ID: 1083847681

View in Genome Browser
Species Human (GRCh38)
Location 11:65345488-65345510
Sequence GGCCTGATGCTCCTGGCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 274}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083847672_1083847681 0 Left 1083847672 11:65345465-65345487 CCCCAGAAGCTAGAGAGCCCCAC 0: 1
1: 0
2: 1
3: 10
4: 135
Right 1083847681 11:65345488-65345510 GGCCTGATGCTCCTGGCTGAGGG 0: 1
1: 0
2: 1
3: 21
4: 274
1083847673_1083847681 -1 Left 1083847673 11:65345466-65345488 CCCAGAAGCTAGAGAGCCCCACG 0: 1
1: 0
2: 0
3: 7
4: 112
Right 1083847681 11:65345488-65345510 GGCCTGATGCTCCTGGCTGAGGG 0: 1
1: 0
2: 1
3: 21
4: 274
1083847674_1083847681 -2 Left 1083847674 11:65345467-65345489 CCAGAAGCTAGAGAGCCCCACGG 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1083847681 11:65345488-65345510 GGCCTGATGCTCCTGGCTGAGGG 0: 1
1: 0
2: 1
3: 21
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083847681 Original CRISPR GGCCTGATGCTCCTGGCTGA GGG Intronic
900210672 1:1454351-1454373 GGGCTGACGCTGCTGGCTGTCGG + Exonic
900216545 1:1485022-1485044 GGGCTGACGCTGCTGGCTGTCGG + Exonic
900223626 1:1522750-1522772 GGGCTGACGCTGCTGGCTGTTGG + Exonic
900503294 1:3017012-3017034 GGCCAGATCCCTCTGGCTGAGGG - Intergenic
900550303 1:3251222-3251244 GGCCTGGAGCTCAAGGCTGAGGG - Intronic
900899961 1:5509656-5509678 GGCCTCATCCTCCTGCCTGTCGG - Intergenic
900922803 1:5684401-5684423 AGGCTGATGCTGCTGGCTGGAGG - Intergenic
901133955 1:6980769-6980791 GGCCTCATGATCATGGCGGAAGG - Intronic
901209187 1:7514975-7514997 GGCCTGATGATCCTGGGTGGAGG - Intronic
903130274 1:21274631-21274653 GGCCTTATGTTCCTGAGTGAGGG - Intronic
903218482 1:21855736-21855758 GGCCTGACTCTCCTGGGTGTGGG - Intronic
903647561 1:24904370-24904392 GGAGTGATGCTCCTGGCTTAAGG + Intronic
904529329 1:31157710-31157732 GGCCTGAAACTCCTGGCCCAAGG + Intergenic
905570925 1:39004886-39004908 ACCCTGATGCTCCTGGCTCCAGG - Exonic
907751551 1:57268128-57268150 GGCCAGATGCTCCTTGCTTTGGG - Intronic
908100520 1:60786327-60786349 TGGCTGCTGCACCTGGCTGAAGG + Intergenic
908305986 1:62816760-62816782 GGCCAGATGCTCTTGGCTCAAGG + Exonic
909795886 1:79735404-79735426 GGCCTCATAATCATGGCTGAAGG + Intergenic
911881792 1:103249056-103249078 GGCCTGATGATCTTGCCTGCTGG + Intergenic
914343611 1:146779921-146779943 AGAGTGATGATCCTGGCTGAAGG + Intergenic
916271095 1:162942473-162942495 GGTTTGATATTCCTGGCTGAGGG + Intergenic
917966594 1:180182875-180182897 GGCCCAATGCTCCTGCCTGCGGG - Intronic
920270829 1:204762503-204762525 GGCGTGATGGTGCTGGCTGTTGG + Intergenic
921265740 1:213419233-213419255 GACCTTTTGCTGCTGGCTGAGGG - Intergenic
921286255 1:213612089-213612111 CTGCTGATGCTTCTGGCTGAGGG - Intergenic
