTGCTGGCGGGGG + Exonic
1134995168 16:18733859-18733881 CTGCCTGATTCTCCTGCCTCAGG + Intergenic
1138572201 16:57883015-57883037 CGGGCTGTTCCTCCTGGCAGAGG + Exonic
1139335031 16:66225766-66225788 AGGACTGATCCTCCTGGATGGGG - Intergenic
1139790378 16:69429296-69429318 CAGGTTGATGCTGCTGGCTGGGG + Intronic
1140010083 16:71123019-71123041 AACCCTGATGCTGCTGGCTGAGG - Intronic
1141703041 16:85651162-85651184 CGCCCTGATGCGTCTGTCTGTGG + Intronic
1145751362 17:27357269-27357291 AGGCAGGATGCTCCTGGCAGAGG - Intergenic
1146311458 17:31771582-31771604 CGGCTTGCTGCTGCTGGCTCAGG - Intergenic
1146846027 17:36182805-36182827 CGGCTTGATGGTCCCGGCTTCGG + Intronic
1148695271 17:49555012-49555034 CGGCCCGGAGCACCTGGCTGGGG + Intergenic
1148737178 17:49871365-49871387 CGGTCTGAGGTTCTTGGCTGGGG + Intergenic
1151715670 17:75829945-75829967 AGGCCTGCTCCTCCTGGCTGGGG - Intronic
1151744983 17:76007165-76007187 CGGCCTGCTGCTCCTGCCAGCGG - Exonic
1152018701 17:77769179-77769201 AGCCCTGCTGCCCCTGGCTGGGG - Intergenic
1152152265 17:78609525-78609547 CGAGCTGAAGCTGCTGGCTGAGG - Intergenic
1152230304 17:79110997-79111019 AGGGCTGCAGCTCCTGGCTGAGG + Intronic
1153622662 18:6994175-6994197 AGACCTGATTCTCCAGGCTGTGG + Intronic
1154133100 18:11752562-11752584 CCGCCTGCTGCTCCTGGGTAAGG + Intronic
1156066479 18:33148322-33148344 CTGCCTGATTCTCCTGCCTCAGG - Intronic
1156540700 18:37906983-37907005 AGGCCTCATTCTCCAGGCTGGGG + Intergenic
1159227956 18:65564965-65564987 CGGGTTGCTGCTGCTGGCTGGGG + Intergenic
1160340616 18:78085783-78085805 CGGCCTGCTGTGCCAGGCTGGGG - Intergenic
1161382136 19:3971025-3971047 CGGCCGTATTCTCCGGGCTGCGG - Exonic
1161486358 19:4537954-4537976 GGGCCAGACGCTCCTGGCAGTGG - Exonic
1161598539 19:5165581-5165603 CGGGTTGCTGCTGCTGGCTGGGG + Intronic
1164566674 19:29330666-29330688 TTCCCTGAGGCTCCTGGCTGAGG + Intergenic
1164618171 19:29678850-29678872 CAGCCTCACGCTCCTGCCTGGGG + Intergenic
1166074062 19:40403713-40403735 CAGGCTGAGGCTCCTGGCGGCGG + Exonic
1166811282 19:45516088-45516110 CTGCCTGACTCTCCAGGCTGGGG + Intronic
1166881659 19:45933945-45933967 CCTCCAGAAGCTCCTGGCTGGGG - Exonic
1167144609 19:47674167-47674189 AGGCCCGGTGCTCCTGGCAGAGG + Intronic
1168471928 19:56646972-56646994 AGGCTTGGAGCTCCTGGCTGGGG + Intronic
1168689563 19:58368606-58368628 CCGCCTGCTGCTGCTGGTTGGGG + Exonic
925011514 2:488940-488962 CAGCATGAGGGTCCTGGCTGAGG - Intergenic
927113988 2:19884274-19884296 GTGCCTGAAGGTCCTGGCTGTGG + Intergenic
930873990 2:56193255-56193277 CGGGCTGGTGCCCCTGGCTCTGG - Exonic
931091373 2:58890321-58890343 GGGCCTGAGGTTCCTGGCTTGGG - Intergenic
