ID: 1083847684

View in Genome Browser
Species Human (GRCh38)
Location 11:65345495-65345517
Sequence TGCTCCTGGCTGAGGGGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 471
Summary {0: 1, 1: 0, 2: 4, 3: 47, 4: 419}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083847672_1083847684 7 Left 1083847672 11:65345465-65345487 CCCCAGAAGCTAGAGAGCCCCAC 0: 1
1: 0
2: 1
3: 10
4: 135
Right 1083847684 11:65345495-65345517 TGCTCCTGGCTGAGGGGAAGTGG 0: 1
1: 0
2: 4
3: 47
4: 419
1083847673_1083847684 6 Left 1083847673 11:65345466-65345488 CCCAGAAGCTAGAGAGCCCCACG 0: 1
1: 0
2: 0
3: 7
4: 112
Right 1083847684 11:65345495-65345517 TGCTCCTGGCTGAGGGGAAGTGG 0: 1
1: 0
2: 4
3: 47
4: 419
1083847677_1083847684 -10 Left 1083847677 11:65345482-65345504 CCCCACGGCCTGATGCTCCTGGC 0: 1
1: 0
2: 2
3: 21
4: 1654
Right 1083847684 11:65345495-65345517 TGCTCCTGGCTGAGGGGAAGTGG 0: 1
1: 0
2: 4
3: 47
4: 419
1083847674_1083847684 5 Left 1083847674 11:65345467-65345489 CCAGAAGCTAGAGAGCCCCACGG 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1083847684 11:65345495-65345517 TGCTCCTGGCTGAGGGGAAGTGG 0: 1
1: 0
2: 4
3: 47
4: 419

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083847684 Original CRISPR TGCTCCTGGCTGAGGGGAAG TGG Intronic
900164541 1:1239507-1239529 GGCTCCTGGCTGTGAGGAGGAGG - Intergenic
900173914 1:1283780-1283802 TGACCCTGGCTGAGAGTAAGGGG - Intronic
900381002 1:2383885-2383907 AGCTCCTGGCTGGTGGGAAGGGG - Intronic
900394107 1:2446140-2446162 TGCCCCTGGCTGCCAGGAAGGGG + Intronic
900436110 1:2632054-2632076 TGGGCCTGCCTGAGGGTAAGGGG - Intronic
900479917 1:2893109-2893131 CTCCCCTGGCTGAGGGGCAGAGG + Intergenic
900612996 1:3552271-3552293 TGCTCCAGGCTGTGGGGACATGG + Intronic
900781941 1:4624152-4624174 TGGCCATGGCTGATGGGAAGGGG + Intergenic
901627683 1:10633023-10633045 AGCGCCTGGGTCAGGGGAAGGGG + Intergenic
901925836 1:12565493-12565515 AGCTCCTGGCTGAGAGGGAGGGG + Intergenic
902432351 1:16373084-16373106 TCCTTCTGGCTGAAGGGGAGAGG + Intronic
902835300 1:19043391-19043413 GGCTCCTGGCTCTGGGGCAGTGG + Intergenic
902835571 1:19044712-19044734 GGCTCCTGGCTCTGGGGCAGTGG + Intergenic
903003395 1:20282353-20282375 TTCTCCTGGGTGTGGGGCAGAGG + Intergenic
903545614 1:24121688-24121710 TGCTCCTGGATGAAGCGCAGCGG + Exonic
903828092 1:26159437-26159459 TGCTCAGGGCTGGGGAGAAGAGG + Intronic
904276097 1:29385257-29385279 TGCTCCTGGCTGACACCAAGTGG - Intergenic
904310056 1:29623226-29623248 AGCTCCTTGCTAATGGGAAGTGG - Intergenic
904887497 1:33751994-33752016 TGCAACTGGCAGAAGGGAAGTGG + Intronic
905204728 1:36336856-36336878 TGCTTCTAGCTGAGAGGGAGCGG - Intergenic
905677484 1:39837863-39837885 TGGTCCTAGCTGATGGGAAGGGG - Intergenic
906046607 1:42835770-42835792 TGTTCTTGGCTGGGGGGCAGGGG + Intronic
906064867 1:42973480-42973502 TGCTCATGGCTGTGGGGATGAGG + Intergenic
906105316 1:43288278-43288300 AGCTCCTGGCTGAGGAGCCGCGG - Intergenic
906473277 1:46149133-46149155 TACTCCCGGCTGGGCGGAAGTGG + Intronic
906529771 1:46517101-46517123 TGCACCTGGCTGAGGTTTAGGGG + Intergenic
906645623 1:47472379-47472401 TGGTCCTGGCTGAGGGGCTGGGG - Intergenic
907289029 1:53401034-53401056 GGAGCCTGGGTGAGGGGAAGGGG + Intergenic
907475385 1:54701893-54701915 TGCTCCTAGCAGAGGAGGAGAGG + Intronic
909508091 1:76417883-76417905 TGTTCCTGCCTCAGGTGAAGAGG + Intronic
910480060 1:87649094-87649116 TTCTCCTGGGTCAGGGGAATTGG + Intergenic
910518420 1:88088925-88088947 TTCCCTTGGCTGGGGGGAAGGGG + Intergenic
912062066 1:105686324-105686346 TGCACCTGGACAAGGGGAAGGGG + Intergenic
912315360 1:108662934-108662956 TGCTACGGGCTGAGAGGAGGAGG + Intergenic