922336405 1:224622038-224622060 GGCCTCATGATCATGGCAGAAGG - Intronic
922794406 1:228332996-228333018 GGAGTGATGCTGCTGGGTGAGGG + Intronic
922894064 1:229087414-229087436 GCCCTGCTGGTCCTGGCTGCAGG - Intergenic
924794271 1:247281287-247281309 TGTCTGCTGCTCCAGGCTGAGGG + Intergenic
1063286585 10:4695005-4695027 GGCCAGCTGCTTCTGGGTGATGG + Intergenic
1064420126 10:15183880-15183902 GGCCTCACGTTCATGGCTGAAGG + Intergenic
1064426862 10:15237083-15237105 GCCTTGAGGCTCCTGGGTGATGG + Intronic
1064934814 10:20667994-20668016 AGCCTGGTGCTCCAGGCAGAAGG + Intergenic
1067096867 10:43307320-43307342 GGCCCTCTGCTCCTGGTTGAGGG + Intergenic
1067144520 10:43684795-43684817 GGCCTCATGATCATGGCAGAAGG - Intergenic
1067449993 10:46376255-46376277 GGCATACTGCTCCTGGCAGAGGG + Intronic
1067587251 10:47483508-47483530 GGCATACTGCTCCTGGCAGAGGG - Intronic
1067634309 10:47991275-47991297 GGCATACTGCTCCTGGCAGAGGG - Intergenic
1070841807 10:79492603-79492625 GGCCTGAGGCTGCTTGCTTATGG + Intergenic
1073462208 10:103672342-103672364 GGCCTATTGCTCTTGTCTGATGG + Intronic
1073801351 10:107045049-107045071 GGCCTGATACCCCAGACTGAAGG - Intronic
1075686757 10:124369698-124369720 GGCCTCATGATCATGGCAGAAGG - Intergenic
1076155539 10:128202340-128202362 GGCCTCATGATCATGGCAGAAGG + Intergenic
1076250509 10:128980598-128980620 TGCCAGATGCCGCTGGCTGATGG + Intergenic
1076684670 10:132192713-132192735 GGCCTGATGGTCCTTCCTGGTGG + Exonic
1076836294 10:133022640-133022662 GGTCTGAGGCTCCTGGCTCTGGG + Intergenic
1079181802 11:18200566-18200588 GGCCTCATGATCATGGCAGAAGG + Intronic
1079182072 11:18202514-18202536 GGCCTCATGATCATGGCAGAAGG + Intronic
1081108163 11:39099251-39099273 GGCCTCATGGTCATGGCGGAAGG + Intergenic
1081166951 11:39819189-39819211 GGCCTCACGCTCATGGCGGAAGG + Intergenic
1083486981 11:62989420-62989442 GGCCTGACTATCCTGGCTGACGG + Intronic
1083689973 11:64401719-64401741 GGCCAGCTGCTTCTGGGTGATGG - Intergenic
1083826140 11:65205121-65205143 GGCCTGCTGCTCTTGGAGGAGGG + Intronic
1083847681 11:65345488-65345510 GGCCTGATGCTCCTGGCTGAGGG + Intronic
1084399819 11:68937023-68937045 GGCCTGCTGCTCCTTGCTGGCGG - Exonic
1084511376 11:69606429-69606451 GGACTGATGCTTCTGGCTTATGG + Intergenic
1084783665 11:71429115-71429137 GTCTTGATGATCCTGGCTGTGGG + Intronic
1084960815 11:72715389-72715411 GCCCTGGTGTTCCTGGCTGATGG + Intronic
1084980648 11:72826856-72826878 GGCCTGGGGCTCCTGGCTGGTGG - Intronic
1088911554 11:114196191-114196213 GGCCTGGTGCTCCTGGAGGCTGG - Intronic
1089494997 11:118903310-118903332 GGCCTGATGCCCCTGGGGGCGGG - Exonic
1090413716 11:126526653-126526675 GTCCTGGGGCTGCTGGCTGAAGG + Exonic
1090660790 11:128880437-128880459 CGCCTGATCCTCGTGGCTGGTGG - Intergenic
1090920916 11:131205186-131205208 GGCCTGTAGCTGCTGGCTGGAGG - Intergenic
