ID: 1083847682

View in Genome Browser
Species Human (GRCh38)
Location 11:65345489-65345511
Sequence GCCTGATGCTCCTGGCTGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 217}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083847674_1083847682 -1 Left 1083847674 11:65345467-65345489 CCAGAAGCTAGAGAGCCCCACGG 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1083847682 11:65345489-65345511 GCCTGATGCTCCTGGCTGAGGGG 0: 1
1: 0
2: 1
3: 19
4: 217
1083847672_1083847682 1 Left 1083847672 11:65345465-65345487 CCCCAGAAGCTAGAGAGCCCCAC 0: 1
1: 0
2: 1
3: 10
4: 135
Right 1083847682 11:65345489-65345511 GCCTGATGCTCCTGGCTGAGGGG 0: 1
1: 0
2: 1
3: 19
4: 217
1083847673_1083847682 0 Left 1083847673 11:65345466-65345488 CCCAGAAGCTAGAGAGCCCCACG 0: 1
1: 0
2: 0
3: 7
4: 112
Right 1083847682 11:65345489-65345511 GCCTGATGCTCCTGGCTGAGGGG 0: 1
1: 0
2: 1
3: 19
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083847682 Original CRISPR GCCTGATGCTCCTGGCTGAG GGG Intronic
900469601 1:2847229-2847251 GACTGGTGCACCTGGCTGGGGGG - Intergenic
900899373 1:5506518-5506540 CCCTGATCCTCCTGGCTCCGTGG - Intergenic
901209186 1:7514974-7514996 GCCTGATGATCCTGGGTGGAGGG - Intronic
902835298 1:19043385-19043407 GCCTGGGGCTCCTGGCTCTGGGG + Intergenic
903130273 1:21274630-21274652 GCCTTATGTTCCTGAGTGAGGGG - Intronic
904842637 1:33383097-33383119 GCCTTATGCCTCTGGCGGAGGGG - Intronic
905570923 1:39004885-39004907 CCCTGATGCTCCTGGCTCCAGGG - Exonic
905875319 1:41428385-41428407 GCTTTGTGCTCCAGGCTGAGCGG + Intergenic
906282680 1:44565229-44565251 GCCTTATTCTCCTGGTTCAGTGG - Intronic
906577669 1:46905351-46905373 GCCTTCTTCTCCTGGTTGAGCGG - Intergenic
907751550 1:57268127-57268149 GCCAGATGCTCCTTGCTTTGGGG - Intronic
907888868 1:58619385-58619407 GCCTGGTGCTTCTGGGAGAGTGG - Intergenic
908140475 1:61179247-61179269 GACTGATGCACCTGGCTTTGGGG + Intronic
911645802 1:100336214-100336236 ACCTGATGTTCCTGGTTGGGCGG - Intergenic
912940173 1:114037728-114037750 GCCTGATGTTTCTGGTTGGGGGG + Intergenic
913969893 1:143406668-143406690 GCCTGGTGCTCCAGGGTGACAGG + Intergenic
914064267 1:144232262-144232284 GCCTGGTGCTCCAGGGTGACAGG + Intergenic
914114883 1:144734092-144734114 GCCTGGTGCTCCAGGGTGACAGG - Intergenic
917966593 1:180182874-180182896 GCCCAATGCTCCTGCCTGCGGGG - Intronic
921182752 1:212644530-212644552 GCCAGGTGCTCCTGGATGTGTGG - Intergenic
921269182 1:213451897-213451919 GCCTGGTGCTCCAGCCTGGGTGG + Intergenic
921286254 1:213612088-213612110 TGCTGATGCTTCTGGCTGAGGGG - Intergenic