912953757 1:114138086-114138108 TGGTCAGGGCTCAGGGGAAGGGG + Intronic
913165579 1:116181732-116181754 CCCTCCTGGGTGAGGAGAAGAGG - Intergenic
913555526 1:119962896-119962918 TGCTCCTTTCTGGGGGGATGTGG - Intronic
913650920 1:120913205-120913227 TGATCCTGGGTGAGAGGAGGAGG - Intergenic
913997095 1:143660593-143660615 TGCTCCCCGCTGAGGGGAGGGGG - Intergenic
914170194 1:145215862-145215884 TGATCCTGGGTGAGAGGAGGAGG + Intergenic
914641093 1:149607309-149607331 TGATCCTGGGTGAGAGGAGGAGG - Intergenic
915134540 1:153721461-153721483 TGATCCAGGCTGGTGGGAAGTGG + Intergenic
915277901 1:154802342-154802364 AGCTCCTGGGTGCGGGGTAGTGG - Intronic
915492729 1:156260336-156260358 TGTCCCTGTCTGAGTGGAAGAGG + Intronic
916056012 1:161069413-161069435 TGCTCCTGGGGAAGGGGCAGTGG - Intronic
917851894 1:179071508-179071530 TGATGCTGGGTGGGGGGAAGAGG - Intronic
918093353 1:181315902-181315924 TGCTACGGGCTGAGGGGAGAAGG + Intergenic
918974922 1:191471500-191471522 TGCTCTTGACTTAGGGGAAAAGG - Intergenic
919825557 1:201500684-201500706 TGACCCTGCCTGTGGGGAAGAGG + Intronic
920409591 1:205749432-205749454 TGTTCCTGGCAAAGGGGGAGGGG - Intronic
920565763 1:206971539-206971561 TGCTCCATGAGGAGGGGAAGGGG - Intergenic
920845904 1:209592769-209592791 GGCTCTTGGCAGAGGGGAAGAGG - Intronic
922961117 1:229646327-229646349 TGGTCCAGGCTAAGGTGAAGTGG + Intronic
923470718 1:234288259-234288281 TGCTCCTGGCTTGGGGAAAGTGG - Intronic
923774436 1:236965945-236965967 TCCACCTGGCAGAGGGGCAGAGG - Intergenic
924021412 1:239787643-239787665 TGGCCCATGCTGAGGGGAAGCGG + Intronic
1063180909 10:3599136-3599158 TGCTCTTGGCTGAGTGGACCTGG + Intergenic
1064778019 10:18801544-18801566 TGCTTATTGCTGAGGGGTAGAGG - Intergenic
1065668454 10:28087721-28087743 TCCCCTTGGCTGAGGAGAAGAGG + Intronic
1065943590 10:30587270-30587292 TGCTCCTTACTCAGGAGAAGGGG + Intergenic
1067297338 10:44982383-44982405 TGGTCCTTCCTGAGGGGATGGGG + Intronic
1067346349 10:45441587-45441609 TGCTCCTGGCTGAATGGCACGGG - Intronic
1067831309 10:49612560-49612582 CGCTCCTTGCGGAGGTGAAGAGG + Exonic
1070249828 10:74764124-74764146 CACTCCAGGCTGAGGGGATGAGG + Intergenic
1070910102 10:80110358-80110380 TGCTGCAGGCTGTGGGAAAGCGG - Intergenic
1071179883 10:82971020-82971042 TGCTCATGGCGGAAGGGAAAGGG + Intronic
1071598178 10:86942877-86942899 TGCTCGTAGCTCAGGGGCAGCGG + Exonic
1072755901 10:98020684-98020706 TGTTCCAGGCTGAGGGGAGCAGG + Intronic
1073242548 10:102067633-102067655 TGCTCCAGGCTCAGGGAATGGGG - Exonic
1073500169 10:103929741-103929763 CGGTCTTGGCTGAGGGGAGGCGG - Intergenic
1073734640 10:106331741-106331763 TGCTCATGGATGATGAGAAGTGG - Intergenic
1073943111 10:108720087-108720109 TGCTCTTGTCTCAAGGGAAGGGG - Intergenic
1074550338 10:114436770-114436792 TCCTCCTGGCTGAGGAATAGGGG + Intronic
1074782068 10:116809160-116809182 GGCACCTGGCTCAGGGGCAGAGG + Intergenic
1075456234 10:122586806-122586828 TACTCCTGGCAGAGGGGATGGGG + Intronic
1075622538 10:123938613-123938635 TGCACCTGGCCAAGGGGAACAGG + Intronic
1076187516 10:128460855-128460877 TGCTCCTTGCTCAGGGGGTGAGG - Intergenic
1076242940 10:128923570-128923592 TGCTCCTGGTTGGGGGTATGGGG - Intergenic
1076605111 10:131684194-131684216 TGCTTCTGGCTGGGAGGAAGAGG + Intergenic
1076725701 10:132412076-132412098 AGCTGCTGGCTGGGAGGAAGCGG - Intronic
1077114032 11:875045-875067 TGCTTCTGGCTGGTGGGAGGAGG + Intronic
1077306310 11:1870172-1870194 TCCTCATGGCTGAGGTCAAGTGG - Intronic
1078474535 11:11620126-11620148 TGCTCCTGGCGGGGGGGTGGGGG + Intronic
1081614925 11:44585137-44585159 TGCTCCTGGGTAAGGGGCTGGGG - Intronic
1083571361 11:63763725-63763747 TGCTCCCGGCTGCGGGGCGGGGG + Exonic