931343468 2:61425399-61425421 AGGCCTTTTGCTGCTGGCTGGGG - Intronic
932960764 2:76409659-76409681 TGGGTTGATGCTTCTGGCTGGGG + Intergenic
934101723 2:88659761-88659783 TGGCCTGCTGCTCATGGGTGGGG + Intergenic
934657171 2:96122438-96122460 CTTCCTCTTGCTCCTGGCTGGGG - Intergenic
936572282 2:113627089-113627111 GGGACTGGGGCTCCTGGCTGTGG - Intergenic
937904991 2:127048791-127048813 CTCCCTGATGCTGCTGGCTGAGG + Intronic
938046402 2:128125294-128125316 CGACCTCAGGCACCTGGCTGTGG + Intronic
942285409 2:174411100-174411122 CTGCCTGCTGCTCCAGGATGTGG + Intronic
943101079 2:183487236-183487258 GGGCCTGATGGTGCTTGCTGAGG + Intergenic
945825747 2:214717805-214717827 CGGGTTGCTGCTGCTGGCTGGGG + Intergenic
946248910 2:218401463-218401485 CGGCAAGATCCTCCTGGCTCAGG + Intronic
946252655 2:218423019-218423041 CGTGCTGATGCTCCAGGCTCTGG - Intronic
946939216 2:224753680-224753702 CGGGTTGCTGCTGCTGGCTGGGG + Intergenic
948626936 2:239275197-239275219 CGGCCTGGTGGTCTGGGCTGAGG - Intronic
948673424 2:239583326-239583348 CCTGCTGATGCGCCTGGCTGGGG + Exonic
948764476 2:240212432-240212454 GGGCCTGAGGCTGCTGGCTGAGG - Intergenic
949026350 2:241768130-241768152 CTGCCAGATGCTCCTGCCCGAGG - Exonic
1171037627 20:21728802-21728824 CGGGTTGCTGCTGCTGGCTGGGG - Intergenic
1171096794 20:22340056-22340078 TGGCCAGATGCTCCTGGCAAGGG + Intergenic
1171414710 20:24969752-24969774 GGGCCTGTTGCTCCGGGGTGAGG - Intronic
1173448097 20:43138296-43138318 CGGCCTGGGCCTCCTGGCTCTGG - Intronic
1175751355 20:61500096-61500118 GGGCCTCCTCCTCCTGGCTGAGG - Intronic
1176240456 20:64073575-64073597 TGGCCCAGTGCTCCTGGCTGGGG - Exonic
1179491061 21:41741854-41741876 CAGCCTGCTGCACCTGGCGGTGG - Exonic
1179613040 21:42564763-42564785 CGGCCTGATGCTGCTGCTCGCGG + Exonic
1179896550 21:44366544-44366566 TGGCCTGATGCTCCTGGCTTGGG + Intronic
1180057633 21:45367111-45367133 AGGCCTGGTCCTCCTGGCTCTGG + Intergenic
1181179176 22:21055254-21055276 CTGCCTGCTGCCCCTGGGTGGGG - Intronic
1182554776 22:31123196-31123218 CTCCCTGGTGCTCCTGACTGAGG + Intronic
1183297964 22:37043284-37043306 CTGCCAGCTGCTCCTTGCTGGGG + Intergenic
1184581668 22:45422178-45422200 CGTCCTCATGCTCATGGCTAAGG + Intronic
1184655109 22:45937144-45937166 GGGCCTCAGGCTCCTTGCTGGGG - Intronic
1184735176 22:46393838-46393860 CGGCCTACTGCCCATGGCTGTGG - Intronic
1184833534 22:47006733-47006755 AGGCCTGAGAGTCCTGGCTGTGG - Intronic
1185383109 22:50519203-50519225 AGGCCCGATGCCCCTGGGTGGGG + Exonic
1185427906 22:50783791-50783813 GGGACTGGGGCTCCTGGCTGTGG + Intergenic
949790839 3:7790454-7790476 CGGGTTGCTGCTGCTGGCTGGGG + Intergenic