923255649 1:232219313-232219335 GCCTGCTGCTCCTGTCTGGCAGG - Intergenic
923553275 1:234980889-234980911 GGCTGCTGGTCTTGGCTGAGCGG - Intergenic
923663578 1:235979571-235979593 TCCAGATGCTCCTGACTGTGTGG - Intronic
924790803 1:247245912-247245934 GGCTGTGGCTCCAGGCTGAGTGG - Intergenic
1063066211 10:2611901-2611923 TACTGGTGCTCATGGCTGAGAGG + Intergenic
1063604844 10:7514103-7514125 ATCTGGTGCTCCTGGCTGTGTGG + Intergenic
1063985071 10:11493742-11493764 GTCTGCTGCTCCTGCCTGTGCGG + Intronic
1067297335 10:44982377-44982399 GGCTGATGGTCCTTCCTGAGGGG + Intronic
1067526631 10:47043271-47043293 CCCTGAGGCTCCCGGCTGACAGG + Intergenic
1068927289 10:62553713-62553735 GGCTGATTGGCCTGGCTGAGAGG - Intronic
1071377531 10:85024045-85024067 GTTTGATTCTCCTGGCTGAAAGG - Intergenic
1071912101 10:90247856-90247878 GCATCATGCCCCTGGCTGGGTGG + Intergenic
1073544303 10:104336022-104336044 GCTTAAGGCACCTGGCTGAGGGG + Intronic
1076250510 10:128980599-128980621 GCCAGATGCCGCTGGCTGATGGG + Intergenic
1077216618 11:1397788-1397810 GCCTCATGGCACTGGCTGAGGGG + Intronic
1077454196 11:2668155-2668177 CCCTCATGCTCCTTGCTGACTGG + Intronic
1077533292 11:3107233-3107255 GCTTGGGGCTCCTGGCTGGGGGG + Intronic
1079347978 11:19669675-19669697 GCCAGAAGCACCTGGCTGAGTGG + Intronic
1079392395 11:20033972-20033994 ACCTGCCACTCCTGGCTGAGCGG + Intronic
1080933350 11:36837045-36837067 TCCTGCTACTCCTAGCTGAGTGG - Intergenic
1083847682 11:65345489-65345511 GCCTGATGCTCCTGGCTGAGGGG + Intronic
1084399818 11:68937022-68937044 GCCTGCTGCTCCTTGCTGGCGGG - Exonic
1084511377 11:69606430-69606452 GACTGATGCTTCTGGCTTATGGG + Intergenic
1084783666 11:71429116-71429138 TCTTGATGATCCTGGCTGTGGGG + Intronic
1084980647 11:72826855-72826877 GCCTGGGGCTCCTGGCTGGTGGG - Intronic
1086349678 11:85932952-85932974 GCCTGATGTTCCTGGTGGAGTGG + Intergenic
1087701848 11:101443931-101443953 GCCTGACATTCCTGGTTGAGGGG - Intergenic
1089494996 11:118903309-118903331 GCCTGATGCCCCTGGGGGCGGGG - Exonic
1094552064 12:31462286-31462308 GCCTGATTATCCTAGCAGAGTGG - Intronic
1096812897 12:54183014-54183036 GCCTGAGGCTTGGGGCTGAGAGG - Intronic
1099166689 12:79315554-79315576 GCATGATGCTCCAGGCTGACTGG + Intronic
1099369316 12:81811191-81811213 CCCTGTTGCTCCTGGGTGGGCGG - Intergenic
1100135889 12:91553002-91553024 GCCTGATAATCCTGGAGGAGAGG - Intergenic
1101501872 12:105311720-105311742 GCCTTCTTCTCCTGGTTGAGTGG - Intronic
1102037839 12:109782428-109782450 TCATGGTGCTCCTGGCTAAGTGG - Intergenic
1102355482 12:112231281-112231303 GAGGGATGCTCCTGGCTGAGGGG - Intronic