1091076583 11:132623705-132623727 GGTCTGATGCCCCTGGCACAGGG + Intronic
1096799350 12:54099357-54099379 AGGCTGAAGCCCCTGGCTGAGGG - Intergenic
1099134949 12:78885647-78885669 GGCCAGGTGCTGCAGGCTGAGGG + Intronic
1101076014 12:101130574-101130596 GGCCTCATGATCATGGCAGAAGG + Intergenic
1101117947 12:101550238-101550260 GGCCTCATAATCATGGCTGAAGG + Intergenic
1102355483 12:112231282-112231304 AGAGGGATGCTCCTGGCTGAGGG - Intronic
1102553952 12:113713591-113713613 GGCCTCATGATCATGGCAGAAGG + Intergenic
1102687182 12:114734279-114734301 GGCCTGGTGCTCCAGGAGGAGGG - Intergenic
1103572572 12:121854848-121854870 TGCCTGCTGCTCCTGCCTGGTGG + Intronic
1105280877 13:18961932-18961954 AGCCTGAGGCTCTTGGCTGTGGG - Intergenic
1105720392 13:23107955-23107977 GGGTTGTTGCTGCTGGCTGATGG - Intergenic
1106139318 13:26998340-26998362 AGCCTCATGCTCGTGCCTGAGGG - Intergenic
1106809967 13:33350035-33350057 GGCCTGGTGCTCCATGCTGGCGG - Intronic
1109721244 13:66278519-66278541 GGCCTCATGATCATGGCAGAAGG + Intergenic
1109906084 13:68844383-68844405 GGCCTCATGATCATGGCAGAAGG - Intergenic
1110250802 13:73378217-73378239 GGCCTCATGATCATGGCAGAAGG + Intergenic
1111313113 13:86516382-86516404 GGCCTCAGAATCCTGGCTGAAGG + Intergenic
1112391925 13:98992828-98992850 CTCCTGATGCTGCTGGCTCAGGG + Intronic
1113439814 13:110319587-110319609 GGCCTGACTCACCTGGCTGTTGG - Intronic
1115134953 14:30096624-30096646 GGCCTGATAATCATGGCAGAAGG - Intronic
1116872908 14:50084725-50084747 GGCCTTATGATCCTGGCTCGTGG + Intronic
1117880685 14:60310412-60310434 GGCTAGATGCTTCTGGCTGTTGG + Intergenic
1118051721 14:62036606-62036628 GGCCTCATGATCATGGCAGAAGG + Intronic
1118074258 14:62281181-62281203 GGCCTCAGGCTCCTAGTTGAGGG + Intergenic
1118336352 14:64856428-64856450 GGCATGATGCTGATGGCTCAGGG - Intronic
1119780352 14:77272873-77272895 GACCTGCTGCACCTGGCTGCAGG - Intergenic
1120649290 14:87112218-87112240 GGCCTGATGCTAATGGCAGTGGG - Intergenic
1126088190 15:45028463-45028485 GTTCAGATGCTCCTGCCTGAAGG - Intronic
1127286858 15:57540308-57540330 GGCCTTATGATCATGGCTGAAGG + Intronic
1129462008 15:75704320-75704342 GGCCTGAGCCAGCTGGCTGATGG - Intronic
1129879187 15:78995965-78995987 GTCCTGGCGCTCCTGGCTGTGGG + Intronic
1130229304 15:82084476-82084498 GGCCTGGAGCGTCTGGCTGAGGG - Intergenic
1130656744 15:85796663-85796685 GGGTTGCTGCTCCTGGCTGGGGG - Intergenic
1130910771 15:88269513-88269535 TGCCCGAGGCTCCTGGCAGAAGG + Intergenic
1131070201 15:89461253-89461275 GGCCTGAGGTGCCTGACTGAGGG - Intergenic
1131417047 15:92269184-92269206 ATCCTGATGCTCCTGGCCCAGGG + Intergenic
1132338978 15:101066142-101066164 GGCCTGCAGGTGCTGGCTGAAGG - Exonic
1132457804 16:33753-33775 GGGCTGGTGCTCCTGCCTGGAGG - Intergenic