950682632 3:14595603-14595625 CAGACTTATGCTCCTGGCTCAGG + Intergenic
953293631 3:41690930-41690952 TTGCCTGATGTTCCTGGTTGGGG - Intronic
953925599 3:46980858-46980880 TGGCATCATGCTCCTGGCTCAGG + Intronic
954692575 3:52403446-52403468 AGGCCTGCTGCACCTGGCTGAGG - Exonic
954745012 3:52782802-52782824 CGGCAGGATGCTCCTGTCTCGGG + Intronic
954843476 3:53533721-53533743 CTGCCTGATGCTCCTGGACAGGG + Intronic
957288837 3:78250593-78250615 CTGCCTGTTGCTTCTGGCTGTGG - Intergenic
957974623 3:87427378-87427400 TGTCCTGATGCTCCTGGCACTGG - Intergenic
959564299 3:107818727-107818749 CGGGTTGCTGCTGCTGGCTGGGG - Intergenic
960047617 3:113212434-113212456 CGGCCCCATGCTCCAGGCCGTGG + Intronic
960117104 3:113906248-113906270 CCGCCTGAAGGACCTGGCTGAGG - Intronic
962318100 3:134371190-134371212 CGCCCTGGTGCTCCTGGCCCTGG + Exonic
967036400 3:185651496-185651518 CCACCTGCTGCCCCTGGCTGAGG + Intronic
968007838 3:195255156-195255178 CCGACTGAAGCTCCTTGCTGAGG - Intronic
968953705 4:3707660-3707682 GGGCCTGAAGCTCCAGGCTGTGG - Intergenic
968976294 4:3823846-3823868 CGGCCTGATGCTCCCGCCTCTGG - Intergenic
969450813 4:7271941-7271963 CTCCCTGCTGCCCCTGGCTGAGG - Intronic
971256315 4:25016915-25016937 CGGCCTGATCCTCCTCTCTCTGG + Intronic
975202381 4:71607050-71607072 CGGGTTGCTGCTGCTGGCTGGGG + Intergenic
978643943 4:110906442-110906464 GGGGCTGCTGCTCTTGGCTGGGG + Intergenic
985558808 5:571115-571137 CGGCCTCCTGCCCCAGGCTGGGG - Intergenic
985781854 5:1875742-1875764 CGGCCTTACGCTCCCGGCCGCGG - Intergenic
985965750 5:3337965-3337987 AGCTCTGGTGCTCCTGGCTGGGG + Intergenic
989648916 5:43666490-43666512 CTGCCTGATTCTCCTGCCTCAGG - Intronic
994075404 5:95644386-95644408 CAGCCTGATGCTCACGGCAGAGG + Intergenic
999665582 5:153909723-153909745 TGGCCTCATGCACCTGGCTATGG + Intergenic
1000391795 5:160730240-160730262 GGTCCTGATGCCCATGGCTGTGG - Intronic
1002278579 5:178118284-178118306 CAGCCTGTTGACCCTGGCTGTGG + Intronic
1002615603 5:180453389-180453411 AGGGTTGCTGCTCCTGGCTGGGG - Intergenic
1006759708 6:36449125-36449147 CGGGCTGCTGCTGCTGGCTCAGG + Intronic
1007029680 6:38616749-38616771 CGGGTTGCTGCTGCTGGCTGAGG - Intronic
1013375376 6:109509606-109509628 CAGCCTCATCCTCCTGGGTGTGG + Intronic
1016340676 6:143059198-143059220 CGGGTTGCTGCTGCTGGCTGGGG - Intergenic
1019358554 7:593524-593546 CGCCCTGTCGCTCCCGGCTGGGG - Intronic
1019542992 7:1559818-1559840 GGGCCTGCTCCTCCTGGCTGTGG - Intronic
1020152787 7:5696522-5696544 CGGCCTGCTCCTCCTTCCTGTGG - Intronic
1020326650 7:6979497-6979519 CGGCCAGATGGTCCAGGTTGGGG + Intergenic
1022457432 7:30570598-30570620 CGGGTTGATGCTGCTGGCTGTGG - Intergenic