1105280876 13:18961931-18961953 GCCTGAGGCTCTTGGCTGTGGGG - Intergenic
1106139317 13:26998339-26998361 GCCTCATGCTCGTGCCTGAGGGG - Intergenic
1106170211 13:27282366-27282388 GCCTTATGATCCTGGGTGACCGG - Intergenic
1108519491 13:51233625-51233647 GATTTATGCTCCTGGCTGGGAGG - Intronic
1108762181 13:53581366-53581388 TCCTGAGGCACCTGGCTCAGTGG + Intergenic
1110625730 13:77653636-77653658 ACCTGATTCTGCTGTCTGAGAGG + Intergenic
1118336351 14:64856427-64856449 GCATGATGCTGATGGCTCAGGGG - Intronic
1121234159 14:92380072-92380094 GCCTGCTGCACCTGGCATAGGGG + Intronic
1122152534 14:99732692-99732714 GCCCCAAGCTCCTGGCTGTGTGG - Intergenic
1126169434 15:45682540-45682562 GGCTGATGCTGCTGGTTGGGTGG + Exonic
1128748107 15:70129199-70129221 GGCAGCTGCTTCTGGCTGAGAGG + Intergenic
1130656743 15:85796662-85796684 GGTTGCTGCTCCTGGCTGGGGGG - Intergenic
1130713922 15:86312847-86312869 GCCCAATGATCCTGCCTGAGGGG - Intronic
1132601854 16:776300-776322 GCAAGGTCCTCCTGGCTGAGAGG + Intronic
1135877103 16:26212867-26212889 GCCCTATGCTCATGGCTGTGGGG - Intergenic
1139156748 16:64452599-64452621 GCATGATGCTCTTGGCTGAGTGG - Intergenic
1141039062 16:80655865-80655887 GCATGATGCTCCTGAAGGAGAGG - Intronic
1142912092 17:3102927-3102949 TCCAGCTGCTCCTGTCTGAGAGG - Intergenic
1146399883 17:32494184-32494206 GCCACTGGCTCCTGGCTGAGGGG + Exonic
1148018033 17:44536378-44536400 GCCCAGTGCTCCTGGGTGAGTGG + Intergenic
1148216120 17:45834868-45834890 GCCAGCTGCTCCTGGGGGAGTGG - Exonic
1149449030 17:56735098-56735120 GCCTGATTCTCCTGGGGGTGGGG - Intergenic
1151187116 17:72372470-72372492 GCCTGTTGCTCCTGGGTGGCTGG - Intergenic
1151540976 17:74764376-74764398 GCCTGAGGCTCCTAGAAGAGGGG + Intronic
1152083773 17:78205137-78205159 CCATGATGCTCCTGGCCGACTGG + Exonic
1152230306 17:79110999-79111021 GGCTGCAGCTCCTGGCTGAGGGG + Intronic
1152317109 17:79587575-79587597 GGCTGAGGGTCCTGGCTGAGTGG - Intergenic
1152646539 17:81471476-81471498 GCCTGAGGCTCCTGACTGCTGGG - Intergenic
1152715728 17:81899644-81899666 GCATGATGAGCCTGGGTGAGGGG + Intronic
1155203002 18:23533891-23533913 GCCTTATGATCCTGGGGGAGAGG + Intronic
1157214987 18:45775306-45775328 GCCTGACACTCTTGGCTGGGCGG + Intergenic
1158411590 18:57210501-57210523 GCCTGCTGGTCCTGGCTAGGAGG - Intergenic
1159552458 18:69909384-69909406 GGCTGATGCTCAGGGGTGAGTGG - Intronic
1162350373 19:10145266-10145288 GCCAGTTGCTCCTGGCAAAGTGG - Intronic
1163148711 19:15398975-15398997 GCCTGATGCCCCTGAGGGAGGGG - Intronic