1132646175 16:1000284-1000306 GGCCTGGGGCTCCTGGCTGGAGG - Intergenic
1133731870 16:8585048-8585070 GGCCTCACAATCCTGGCTGAAGG + Intronic
1139350465 16:66331829-66331851 GGCCTCATGATCATGGCAGAAGG - Intergenic
1139640921 16:68290778-68290800 GGCCTGCTGCTCCCCACTGAAGG - Intronic
1139990380 16:70935413-70935435 AGAGTGATGATCCTGGCTGAAGG - Intronic
1142150759 16:88511595-88511617 GGCCTCCTACTCCTGGCAGATGG - Intronic
1142230842 16:88899621-88899643 GGTCTGATGCTCCTGGCTGGAGG - Intronic
1142558903 17:798383-798405 GGCCTGGTTTTCCTGGCTGCCGG + Intergenic
1142889065 17:2931223-2931245 GGGCTGATAAACCTGGCTGAGGG + Intronic
1143112354 17:4559692-4559714 GCCCTGCTGCTGCTGGCTGTTGG - Exonic
1144701769 17:17345078-17345100 GGCCTGGTGCTCCTGGGAGCTGG + Intronic
1145751361 17:27357268-27357290 GGCAGGATGCTCCTGGCAGAGGG - Intergenic
1148301012 17:46548846-46548868 TGCCTTATGCTCTTGGGTGAAGG - Exonic
1148454263 17:47802481-47802503 GGCCTGATACTCCACGCAGATGG + Intergenic
1148464616 17:47857533-47857555 GGCCTGAAGGTCCAGGTTGAGGG - Intergenic
1151540975 17:74764375-74764397 GGCCTGAGGCTCCTAGAAGAGGG + Intronic
1152167401 17:78718996-78719018 GGACTGCTGCTCCTGCCGGAAGG - Intronic
1152230305 17:79110998-79111020 GGGCTGCAGCTCCTGGCTGAGGG + Intronic
1152583717 17:81180072-81180094 GGCCTGGAGCTCCAGGCTGCTGG - Intergenic
1152646540 17:81471477-81471499 AGCCTGAGGCTCCTGACTGCTGG - Intergenic
1156369945 18:36464464-36464486 GGCCTGAGCCTCCTGGGTGCTGG - Intronic
1156465454 18:37345717-37345739 GTCCTGCTGCTCTAGGCTGAAGG + Intronic
1160710708 19:549785-549807 GGCCTGATGCCCTGGGGTGATGG + Exonic
1161961984 19:7528195-7528217 GGCCTGGGTCTCCAGGCTGATGG - Exonic
1163148712 19:15398976-15398998 GGCCTGATGCCCCTGAGGGAGGG - Intronic
1163432658 19:17277539-17277561 GGATGGATGCTCCAGGCTGAGGG - Intronic
1163721409 19:18899876-18899898 GGCCTGGTACTCCTTGATGAAGG + Exonic
1164654214 19:29909122-29909144 TGCCTGCTGCTCCTGGCTCCAGG + Intergenic
1165013027 19:32862460-32862482 GGGCTGGTGCTCCTGGCCCAAGG - Exonic
1165487319 19:36103607-36103629 GGCCTGAAGCTCCTGGCCCAAGG - Exonic
1165497415 19:36161413-36161435 GGCCAGTTGCTTCTGGGTGATGG + Intergenic
1167144610 19:47674168-47674190 GGCCCGGTGCTCCTGGCAGAGGG + Intronic
1167243320 19:48358531-48358553 GGCCTGAGCCTCCTGGAGGATGG - Intronic
1167712283 19:51119817-51119839 TGCCTGGTGCTCATGGCTCAAGG + Intergenic
1168046546 19:53798279-53798301 GGCCTGTGGTTGCTGGCTGAGGG - Exonic
925011513 2:488939-488961 AGCATGAGGGTCCTGGCTGAGGG - Intergenic
925799578 2:7584779-7584801 GGCCTCACGATCCTGGCAGAAGG - Intergenic
927105215 2:19818321-19818343 GCTCTGATGTCCCTGGCTGATGG - Intergenic
928907518 2:36382698-36382720 GGCCTGTGTCTCCTGGCTCAAGG + Intronic