1083631269 11:64096772-64096794 TGCCCCTCCCTGAGGGGAAGAGG + Intronic
1083755856 11:64791337-64791359 TGCTCCGGGCTGCAGGGAAGAGG - Intronic
1083847684 11:65345495-65345517 TGCTCCTGGCTGAGGGGAAGTGG + Intronic
1083891238 11:65596712-65596734 GGCACCTGGGAGAGGGGAAGGGG + Intronic
1084544501 11:69807920-69807942 TTCTGCTGGATGAGGGGAAGGGG - Intergenic
1084672377 11:70614932-70614954 TGCTCCTGGCTGGGGGGCTGTGG + Intronic
1085517569 11:77120532-77120554 TGCCCAGGGCTGAAGGGAAGAGG - Intronic
1085654232 11:78297934-78297956 GGCTCCTTGTTGAGGGGAATGGG + Intronic
1086092799 11:83020910-83020932 AGCTCTTGGCAGAGAGGAAGTGG - Intronic
1088626318 11:111733010-111733032 GGGTCCTGACTGAGGCGAAGGGG + Intronic
1089049121 11:115530804-115530826 TGCTCCTTCTTGAGGGGAGGAGG + Intergenic
1089147048 11:116336723-116336745 TGGGGCTGGCAGAGGGGAAGAGG - Intergenic
1089587701 11:119520652-119520674 TGCACCTGGCTCTGGGGAATGGG + Intergenic
1091227559 11:133966595-133966617 TGCTCTTGGCAGAGAAGAAGGGG + Intergenic
1091240191 11:134046928-134046950 CTCACCTGGCTGAGGGGACGAGG - Intergenic
1091309222 11:134560985-134561007 TGGGCCTGGCTGAGTGGCAGTGG + Intergenic
1091455591 12:605046-605068 TTCTCCTGGCTGAAGGATAGAGG + Intronic
1092057917 12:5522718-5522740 TGCAGCTGGGTGAGGGGAGGGGG + Intergenic
1094164747 12:27431426-27431448 TGCCAGTGGCTGAGGAGAAGAGG - Intergenic
1094608632 12:31971914-31971936 TGCACCTGGTTGAGAGGGAGGGG + Intronic
1094641847 12:32283453-32283475 TGCTCATAGCTGAGGAGAACTGG - Intronic
1095808343 12:46345333-46345355 TTATCAGGGCTGAGGGGAAGGGG + Intergenic
1096463705 12:51836868-51836890 TGCGCCTGTGTGAGGGGAGGAGG - Intergenic
1096519093 12:52174085-52174107 TACTCCTGGCTGATGGGAAAGGG + Intronic
1097044148 12:56174624-56174646 GTCTTGTGGCTGAGGGGAAGGGG - Intronic
1097349898 12:58537137-58537159 TGCCCCTGGCTGATGAGAACAGG - Intergenic
1100776367 12:97979312-97979334 TGCTCCTGGCTGCTGGGACCAGG + Intergenic
1103196141 12:119045300-119045322 TGTTGCTGGCTGTGAGGAAGGGG - Intronic
1103327412 12:120130792-120130814 TTTTCCTGGCTCTGGGGAAGGGG - Intronic
1103517529 12:121517222-121517244 AGCTTCAGGATGAGGGGAAGGGG + Intronic
1103602531 12:122063405-122063427 TGCTCCTTGATGAAGGGAGGTGG - Intergenic
1103614770 12:122145207-122145229 TGGGTCTGGTTGAGGGGAAGGGG + Exonic
1103736218 12:123062399-123062421 TGCTGCTGGCTGTGGGGCTGGGG + Intronic
1103987880 12:124779570-124779592 TGCGTCTGGGTGAGGGGAACTGG + Intronic
1104037069 12:125104942-125104964 TGATCATGGCGGAAGGGAAGTGG + Intronic
1105884059 13:24627324-24627346 GGCTCCTGGAAGAGGGGAGGAGG + Intergenic
1106139314 13:26998333-26998355 TGCTCGTGCCTGAGGGGAGAGGG - Intergenic
1106315746 13:28591710-28591732 TGTTAGGGGCTGAGGGGAAGGGG + Intergenic
1106720743 13:32432357-32432379 TGCCAGGGGCTGAGGGGAAGGGG + Intergenic
1108058835 13:46512586-46512608 TGCTTAGGGCTGAGGGGAAGAGG - Intergenic
1110815627 13:79857361-79857383 TGCTCCTGGATGATGGTGAGTGG - Intergenic
1112694061 13:101927815-101927837 TGCTCCAGGCTCTGGGGAGGTGG - Intronic
1113531982 13:111033898-111033920 TCCTCCTGGCTCAGGGCAACAGG - Intergenic
1115642494 14:35343590-35343612 TGCTTCTGGCTGATGGGATAGGG - Intergenic
1117480060 14:56133738-56133760 TGCTCCTGACTGGAGGGAAAAGG - Intronic
1117651164 14:57907124-57907146 TTGTCCAGGCTGAGGGGCAGTGG + Intronic
1117841786 14:59869285-59869307 TGCTCCCAGAGGAGGGGAAGGGG - Intronic
1118220603 14:63852429-63852451 TCCCCTTGGATGAGGGGAAGTGG - Intergenic
1119883699 14:78122598-78122620 GGCTCCTGTCAGAGGGGATGAGG - Intergenic
1120638647 14:86982887-86982909 AAATCCTGGCTGAGGGGATGAGG + Intergenic
1120682571 14:87498305-87498327 AGCTCCTTGCTGTGGGGCAGTGG - Intergenic