1164842949 19:31407773-31407795 GCCAGATGCTCCTGGGTGGCTGG + Intergenic
1165038208 19:33049857-33049879 TCCTGCTGCTCCAGGATGAGCGG + Intronic
1166379880 19:42350343-42350365 TCCCGATGCTCCTCGCAGAGTGG - Exonic
1168046545 19:53798278-53798300 GCCTGTGGTTGCTGGCTGAGGGG - Exonic
926699755 2:15795912-15795934 GCCTCCTGCTCCTGGAAGAGTGG - Intergenic
927392910 2:22615787-22615809 GCCAGGTGCTCCTGACAGAGAGG + Intergenic
927483071 2:23469449-23469471 GCCTGGTGCTGCGGGCTGCGTGG - Intronic
931007773 2:57871905-57871927 GCCTGAGGCTCCTGGTGGGGTGG + Intergenic
931808010 2:65826772-65826794 CCCTGTTGCTCCTGGCTGGCAGG + Intergenic
932795042 2:74687154-74687176 GGCTGTTGCTCCTGAGTGAGGGG - Intergenic
934061407 2:88297641-88297663 GCCTGAAACTCCTGGCTCAAGGG + Intergenic
934174585 2:89567581-89567603 GCCTGGTGCTCCAGGGTGACAGG + Intergenic
934284901 2:91641931-91641953 GCCTGGTGCTCCAGGGTGACAGG + Intergenic
934768509 2:96893954-96893976 GGCTGTTGCTCCTGGCAGGGTGG + Exonic
935174448 2:100637695-100637717 CCCTGATGATGCTGCCTGAGTGG + Intergenic
935579172 2:104741658-104741680 GCCTGAAGTTCCTTGTTGAGGGG + Intergenic
936956608 2:118028877-118028899 GCCTGACGTTCCTGGTAGAGGGG - Intergenic
937231640 2:120401415-120401437 GCCTGATGATCCTGCCTGGGAGG + Intergenic
937323074 2:120972494-120972516 TCCTGATTCTCCTGGGTGATAGG + Intronic
937323514 2:120974963-120974985 GCCAGCTGCTCCTGGGAGAGGGG - Exonic
943612070 2:190045427-190045449 GGCTGAAGGCCCTGGCTGAGAGG + Intronic
945720785 2:213416139-213416161 GCCAGAAGCTCTTGGCTGAATGG + Intronic
945814600 2:214589028-214589050 CCCTGATCCTCCTGGCCAAGTGG + Intergenic
946248912 2:218401465-218401487 GCAAGATCCTCCTGGCTCAGGGG + Intronic
946332508 2:219018376-219018398 CCCCGAGGGTCCTGGCTGAGGGG - Intronic
946341167 2:219070075-219070097 GCATTATGCTCCTTGCTGAATGG + Intergenic
946429108 2:219615181-219615203 GCCAGATGCTGCTGGAGGAGAGG - Exonic
946429465 2:219617039-219617061 GCCTGGAGCTGCTGGCTGTGGGG + Intergenic
946576477 2:221081420-221081442 GCATGATGCTGCTGGCCGGGTGG - Intergenic
947534767 2:230933687-230933709 GGCTGCTGCTCCTGGATAAGAGG - Intronic
947717706 2:232350211-232350233 GCCTGGTGCTACTGGCTGCAGGG + Intergenic
948146554 2:235712426-235712448 GCTTGATGCTTCTGTCAGAGGGG + Intronic
948205109 2:236159450-236159472 GCCCGATGCACCTGGCTCGGCGG - Intergenic
1168820368 20:768877-768899 GGCTGGTGCTCCAGGCTGGGAGG - Intergenic
1168871715 20:1134954-1134976 GCCTGCTGGACCTGGGTGAGGGG - Intronic
1168970256 20:1926163-1926185 GCCTGATGCTTCTGTCTGGGAGG + Intronic
1170846375 20:19965290-19965312 GCTTGATGGGCCTGGCTGAAAGG - Intronic