931079323 2:58751910-58751932 GGCCTCATGATCATGGCAGAAGG - Intergenic
931343467 2:61425398-61425420 GGCCTTTTGCTGCTGGCTGGGGG - Intronic
932708852 2:74047575-74047597 AGCCTTCTGCTCCTGGCTGGTGG + Exonic
933713427 2:85343919-85343941 GGCCTGATTCCCCTGTCTCAAGG + Intronic
934061406 2:88297640-88297662 AGCCTGAAACTCCTGGCTCAAGG + Intergenic
934770126 2:96902536-96902558 GGCCTGATGTTCCTGGCCTTTGG + Intronic
936572281 2:113627088-113627110 GGACTGGGGCTCCTGGCTGTGGG - Intergenic
937547005 2:123035443-123035465 GGCCTCATAATCATGGCTGAAGG + Intergenic
937800766 2:126077923-126077945 GGCCTCATAATCATGGCTGAGGG - Intergenic
938076779 2:128343718-128343740 GGGCTGATCCTCCTGACTAAGGG + Intergenic
939189652 2:138901707-138901729 GGCATCATCCTGCTGGCTGAGGG - Intergenic
942455700 2:176136824-176136846 GGCCGGCTGCTCCTGGCAGGCGG - Intergenic
942640758 2:178058506-178058528 GGCCTCACACTCCTGGCAGAAGG - Intronic
946189753 2:218002090-218002112 GGGCTGAGGCTCCTGGGTAAAGG - Intronic
946248911 2:218401464-218401486 GGCAAGATCCTCCTGGCTCAGGG + Intronic
946507883 2:220321098-220321120 GGCCAGCTGCTTCTGGGTGATGG - Intergenic
946995821 2:225389864-225389886 GGCATGAGGCACTTGGCTGAGGG + Intergenic
947717705 2:232350210-232350232 GGCCTGGTGCTACTGGCTGCAGG + Intergenic
948075569 2:235162935-235162957 GGCCCGATGCTCCCAGCTGGAGG + Intergenic
948464470 2:238145624-238145646 GGCCTGGTGCCCCAGGCTGGTGG + Intronic
948626935 2:239275196-239275218 GGCCTGGTGGTCTGGGCTGAGGG - Intronic
948688693 2:239688365-239688387 GGAGAGCTGCTCCTGGCTGAGGG - Intergenic
949026349 2:241768129-241768151 TGCCAGATGCTCCTGCCCGAGGG - Exonic
1168979325 20:1991425-1991447 AGACTGATGCTCCTGGCAGGAGG - Intronic
1170829813 20:19830471-19830493 GGGCTGAGGCTTGTGGCTGATGG - Intergenic
1171096795 20:22340057-22340079 GGCCAGATGCTCCTGGCAAGGGG + Intergenic
1171234085 20:23510231-23510253 GCCCTGAGGCTCCTGGAGGAAGG - Intergenic
1171817625 20:29802371-29802393 GGCCTCACGCTCATGGCAGAAGG - Intergenic
1172482478 20:35278966-35278988 GCCCTGTGGCTGCTGGCTGAGGG - Exonic
1172753955 20:37270482-37270504 TGCCTGATGAGCCAGGCTGAGGG - Intergenic
1174409298 20:50323122-50323144 GGCATGTTTCTCCTGGCTCAAGG - Intergenic
1174896436 20:54454283-54454305 GGCCTCATGTTCATGGCAGAAGG - Intergenic
1175151093 20:56935104-56935126 GGCCTCATTGTCCTGGCTGCAGG - Intergenic
1175575309 20:60056518-60056540 GGCCTGAGGCTCCCGTGTGAGGG + Intronic
1175611191 20:60352613-60352635 GGCCTGGTGCTCAGAGCTGATGG + Intergenic
1175774552 20:61644785-61644807 GGACTGCTGTTCCTGGCTGACGG - Intronic
1175892566 20:62322062-62322084 CACCTGATGCTGCTGGCTGCAGG + Exonic
1176099307 20:63357726-63357748 TGCCTGATGCTCCTGGGTGCTGG - Intronic
1176240455 20:64073574-64073596 GGCCCAGTGCTCCTGGCTGGGGG - Exonic