1120979595 14:90278498-90278520 TCCTCCAGGCTGACAGGAAGTGG - Intronic
1121273652 14:92653373-92653395 TGGTCCTGCTTGAGGCGAAGGGG - Intronic
1121806826 14:96834570-96834592 TGCTCCTGGAGCAGGTGAAGTGG - Intronic
1121946198 14:98124882-98124904 TGCTCAGGGCTGAGGGGCTGAGG + Intergenic
1122114223 14:99519888-99519910 TGCTGGTGGCTGGGAGGAAGGGG + Intronic
1122198619 14:100108432-100108454 TGGCCCTGCCTGAGGGGAACAGG + Intronic
1122887478 14:104716640-104716662 CGCACGTGGCTGAGGGCAAGAGG + Intronic
1124491430 15:30159377-30159399 TGATCCTGGTGGAGGTGAAGTGG + Intergenic
1124752107 15:32378929-32378951 TGATCCTGGTGGAGGTGAAGTGG - Intergenic
1125397708 15:39268362-39268384 TGTCACTGGGTGAGGGGAAGGGG + Intergenic
1126121567 15:45256961-45256983 AGATCCTGGTTGTGGGGAAGAGG - Intronic
1127995828 15:64152563-64152585 GGCTTCTGGCTGGGGCGAAGAGG + Intronic
1129149286 15:73677610-73677632 TGACCCTGGCTGGCGGGAAGGGG - Intergenic
1129256874 15:74338802-74338824 TGCTCAGGGCTGTGGGGAAGTGG - Intronic
1130093374 15:80839189-80839211 TCCTGCTGGCTGAGGAGAAGTGG - Intronic
1130104704 15:80920578-80920600 TGCTCTTTGATGAGAGGAAGTGG + Intronic
1130411985 15:83654828-83654850 GACTCCTGGCTGAAGGGAGGCGG - Intronic
1131152600 15:90056436-90056458 TAGTCCTGACTGAGGGGTAGGGG + Intronic
1131547968 15:93331831-93331853 TGCACTTGGCTGTGGGGGAGGGG + Intergenic
1131712844 15:95074670-95074692 TGCTTCTGCCTGAGAGGCAGAGG - Intergenic
1131782245 15:95872181-95872203 CGCTGCTGGCTGTGGGGAGGGGG + Intergenic
1131990502 15:98088649-98088671 TGACCCTGGGGGAGGGGAAGGGG - Intergenic
1132099642 15:99014648-99014670 TGACCCTGGGGGAGGGGAAGGGG + Intergenic
1132303524 15:100791089-100791111 TGCCAGGGGCTGAGGGGAAGAGG + Intergenic
1132548880 16:546086-546108 TGCCCCTGGCAGAGTGGACGGGG - Intronic
1132601858 16:776306-776328 TCCTCCTGGCTGAGAGGGAGGGG + Intronic
1132743115 16:1425844-1425866 AGATTCTGGCTCAGGGGAAGGGG - Intergenic
1132849162 16:2016703-2016725 CGCTCCTGGCTAAGAGGACGTGG - Intronic
1132896506 16:2231867-2231889 TCCTCCTGGCTTTGGGGATGGGG + Intronic
1133055441 16:3143389-3143411 GGCCCCTGGCTGAGGGGAGGCGG + Intergenic
1133616273 16:7479683-7479705 TGCTTCTCTCCGAGGGGAAGTGG + Intronic
1134826975 16:17292879-17292901 TGCTCAGGGCTGAGATGAAGTGG - Intronic
1136136973 16:28262149-28262171 TGCTGCTGGAGGAGGGGCAGTGG + Intergenic
1136229335 16:28877643-28877665 TGCTGATGGCAGAGGGGGAGGGG - Intergenic
1136451794 16:30357890-30357912 TGTTCTTGGCTGAGGGAAAGAGG + Exonic
1137676469 16:50305981-50306003 TGCTCCTGGGCGGGGGGCAGGGG + Intronic
1138585253 16:57964882-57964904 TGGGGCTGGCTGAGGGGAAGAGG + Intronic
1139265147 16:65631474-65631496 AGCTACAGTCTGAGGGGAAGTGG - Intergenic
1139594238 16:67948818-67948840 TGCTCTTGGGTGAGAGGAAGGGG + Intronic
1141030213 16:80581145-80581167 GGCTCCTGGCGGTGGGGGAGAGG + Intergenic
1141750558 16:85955265-85955287 TGCTTCACGCTGAGGGGAGGTGG + Intergenic
1141982021 16:87556725-87556747 TGTTACTGGCTGAGCGGTAGGGG - Intergenic
1142267308 16:89070600-89070622 TGCTGCTGGCTGGTGGGAGGGGG + Intergenic
1143038325 17:4014150-4014172 TGCTCATGTCGGAGGTGAAGCGG + Exonic
1143412545 17:6719628-6719650 TGCTCCAGGCTGTAGGGAAATGG + Intergenic
1143612087 17:8024667-8024689 TGCTCCCGGCTCAGAGGAAGAGG - Intergenic
1144155536 17:12496995-12497017 TGCCAGTGGCTGAGGGGAGGGGG - Intergenic
1144301055 17:13923298-13923320 AGCCCCTGGCTCAGGGCAAGTGG - Intergenic
1144754304 17:17669879-17669901 TGCTCATGGCTGACAGGGAGGGG + Intergenic
1145890044 17:28407830-28407852 GACTCCTGGCTCAGGGGAGGTGG - Intergenic
1145950434 17:28812673-28812695 GGCTCCTGGCTTTGGGGTAGGGG - Intronic