1172297374 20:33822651-33822673 GCTTGCTGCTCCTAGCTGACAGG + Intronic
1174487257 20:50869309-50869331 GCCTGAGGCTTCAGGCTCAGAGG + Intronic
1175378010 20:58542585-58542607 GCCAAATGCTTCTGGGTGAGAGG + Intergenic
1175575630 20:60058517-60058539 ACCTGATCCTCCTGGGAGAGGGG - Intronic
1175679323 20:60974226-60974248 GCCTCATGCTGCTGCCTGGGTGG - Intergenic
1178941283 21:36908858-36908880 TCCTGAGGCTCCAGGCTTAGGGG + Intronic
1179257595 21:39730158-39730180 CCCTGATGTTCCTGGGTTAGTGG + Intergenic
1179785918 21:43729495-43729517 GGCTGATGCCCCTGGCTGCTGGG - Intronic
1179888424 21:44324351-44324373 GCCTGGTGCTGCTGGCTGTCTGG + Intronic
1180622651 22:17172030-17172052 GCCTGCCAGTCCTGGCTGAGTGG - Intergenic
1181572047 22:23772996-23773018 GCCGGCCGCTCCTCGCTGAGGGG + Intronic
1182008140 22:26978652-26978674 AGCTGAAGCTCCAGGCTGAGAGG + Intergenic
1182012199 22:27010308-27010330 GCCTGATCCTCCTGGGTCATTGG + Intergenic
1182554779 22:31123198-31123220 CCCTGGTGCTCCTGACTGAGGGG + Intronic
1182630570 22:31682165-31682187 CCCTGCTGCTCTTGGCTCAGTGG + Exonic
1184583005 22:45429725-45429747 GCCAGATGGTCCAGGCAGAGCGG - Intronic
1184932315 22:47690489-47690511 GCTTGAGGCACCTGGCTGTGTGG + Intergenic
1185173198 22:49305245-49305267 GGCTGCAGCCCCTGGCTGAGGGG - Intergenic
950033025 3:9864350-9864372 GACAGCTGCTCCTGGCTGTGCGG + Intergenic
950054694 3:10015337-10015359 GACAGCTGCTCCTGGCTGTGCGG + Intergenic
950725348 3:14913631-14913653 GCCAGATGCAAATGGCTGAGGGG - Intronic
952399818 3:32953120-32953142 AACTGAAGCTCCTGGCAGAGAGG + Intronic
953052905 3:39362050-39362072 GCCTGTTGCCCCTGGCTGGCTGG - Intergenic
954152020 3:48662531-48662553 CCCAGCTCCTCCTGGCTGAGGGG + Exonic
955019514 3:55105758-55105780 GCCTGTCGCTCCTGGATGAAAGG + Intergenic
955496947 3:59543187-59543209 GCCTGCTGCACCTGCCAGAGGGG - Intergenic
962156932 3:132957423-132957445 GTCTGATGATCCTTGCTGGGAGG - Intergenic
962324491 3:134422152-134422174 GCCTGCTGCTTCTGGGTGATGGG + Intergenic
962449610 3:135501891-135501913 GCTTGATGTTTCTGGCTTAGTGG - Intergenic
963771302 3:149388967-149388989 GAGACATGCTCCTGGCTGAGAGG + Intergenic
967866330 3:194192997-194193019 GGCTGATTCTTCTGTCTGAGTGG + Intergenic
968569793 4:1333624-1333646 GCTGGCTGCTCCTGGGTGAGTGG + Intronic
968976292 4:3823844-3823866 GCCTGATGCTCCCGCCTCTGGGG - Intergenic
969305800 4:6325683-6325705 GCCTGGTGCTCTAGGATGAGAGG - Intronic
969828438 4:9776544-9776566 GCCTGGTGCTCCAGGGTGACAGG + Intronic
973611618 4:52640983-52641005 GCCTTAACTTCCTGGCTGAGAGG + Intronic