1176926713 21:14758843-14758865 GGCCTGATGCTCTTCCCAGAAGG - Intergenic
1177599121 21:23288173-23288195 GGCCTCATGATCATGGCAGAAGG - Intergenic
1177852625 21:26366665-26366687 GGCTTGGTGGTTCTGGCTGAGGG + Intergenic
1178830770 21:36054640-36054662 GATTTGATGCTCCTGGCTCATGG + Intronic
1178830797 21:36054776-36054798 GATTTGATGCTCCTGGCTCATGG + Intronic
1178830809 21:36054844-36054866 GATTTGATGCTCCTGGCTCATGG + Intronic
1178830821 21:36054912-36054934 GATTTGATGCTCCTGGCTCATGG + Intronic
1179422151 21:41245267-41245289 GACCTGATCCTCCTGCCTTAAGG - Intronic
1179785919 21:43729496-43729518 CGGCTGATGCCCCTGGCTGCTGG - Intronic
1181082629 22:20424941-20424963 GGCCTGGTGCCTCTGGCTGGAGG - Exonic
1181779237 22:25180950-25180972 GGCCGGCTCCTCCAGGCTGATGG - Intronic
1182554777 22:31123197-31123219 TCCCTGGTGCTCCTGACTGAGGG + Intronic
1184098656 22:42330029-42330051 GGCCTTAAGCTCTTGCCTGATGG - Intronic
1185383110 22:50519204-50519226 GGCCCGATGCCCCTGGGTGGGGG + Exonic
1185427907 22:50783792-50783814 GGACTGGGGCTCCTGGCTGTGGG + Intergenic
949476014 3:4446392-4446414 GGCCTCATAATCATGGCTGAAGG - Intronic
949624748 3:5853204-5853226 GGCCTCAGGCTCCTGCCTGGTGG + Intergenic
950469065 3:13173484-13173506 GGCCTCCTGCTCCTGGAGGAAGG + Intergenic
950552991 3:13678345-13678367 GAGCTGCTGCGCCTGGCTGATGG + Intergenic
950725349 3:14913632-14913654 GGCCAGATGCAAATGGCTGAGGG - Intronic
951043271 3:18011577-18011599 GGCCGGACGCACCTGGCTGTAGG - Intronic
953657521 3:44865287-44865309 GGCCTGCTTCCCTTGGCTGATGG - Exonic
953871537 3:46631137-46631159 GGCGTGAGGCTCCTGGATCAGGG + Intergenic
954854850 3:53635346-53635368 GACCTGATGCCCCAGGCTTAGGG + Intronic
955496948 3:59543188-59543210 GGCCTGCTGCACCTGCCAGAGGG - Intergenic
955520116 3:59767511-59767533 GGAGTGGTGTTCCTGGCTGAAGG + Intronic
961531747 3:127544334-127544356 GGCCTCACGCACCTGGCTGGAGG + Intergenic
962324490 3:134422151-134422173 GGCCTGCTGCTTCTGGGTGATGG + Intergenic
962875921 3:139536061-139536083 GGGCCACTGCTCCTGGCTGATGG + Intronic
965202270 3:165674930-165674952 GGCCTCATGATCATGGCAGAAGG - Intergenic
967706399 3:192656019-192656041 TGCCTGAACCTCCTGGATGAGGG - Intronic
968007837 3:195255155-195255177 CGACTGAAGCTCCTTGCTGAGGG - Intronic
968641811 4:1718556-1718578 GGCCTCAGGGGCCTGGCTGAGGG + Exonic
968976293 4:3823845-3823867 GGCCTGATGCTCCCGCCTCTGGG - Intergenic
969443442 4:7231197-7231219 GAGCTGATGCTCCAGGTTGAAGG + Intronic
969595922 4:8149218-8149240 GGCCTGAGGCTTCTCGCTAACGG - Intronic
970938016 4:21597319-21597341 GGCCTCATGATCATGGCCGAAGG - Intronic
972240860 4:37190135-37190157 GGCCTCATGATCATGGCAGAAGG + Intergenic
973598189 4:52513804-52513826 GGCCTCATGATCATGGCGGAAGG - Intergenic