1146164254 17:30575759-30575781 AGCTCCTGCCTGCGGGGCAGTGG + Intergenic
1147240988 17:39090418-39090440 TGCTCCAGGCCGAGTGGAAAGGG + Intronic
1147547718 17:41415686-41415708 TGCTTATGCCTGTGGGGAAGAGG + Intergenic
1148020296 17:44548799-44548821 TGCCCCTGGCTTTGGGGCAGAGG - Intergenic
1148202444 17:45758265-45758287 TGCTCCTGGCTGGGAGGGAGAGG - Intergenic
1148548308 17:48533258-48533280 TGCTTCAAGCTGAGGGGGAGGGG + Intergenic
1148839380 17:50484836-50484858 TCCTCCTGGCACAGGGGAGGGGG - Exonic
1150285901 17:63954014-63954036 TGCTTCTGGCTGATGGGAGCTGG - Intronic
1150360527 17:64529470-64529492 AGCATCTGGCTGAGGGGAAATGG - Intronic
1150656667 17:67044194-67044216 TGCTCTGGGCTGATGGGAAAGGG - Intergenic
1151380721 17:73724048-73724070 AGCTCCTGGCTGAGCTGATGAGG + Intergenic
1151715666 17:75829937-75829959 TCCTCCTGGCTGGGGCCAAGGGG - Intronic
1151718209 17:75842328-75842350 TCGTCCTGGCTCAGGGGAGGGGG - Intronic
1151963044 17:77417404-77417426 GGACCCTGGCAGAGGGGAAGGGG + Intronic
1152209752 17:78996817-78996839 TGCTCCTGGCTAAGGGTAAGGGG + Intronic
1152230308 17:79111005-79111027 AGCTCCTGGCTGAGGGGAGAGGG + Intronic
1152531494 17:80921944-80921966 TCCTCCTGGCCGAGGGGCTGTGG - Intronic
1152586013 17:81189829-81189851 TGCTGCAGGCTGCGGTGAAGCGG - Exonic
1152647495 17:81476234-81476256 TGCTCCAGGAAGATGGGAAGGGG + Intergenic
1152724437 17:81938231-81938253 TGCTCCGGGCTGCGTGGGAGTGG - Intronic
1153784961 18:8526247-8526269 TGCTCCTAGCTGTGGGAGAGGGG - Intergenic
1154169225 18:12038664-12038686 TGCTCCGGGCTGCGGGGACTGGG - Intergenic
1154358973 18:13643341-13643363 CCTTCCTGGCGGAGGGGAAGGGG - Exonic
1154491444 18:14925311-14925333 TGCCCCTGGCTGTGGGGACCAGG + Intergenic
1155252487 18:23965681-23965703 TCCTCTAGGCTCAGGGGAAGAGG - Intergenic
1155635850 18:27954500-27954522 TTCTCCTGGCAGAGGGGGAAAGG - Intronic
1156820892 18:41371611-41371633 TGCTCCTGGATGTGGGACAGAGG - Intergenic
1157110555 18:44816400-44816422 AGCAGCTGGCTGAGGGGAAGGGG + Intronic
1157323256 18:46650099-46650121 TGCTCTTGGCGGAGGGGATGTGG - Intronic
1158861690 18:61598657-61598679 CTCTCATGGCAGAGGGGAAGGGG - Intergenic
1159288046 18:66377415-66377437 TGCTCCTTGCTGAAGGCAAAGGG + Intergenic
1159899907 18:74036391-74036413 CTCTGCTGGCTGAGTGGAAGAGG - Intergenic
1160225634 18:77008893-77008915 TGCTCCTTGCTGAGTGTAAATGG + Intronic
1160357941 18:78244465-78244487 TGCTTCTGGCTCTGGAGAAGAGG + Intergenic
1160495969 18:79375630-79375652 TGGCCCTGAGTGAGGGGAAGGGG + Intronic
1160769703 19:825090-825112 GGCTCCCGGCAGAGGGGAAATGG + Intronic
1161181719 19:2887930-2887952 AGTTCCTGGCTAAGGGGCAGAGG - Intergenic
1162440271 19:10688207-10688229 TGCTGCTGGCTGAGGAGAGGCGG + Intronic
1163471083 19:17497331-17497353 TGCGCCTGGCGGTGGGGAACGGG + Exonic
1163608942 19:18291436-18291458 TGCCCCAGGCTGCGGGGATGGGG + Intergenic
1163659234 19:18567034-18567056 TGCTGCCAGCTGAGGGCAAGGGG - Intronic
1163746213 19:19049652-19049674 TGCTAGAGGCTGAGGGGAAGAGG - Intronic
1165391601 19:35542305-35542327 GGCTCTTTGCTGTGGGGAAGTGG - Exonic
1165718648 19:38063356-38063378 GGCTCTAGGCTGAGGGGATGGGG - Intronic
1165789476 19:38483009-38483031 TCCACCTGGCAGAGGAGAAGAGG - Exonic
1165829729 19:38724413-38724435 TGCACCTGGCAGAGGAGACGCGG - Exonic
1166219956 19:41357853-41357875 GGGTCCAGGCTGAGGGGAGGGGG - Intronic
1166661704 19:44651448-44651470 TGATCGTGGCTCAGGGGAACTGG - Intronic
1167650359 19:50725333-50725355 TGGTCCGGGCTGAGCGGATGCGG - Exonic
1168044904 19:53787658-53787680 TGCCACAGGCTGAGGGGATGCGG - Intergenic
1168103299 19:54152532-54152554 TGCTCCTTGGTGAGGGGCACAGG - Exonic
925528591 2:4833750-4833772 TGTGCCTGGCTCATGGGAAGTGG - Intergenic