1022821066 7:33961487-33961509 CTGACTGTTTCTCCTGGCTGTGG - Intronic
1024243511 7:47453133-47453155 CTGCCAGCTGCTCCTGGCTGTGG - Intronic
1024285300 7:47751994-47752016 TGGGCTGCTGCTGCTGGCTGGGG - Intronic
1024443233 7:49446097-49446119 CGGGTTGCTGCTACTGGCTGGGG - Intergenic
1024532706 7:50406661-50406683 CCACCTTGTGCTCCTGGCTGAGG - Intergenic
1024963987 7:55005422-55005444 CGGCCTTCTGCGCCTGGCAGGGG - Intergenic
1025028450 7:55536771-55536793 CGGCGTGCTGATCCTGGCTCAGG + Intronic
1025716726 7:63963943-63963965 CATAGTGATGCTCCTGGCTGTGG - Intergenic
1026867313 7:73831714-73831736 CGGCCTGCTGCTCCTTGGCGGGG + Exonic
1029705881 7:102275338-102275360 CGGCCTCAAGCTCCTGGTTCCGG - Intronic
1037528304 8:19749468-19749490 AGGCTTCCTGCTCCTGGCTGAGG + Intronic
1038152803 8:24957496-24957518 CAGCTTGAAGCTCCCGGCTGCGG - Intergenic
1038435383 8:27532128-27532150 CTGCCTGTTGCTCCTGGGGGTGG + Intronic
1039918607 8:41877283-41877305 CAGTCTTATGCTCCAGGCTGGGG + Intronic
1041203165 8:55471387-55471409 CGTGCTGATGCTGCTGGTTGAGG - Intronic
1044287736 8:90428675-90428697 AGTCCTGATGCTGCTGGCTTAGG - Intergenic
1045187902 8:99857230-99857252 CGGCCTCTTGCTCCTGCCAGTGG - Intronic
1045858203 8:106788924-106788946 CGGGTTGCTGCTGCTGGCTGGGG - Intergenic
1048285552 8:133138504-133138526 TGGCCTGATGTTGCTGGCTTTGG + Intergenic
1049043295 8:140129201-140129223 AGGCCTGAGGTTCCTGGGTGAGG + Intronic
1049159929 8:141090388-141090410 CCTCCTGCTGCTCCTGGCTCAGG - Intergenic
1050683611 9:8142252-8142274 CTGGCTGTTGCTTCTGGCTGGGG + Intergenic
1051710722 9:19927956-19927978 GGGTCTGCTGCACCTGGCTGGGG + Intergenic
1056756605 9:89385746-89385768 CTGCCTGTTGCTCCCAGCTGAGG + Intronic
1058357813 9:104104878-104104900 AGGCCTGATCATCCTGCCTGTGG - Intronic
1060389961 9:123268826-123268848 CGGCCTTATGCACCTGCCAGCGG + Intergenic
1060526338 9:124323352-124323374 GGGCCTGTTGCTCCAGGCTCGGG + Intronic
1061931262 9:133834273-133834295 CGGCCAGCTCCTCCAGGCTGCGG + Exonic
1062480378 9:136748230-136748252 TGCCCTGAGGCTCCTGCCTGTGG + Intronic
1187631638 X:21179290-21179312 CGGCCTGCTGCTCTGTGCTGGGG - Intergenic
1191206300 X:57836738-57836760 CGGGTTGCTGCTGCTGGCTGGGG + Intergenic
1194545819 X:95232184-95232206 TGGTGTGATGCTTCTGGCTGAGG + Intergenic
1195552751 X:106186751-106186773 CGGGTTGCTGCTGCTGGCTGGGG + Intronic
1196312902 X:114189221-114189243 CGGGTTGCTGCTGCTGGCTGGGG - Intergenic
1197774869 X:130112043-130112065 CGGCCTGCTTCTCCTGCCTTGGG + Intergenic
1200215042 X:154364473-154364495 CGCCCTGCTGCTCCTGCTTGGGG - Intronic
1200747720 Y:6917093-6917115 CGGCCTGAGGCCCAAGGCTGGGG - Intronic