974013813 4:56630874-56630896 GGCATGATGCTCTAGGCTGGTGG - Intergenic
978643944 4:110906443-110906465 GGGCTGCTGCTCTTGGCTGGGGG + Intergenic
979950358 4:126885442-126885464 GTCTAGATCCTCCTGGCTGAGGG - Intergenic
982921974 4:161287418-161287440 TGCCTCATGCCTCTGGCTGAGGG + Intergenic
984825269 4:183918815-183918837 GGCCTGGGGCTCCGGGATGACGG + Intronic
985067265 4:186134773-186134795 GGCCTGCTGCTGCTTGGTGAAGG - Intronic
985965751 5:3337966-3337988 GCTCTGGTGCTCCTGGCTGGGGG + Intergenic
987207153 5:15639515-15639537 GGCCTCATGATCATGGCAGAAGG - Intronic
988386189 5:30568346-30568368 GTACTTATGTTCCTGGCTGAGGG - Intergenic
990944707 5:61237824-61237846 GTTCTGATGCTCGTGGCTGATGG - Intergenic
991339862 5:65596803-65596825 GGATTGGTGATCCTGGCTGAGGG - Intronic
993133928 5:83933101-83933123 GGCCTCATGATCATGGCGGAAGG - Intergenic
994075405 5:95644387-95644409 AGCCTGATGCTCACGGCAGAGGG + Intergenic
995475847 5:112547519-112547541 GGCCAGCTGCTTCTGGGTGACGG - Intergenic
1000391794 5:160730239-160730261 GTCCTGATGCCCATGGCTGTGGG - Intronic
1000793338 5:165633664-165633686 GGCCTGATCTTCCTGCCTCAGGG + Intergenic
1001419700 5:171577319-171577341 GGCCGGAAGCTGCTGGCTGCAGG + Intergenic
1002615602 5:180453388-180453410 GGGTTGCTGCTCCTGGCTGGGGG - Intergenic
1003398403 6:5772252-5772274 GGCATGATGCTAGAGGCTGATGG + Intergenic
1003557280 6:7151426-7151448 GGCCTGCTGCTCCTGGGGGCTGG - Intronic
1004483795 6:16046504-16046526 GACCTCATGATCATGGCTGAAGG - Intergenic
1004627756 6:17393314-17393336 ATCCGGAGGCTCCTGGCTGAAGG - Exonic
1005153478 6:22778475-22778497 GGCCTCATGATCATGGCAGAAGG - Intergenic
1006919633 6:37618997-37619019 AGCCTCACGCTCCTGGCTGTTGG - Intergenic
1007983225 6:46180400-46180422 GGCCAGCTGCTTCTGGGTGATGG - Intergenic
1009723596 6:67507337-67507359 GGCCTCACAATCCTGGCTGAAGG + Intergenic
1011538480 6:88404137-88404159 GGCCTAATGCTCCTTTCTGTTGG - Intergenic
1011726570 6:90215844-90215866 GACCTGCTGCTTCTGGCTAAGGG - Intronic
1012169305 6:95999051-95999073 GGCCTCATGATCATGGCAGAAGG + Intergenic
1013076894 6:106779781-106779803 GGCCTCATGATCATGGCAGAAGG - Intergenic
1014068992 6:117159687-117159709 TGCCTGAGGCTGGTGGCTGAGGG + Intergenic
1015747963 6:136530850-136530872 GACCTGGTACTTCTGGCTGATGG - Intronic
1016304186 6:142666190-142666212 GGCCTCACAATCCTGGCTGAAGG + Intergenic
1016834564 6:148464481-148464503 GGCCTGGGGCTTCTGGCTGGAGG + Intronic
1016879363 6:148895751-148895773 GGCCTCACGATCATGGCTGAAGG - Intronic
1017477841 6:154816437-154816459 GGCCTGATGCTTTTCCCTGAGGG + Intronic
1019542991 7:1559817-1559839 GGCCTGCTCCTCCTGGCTGTGGG - Intronic
1020281508 7:6652503-6652525 GGCCTGGGGGTCCTGGCCGACGG + Exonic
1023151004 7:37201499-37201521 TGCCTGATGTTCATGGCAGATGG - Intronic