925749612 2:7075830-7075852 TGCTCAAGTCTAAGGGGAAGGGG + Intergenic
925831898 2:7904031-7904053 TTCTCCTGCCTCAGGGGCAGAGG + Intergenic
926308243 2:11655847-11655869 TGCTCCTGTCTTAGAGGGAGAGG - Intergenic
926754353 2:16223548-16223570 GGCTCTTGGCTGAAGGGGAGAGG + Intergenic
927203072 2:20590466-20590488 TGCTCCGGGATGAGGGGGTGAGG - Intronic
927228231 2:20791947-20791969 TGGTCCTGGCAGAGGAGAAAAGG - Intronic
928126592 2:28620703-28620725 TCCTGCTGGAGGAGGGGAAGAGG + Intronic
928231858 2:29505267-29505289 TGCCTCTGGGGGAGGGGAAGGGG + Intronic
929461368 2:42104032-42104054 TCCTCCTGGGTGTGGGGCAGGGG + Intergenic
929692650 2:44087313-44087335 GGCTCCGGGCCCAGGGGAAGCGG - Intergenic
931255211 2:60565773-60565795 TGTTCCTGGAGCAGGGGAAGTGG - Intergenic
931809626 2:65842074-65842096 TACTCCTGGATAAGGGGATGGGG + Intergenic
932877557 2:75469734-75469756 TTCTCTTGGCTGGGTGGAAGTGG + Intronic
933184469 2:79263421-79263443 TGATCATGGCTGAGGGCAAAAGG - Intronic
934657166 2:96122430-96122452 TGCTCCTGGCTGGGGGAGTGGGG - Intergenic
934662181 2:96148840-96148862 TCCTCCTGGCCAAGGTGAAGCGG + Intergenic
934678597 2:96266579-96266601 TGTTCCTGGCGGAGGGAGAGTGG + Intronic
934978625 2:98822917-98822939 TGCTCCCGGATGAGGAGAAGGGG - Exonic
936045192 2:109181979-109182001 TGCTCATTGCTCAGGGGAGGAGG + Intronic
936528155 2:113256262-113256284 TCCTCCAGGCTGAGGAGCAGTGG - Intronic
938038191 2:128053799-128053821 TGCTGCTGGCTGAGGGGCTGGGG + Intergenic
938421290 2:131149018-131149040 TGCTTCTGGCTGAAGGGGGGAGG + Intronic
938680926 2:133689382-133689404 CCTGCCTGGCTGAGGGGAAGAGG - Intergenic
940353836 2:152717917-152717939 TGCTCGAGGCGGAGGGGAGGAGG + Exonic
940702208 2:157059490-157059512 TGCTGATAGCTGAGTGGAAGTGG - Intergenic
940713054 2:157185740-157185762 TCATACTGGCTGAGGCGAAGAGG + Intergenic
941846780 2:170141639-170141661 TGCTCCTGGCAGAGGAGGAAGGG - Intergenic
942947179 2:181683785-181683807 TGGGCCGGGCGGAGGGGAAGGGG + Intergenic
943396806 2:187348405-187348427 AGTTTCTGGTTGAGGGGAAGTGG + Intronic
943548238 2:189308206-189308228 TGCCCTTGGCTGAGAGGGAGGGG - Intergenic
944221933 2:197311161-197311183 TGATTCTGGGTTAGGGGAAGGGG - Intronic
944684668 2:202107614-202107636 TCCTCCTGGCAGAGTGGCAGAGG - Intronic
945452026 2:210004917-210004939 ATCTCCTGGCAAAGGGGAAGAGG - Intronic
946397727 2:219451673-219451695 TCCTCCGGGCTGAGGGTGAGCGG + Exonic
947731325 2:232433139-232433161 TGATCCTGGCAGAGGGGAGGAGG + Intergenic
947932500 2:233975359-233975381 AGCTCCTGGCTGTGGGGCTGTGG - Intronic
948321385 2:237072473-237072495 TCCCACTGGCTGAGGGAAAGCGG - Intergenic
948516625 2:238508052-238508074 TGCTCCTGGCTGGGGCTGAGTGG + Intergenic
948673426 2:239583334-239583356 TGCGCCTGGCTGGGGGAATGCGG + Exonic
948735180 2:239999022-239999044 AGCTGCTGGCAGAGGGGAGGAGG + Intronic
1168969896 20:1923809-1923831 TGCTTCTGGCTGTGTTGAAGGGG + Intronic
1169825427 20:9763098-9763120 TGCCTGGGGCTGAGGGGAAGGGG + Intronic
1172608537 20:36231985-36232007 TGCACCTGGCTTTGGGGCAGGGG + Exonic
1173203182 20:40969115-40969137 TGTTCCTGGCTCAGGGGATGGGG - Intergenic
1173227597 20:41171043-41171065 TCCCCCAGGCTCAGGGGAAGAGG - Intronic
1173663952 20:44752385-44752407 AGCTCCTGGCTGAAGGGAATTGG + Intronic
1174017731 20:47502194-47502216 CCCCCCGGGCTGAGGGGAAGCGG - Intronic
1174076546 20:47941573-47941595 TGGCGCTGCCTGAGGGGAAGGGG - Intergenic
1174148435 20:48468800-48468822 TGCTCCCAGGTGAGGGCAAGTGG - Intergenic
1175046571 20:56111990-56112012 TGTGGCTGGCTGAGGGGAAGGGG + Intergenic
1175418612 20:58817409-58817431 TGCTCGTGGCTGAGGGTGGGAGG + Intergenic