974340092 4:60603779-60603801 GCCTGTTGCTGCTGGCTGGCTGG + Intergenic
976625763 4:87179984-87180006 GGCTGATGCTGCTGGTCGAGGGG + Intronic
976968242 4:91072027-91072049 GTCTGATGCTCATACCTGAGTGG - Intronic
980978728 4:139635735-139635757 GCCTTCTTCTCCTGGTTGAGCGG - Intergenic
983190664 4:164750401-164750423 GCCTTCTTCTCCTGGATGAGAGG - Intergenic
985943238 5:3155690-3155712 TCCCGATGCTCCTCCCTGAGGGG - Intergenic
986082258 5:4407512-4407534 GCCTGAGGATCCTGGCCCAGGGG + Intergenic
988386188 5:30568345-30568367 TACTTATGTTCCTGGCTGAGGGG - Intergenic
988882142 5:35515353-35515375 ACCTGATGTTCCTGGTTGTGGGG - Intergenic
991267835 5:64743882-64743904 GCCTGATGTTCCTTTGTGAGTGG - Intronic
993226372 5:85170173-85170195 GACTGAAGGCCCTGGCTGAGTGG + Intergenic
994464636 5:100111382-100111404 GCCTGATTGTCCTGGCTAGGAGG + Intergenic
995296307 5:110527547-110527569 GCCTTTTGTTCCTGGCTTAGAGG - Intronic
995533964 5:113117258-113117280 GCCAGATTCTCCTGGCTTACTGG - Intronic
997197011 5:131987136-131987158 GCCTGAGGCTCCTGGGAGACAGG + Intronic
997200838 5:132009327-132009349 GCCTCCTGTTACTGGCTGAGTGG + Intronic
997849350 5:137317022-137317044 GCTTGATCTTCCTAGCTGAGTGG - Intronic
999231599 5:150065209-150065231 GCCTGCTGGTTCTGGGTGAGTGG + Intronic
1000391793 5:160730238-160730260 TCCTGATGCCCATGGCTGTGGGG - Intronic
1002615601 5:180453387-180453409 GGTTGCTGCTCCTGGCTGGGGGG - Intergenic
1004474304 6:15956905-15956927 GCCTGATAATCCTGGTTCAGGGG + Intergenic
1006135887 6:31896598-31896620 GCCGGATCCTGCTGGGTGAGAGG - Exonic
1006220335 6:32484367-32484389 GCCTGATGCTCCTGACAGCCAGG + Intergenic
1010492170 6:76489522-76489544 GCCTTACTCTCCTGGTTGAGTGG + Intergenic
1019542990 7:1559816-1559838 GCCTGCTCCTCCTGGCTGTGGGG - Intronic
1023151003 7:37201498-37201520 GCCTGATGTTCATGGCAGATGGG - Intronic
1023827515 7:44019415-44019437 GCCTCCTAGTCCTGGCTGAGCGG + Intergenic
1024232360 7:47372243-47372265 GGCTCATGCTCTGGGCTGAGTGG - Intronic
1024553250 7:50581318-50581340 GCCTTCTTCTCCTGGTTGAGTGG - Intergenic
1026059252 7:67011456-67011478 TGCTGATGCTGCTGGCTCAGGGG - Intronic
1026718843 7:72813591-72813613 TGCTGATGCTGCTGGCTCAGGGG + Intronic
1027007586 7:74708460-74708482 GGCTGGTGCTGGTGGCTGAGGGG + Intronic
1029280929 7:99435061-99435083 TCCTGACGCTCCTGGCCGAGGGG + Exonic
1029738688 7:102479184-102479206 GCCTCCTAGTCCTGGCTGAGCGG + Intergenic
1029755814 7:102572841-102572863 GCCTCCTAGTCCTGGCTGAGCGG + Intronic
1029773756 7:102671914-102671936 GCCTCCTAGTCCTGGCTGAGCGG + Intergenic