1027179227 7:75926400-75926422 GTTCCGATACTCCTGGCTGAAGG + Intronic
1029280928 7:99435060-99435082 TTCCTGACGCTCCTGGCCGAGGG + Exonic
1032089905 7:128906294-128906316 GGCAGCATGCTCCTGGCTCAGGG + Exonic
1032092339 7:128917240-128917262 GGCAGCATGCTCCTGGCTCAGGG - Intergenic
1033437589 7:141347572-141347594 AGCAAGATGCTCGTGGCTGAGGG + Intronic
1034863354 7:154619090-154619112 GGCCTCATCATCATGGCTGAAGG - Intronic
1035600394 8:893823-893845 GGCCCCATGCTGCTGGCCGAAGG - Intergenic
1036706062 8:11048236-11048258 GGCCGGATTCCCCTTGCTGATGG - Intronic
1036945141 8:13088160-13088182 GGCCTCAAACTCCTGGCTCAAGG + Intronic
1037601118 8:20395034-20395056 GGAGTGATGCTCTTGTCTGAAGG - Intergenic
1038006815 8:23437532-23437554 GGCCTGATGTTCCCAGCTGCTGG + Intronic
1041203164 8:55471386-55471408 GTGCTGATGCTGCTGGTTGAGGG - Intronic
1044574442 8:93752878-93752900 GGCCTGATCCTCCAGGCAAATGG - Intergenic
1049159928 8:141090387-141090409 CTCCTGCTGCTCCTGGCTCAGGG - Intergenic
1049361285 8:142213590-142213612 GGCCTTTTGCTCCTGGCCGCAGG - Intronic
1049542444 8:143214680-143214702 GGCCTGGTGCTCCTGGAGGCAGG + Intergenic
1050141810 9:2523864-2523886 GGCTTAATGCTTGTGGCTGAGGG - Intergenic
1051341472 9:16115931-16115953 GGCCTGACAATCCTGGCAGAAGG + Intergenic
1051710723 9:19927957-19927979 GGTCTGCTGCACCTGGCTGGGGG + Intergenic
1052712183 9:32070138-32070160 GGCCAGTTGCTCCTGTCTGGTGG - Intergenic
1053201621 9:36155854-36155876 GGTCTGGAGCTCCTGGATGAAGG - Intronic
1053739401 9:41124245-41124267 GGCCAGGTGCTACTGCCTGAGGG + Intergenic
1054688950 9:68307077-68307099 GGCCAGGTGCTACTGCCTGAGGG - Intergenic
1054990428 9:71319409-71319431 GCACTGATGCTCCTGGCTCTTGG - Intronic
1055003875 9:71483850-71483872 TGCCCTGTGCTCCTGGCTGATGG - Intergenic
1056664628 9:88571863-88571885 GTCCTGGCTCTCCTGGCTGAAGG - Intronic
1056756606 9:89385747-89385769 TGCCTGTTGCTCCCAGCTGAGGG + Intronic
1057181824 9:93034713-93034735 GGCCTGAGGCTCTGGGCTGCTGG - Intronic
1060526339 9:124323353-124323375 GGCCTGTTGCTCCAGGCTCGGGG + Intronic
1061545527 9:131302148-131302170 GTCCTGGTGCTTCTGGCCGAGGG - Intronic
1062319308 9:135982664-135982686 GGACCGCTCCTCCTGGCTGATGG - Intergenic
1062480379 9:136748231-136748253 GCCCTGAGGCTCCTGCCTGTGGG + Intronic
1185767894 X:2740855-2740877 TGCCTGAGGCTCCTCCCTGAAGG + Exonic
1191111435 X:56805664-56805686 GGGCTGACTCTCTTGGCTGATGG + Intergenic
1192073168 X:67962328-67962350 AGCCTGAGGCTTCTGGCTTAAGG + Intergenic
1195544908 X:106103309-106103331 GGCCAGATGCTTCAGGGTGATGG - Intergenic
1198308109 X:135402432-135402454 GGCCAGATGCTTCTGGGTGATGG + Intergenic
1198587944 X:138143540-138143562 GTACAGATGCTCCTGGCTCAGGG + Intergenic
1201912325 Y:19145432-19145454 GGCCTCATGGTCATGGCAGAAGG - Intergenic