1175908594 20:62393922-62393944 AGCACCTGGCTGTGGGGCAGTGG + Intronic
1176030263 20:63008198-63008220 TTGTCCTGGCGGAGGGGAATGGG + Intergenic
1176869442 21:14073863-14073885 TGCGCCTGGCCCAGGGGGAGGGG - Intergenic
1177294239 21:19154395-19154417 TCCTGCTGGCTGTTGGGAAGAGG - Intergenic
1177879144 21:26670957-26670979 TGCTCCTGGCTCAGCTGAAATGG - Intergenic
1178389818 21:32189085-32189107 TCCTCATGGAAGAGGGGAAGCGG + Intergenic
1179561644 21:42219465-42219487 TGGCCCTGGCGGAGGGGCAGGGG - Intronic
1180103401 21:45600755-45600777 AGATGCTGGCTGAGAGGAAGTGG + Intergenic
1180589665 22:16926383-16926405 AGCTCCCAGGTGAGGGGAAGAGG - Intergenic
1180957433 22:19747259-19747281 TGGTCCTGGCTGTGGAGAAAAGG - Intergenic
1181031246 22:20149698-20149720 CCCGCCTGGCTGAGGGGGAGGGG - Intronic
1181512092 22:23393699-23393721 CCCGCCTGGCTGAGGGGGAGGGG + Intergenic
1182463652 22:30500798-30500820 TGCGCCAGGCTGAGGGGACCAGG + Intronic
1182566877 22:31206694-31206716 AGCTCCTGGCAGAGGGTGAGTGG - Exonic
1183044611 22:35209847-35209869 TGCTACTGGGTAATGGGAAGAGG - Intergenic
1183701730 22:39454823-39454845 TGCTCCTGGCAAAGGGGAGGAGG - Intergenic
1184769346 22:46588615-46588637 TGTTCCTGGCTGGGGGGCAGGGG + Intronic
1185158018 22:49205767-49205789 TCCTCCAGGCTGGGAGGAAGGGG + Intergenic
949722219 3:7003077-7003099 GGCTGCGGGTTGAGGGGAAGTGG + Intronic
950503229 3:13377419-13377441 AGGTCCTGGCTGGGGGGATGAGG - Intronic
950562785 3:13744804-13744826 AGCTCCTGGGTGGGGGCAAGAGG + Intergenic
951189334 3:19749852-19749874 AGCTCCTGACGGTGGGGAAGGGG - Intergenic
951916515 3:27806285-27806307 TTCTCCTGGCAGAGGGGTTGGGG + Intergenic
952033813 3:29175927-29175949 TGCCCTTGGCTGAGAGGAGGGGG + Intergenic
952420450 3:33126127-33126149 TGCCAGTGGCTGGGGGGAAGGGG - Intronic
953280147 3:41547409-41547431 TGATCCTGGCTGGGTGGCAGTGG - Intronic
953674860 3:44993073-44993095 TGTTCCTGGCTGAGGGGCTGGGG + Intronic
953875609 3:46665000-46665022 TGCTCCTGGCAGAAGGGGAAGGG - Intergenic
955466057 3:59238498-59238520 TGGTCCTGGCTGAGGGGTTTGGG - Intergenic
956923901 3:73961487-73961509 TGCTTAGGGCTGAGGGGAGGGGG - Intergenic
957299942 3:78379020-78379042 TGATTCTGGCTGAGGAGAATGGG - Intergenic
957764054 3:84598430-84598452 CACTCCTGGCTGAAGGGGAGGGG - Intergenic
960303205 3:116029699-116029721 TGCTCCTGTCTGATGAAAAGAGG - Intronic
960631457 3:119736220-119736242 TGCCAGGGGCTGAGGGGAAGGGG - Intronic
960944854 3:122958796-122958818 TGCCCCTGGGAGAGGGCAAGGGG - Intronic
960988617 3:123296208-123296230 TGCTCAGGGCTGTGGGGAGGTGG + Exonic
961450308 3:126999576-126999598 TTCTCCGGGCTGAGGGCAGGCGG - Intronic
961493412 3:127273518-127273540 TGCTGCTGGCTGGGGGCCAGTGG + Intergenic
961781883 3:129325280-129325302 AGGTCCTGGCTGGGGGGATGAGG - Intergenic
961799261 3:129432364-129432386 TGTTCCTGGCTGCGGGGAAGCGG - Intronic
961989016 3:131167805-131167827 TGCTCCTTGCTGATGGGAAGGGG - Intronic
963234628 3:142945020-142945042 AGCTCCTGGAGAAGGGGAAGGGG + Intergenic
963823614 3:149927149-149927171 TGCCAGTGGCTGGGGGGAAGTGG - Intronic
965339148 3:167464435-167464457 AGATCCTGGCTGAGTGGAAAAGG + Intronic
966811745 3:183852478-183852500 TACTAGTGGCTGAGGGGAGGGGG + Intronic
967967069 3:194970067-194970089 TGCTCAGGGCTGAGGGGATTGGG - Intergenic
968233759 3:197019302-197019324 TGTTCTTGGCTGAGGAGAAGCGG - Intronic
969223188 4:5774698-5774720 TGCTTCTGTTTGAGGGGGAGGGG + Intronic
970256143 4:14172149-14172171 TTCAGCTGGCTGAGGGGTAGTGG + Intergenic
973968235 4:56185374-56185396 TGCCAGTGGCTGAGGGGAGGGGG - Intronic
975258725 4:72271125-72271147 TGCTCCTGCTTGAGGGAAACTGG - Intergenic
976599094 4:86921350-86921372 AGCTTCTGGCTGAGGGCAAAGGG + Intronic