1030429532 7:109425861-109425883 GCCTAATGTTCCTGGCTGATTGG - Intergenic
1034362728 7:150514819-150514841 GCCTGAGCTTCCTGACTGAGAGG + Exonic
1034432299 7:151047124-151047146 GCCTGAGGCTGATGACTGAGTGG - Intronic
1036185641 8:6620481-6620503 GCCTGCTGCCCCTGACTGAGAGG + Intronic
1037616159 8:20520535-20520557 GCCTGGTGATGCTGCCTGAGTGG - Intergenic
1038702095 8:29858224-29858246 GCCTCAGCCTCCTGCCTGAGTGG - Intergenic
1040352986 8:46587211-46587233 GCCTTCTTCTCCTGGTTGAGCGG - Intergenic
1040582070 8:48706268-48706290 GGCTGATGCTGATGGCTGAGAGG - Intergenic
1041203163 8:55471385-55471407 TGCTGATGCTGCTGGTTGAGGGG - Intronic
1045379634 8:101610428-101610450 CCCTAATGCTCCTGCCTGGGTGG - Intronic
1048060294 8:130912465-130912487 GCAGGATGCTCCAGGCTGTGAGG - Intronic
1048570887 8:135654942-135654964 GCATGAGAATCCTGGCTGAGAGG + Intronic
1049602466 8:143514268-143514290 GCCTGAGGCTCCTGGGAGAGAGG - Intronic
1049986948 9:960651-960673 GGTGGCTGCTCCTGGCTGAGGGG + Intronic
1050697964 9:8300142-8300164 GCTTGATGCTTCTGGCTATGAGG + Intergenic
1051956333 9:22699613-22699635 GCGGGCTCCTCCTGGCTGAGAGG + Intergenic
1052751028 9:32490858-32490880 CCCAAATGCGCCTGGCTGAGAGG - Intronic
1054159826 9:61666031-61666053 GCCTCATGACCCTGGCAGAGAGG - Intergenic
1055427009 9:76206649-76206671 GCCTGATGCTTCTGGAAGAATGG + Intronic
1056130872 9:83585238-83585260 CCTTGTTCCTCCTGGCTGAGTGG - Intergenic
1057271984 9:93656625-93656647 GCCTGGGGCTCTTGGCTGTGGGG + Intronic
1057805237 9:98215213-98215235 GCCTGATGCTCATGGGAGACTGG - Intronic
1058759029 9:108111878-108111900 GGATGATGCTCCAGGCTGAGAGG + Intergenic
1059484252 9:114614750-114614772 GCCTGATTTTCCTTGGTGAGGGG + Intronic
1059566318 9:115385896-115385918 GCCAGTTTCTCCTGCCTGAGTGG + Intronic
1061545526 9:131302147-131302169 TCCTGGTGCTTCTGGCCGAGGGG - Intronic
1061612783 9:131759313-131759335 GCCTGCTTCTCCTGTCTGGGAGG - Intergenic
1061630764 9:131870805-131870827 GGTTGAAGCTTCTGGCTGAGAGG - Intronic
1061927840 9:133814810-133814832 GCCTGGGGCTCCTGGGGGAGAGG - Intronic
1062232072 9:135487291-135487313 CCCTGCTGCTCCTGCCCGAGGGG + Exonic
1062252568 9:135605653-135605675 GCCTGCCGCTCCTTGATGAGTGG + Intergenic
1185564874 X:1087436-1087458 GTCTGATACTCCTGGAGGAGAGG + Intergenic
1185944754 X:4362725-4362747 GCCTCATGCAGCTGGCTGTGTGG + Intergenic
1187575458 X:20549479-20549501 GCCTGGTGCACCTGGCACAGAGG + Intergenic
1192168941 X:68842696-68842718 GCAAGATTCTTCTGGCTGAGAGG - Intergenic
1194718150 X:97310617-97310639 GCCTGAAGCTCATGAATGAGAGG + Intronic