977579260 4:98706308-98706330 TACTACTGTTTGAGGGGAAGGGG + Intergenic
979098294 4:116578797-116578819 TGCTGTAGACTGAGGGGAAGGGG + Intergenic
979542491 4:121901336-121901358 TACACCTCGCTGAGAGGAAGTGG + Intronic
979558283 4:122075710-122075732 AGCTCCTGGCAGAGGGTGAGTGG + Intergenic
981497470 4:145410243-145410265 TGTTCCTGCCTTAGAGGAAGAGG - Intergenic
985579713 5:690222-690244 GGCTCCTGGCTGAGGGTTTGTGG + Intronic
985594559 5:782281-782303 GGCTCCTGGCTGAGGGTTTGTGG + Intergenic
985649139 5:1099235-1099257 TGCTCCTGCCTCAGGGCACGTGG - Intronic
986405162 5:7418457-7418479 TGCTCCTGGCTTAGGAATAGTGG - Intronic
990012831 5:51021065-51021087 GGCACCTGGCTGAGGGAAGGTGG + Intergenic
990618292 5:57530709-57530731 TGGTTTTGGCTGAGGGAAAGAGG + Intergenic
991188426 5:63838919-63838941 TATTCCTAGCAGAGGGGAAGGGG + Intergenic
991339859 5:65596796-65596818 TGATCCTGGCTGAGGGTGTGGGG - Intronic
993885646 5:93412244-93412266 TATTCCAGGCTGAGGAGAAGAGG - Intergenic
996517993 5:124394891-124394913 TGCTCCTGGCTGAGGAGCCTCGG - Intergenic
997583113 5:135029378-135029400 GGCTCCAGGCGGTGGGGAAGGGG - Intronic
997659309 5:135577601-135577623 TGTTTCTGGGGGAGGGGAAGAGG + Intronic
998377813 5:141702645-141702667 TGGTCCTGATTGAGGGGCAGAGG + Intergenic
1001555008 5:172631189-172631211 TGCTGGTGGCTGAGTGGGAGTGG + Intergenic
1002471543 5:179438746-179438768 AGCTCCTGGGTGGGTGGAAGAGG + Intergenic
1002716277 5:181230137-181230159 CGCTCACAGCTGAGGGGAAGTGG - Intronic
1002721709 5:181265345-181265367 TGCTGCTGGCAGAGGAGGAGTGG + Intergenic
1003222117 6:4170142-4170164 TGCTTGAGCCTGAGGGGAAGAGG + Intergenic
1003626692 6:7747580-7747602 TGCTCCTATCTGGAGGGAAGAGG - Intronic
1006324696 6:33344886-33344908 TGCTTCTGGCTGTGAGGGAGAGG + Intergenic
1006862271 6:37180271-37180293 TGCCCTTGGCTGAGGGGATCTGG + Intergenic
1007524968 6:42483819-42483841 TCCTGCTGCCTGAGGTGAAGAGG + Intergenic
1008877051 6:56340507-56340529 TTCTCCTGGTTGATGGGGAGAGG + Intronic
1009030649 6:58054081-58054103 TGCTCCAGGCTGTTGGAAAGTGG + Intergenic
1009427249 6:63528028-63528050 TGCTCTTGGCTGGGGAGAAAGGG - Intronic
1010629611 6:78182408-78182430 GGGACCTGGCTGAGGGGATGAGG + Intergenic
1013633867 6:112010240-112010262 TTCTCCTGGTTGGGGGGAAAAGG + Intergenic
1014017118 6:116545662-116545684 TGCTCTTTGCTGAGCTGAAGAGG + Intronic
1016923421 6:149317764-149317786 CGCTCCTGGCTGAGGGGGAGGGG - Intronic
1017078087 6:150638427-150638449 AGCTTCTGGCTGAGTGGTAGGGG - Intronic
1017131307 6:151110545-151110567 GGGACCTGGCTGAGAGGAAGGGG + Intergenic
1018067507 6:160134136-160134158 TCCTCCTGCCTACGGGGAAGGGG + Intronic
1018750344 6:166798770-166798792 TGCACCTGTCTGTGGAGAAGGGG - Intronic
1018900696 6:168050402-168050424 TGTTCCTGGCTACGGGGGAGGGG - Intergenic
1019127008 6:169847279-169847301 TCTTCCTGGGTGAGGGGAGGCGG + Intergenic
1019440010 7:1041223-1041245 GGCTCCGCGCTGCGGGGAAGGGG + Intronic
1019440020 7:1041251-1041273 GGCTCCGCGCTGCGGGGAAGGGG + Intronic
1019440030 7:1041279-1041301 GGCTCCGCGCTGCGGGGAAGGGG + Intronic
1019441988 7:1052198-1052220 TGCTCCAGGCTGAGTGGGTGAGG + Intronic
1019684853 7:2375728-2375750 TGCTCATGGTTGCGGGGAGGTGG + Intronic
1020066136 7:5190076-5190098 TGGGCCTGGCTGAGGGCGAGCGG - Intergenic
1020181806 7:5928491-5928513 CTCTCCTGGCCGAGGAGAAGGGG - Intronic
1020301126 7:6796449-6796471 TTCTCCTGGCCGAGGAGAAGGGG + Intronic
1021606768 7:22416049-22416071 TTCTCCAGGCTAAGGAGAAGAGG - Intergenic
1023276120 7:38520658-38520680 GACTCCTGACTGAGGGGATGGGG + Intronic
1023519278 7:41034563-41034585 TGCACCAGGCTGAGGGTAATTGG + Intergenic
1028822256 7:95225947-95225969 TTCTCCTGTCTGAAAGGAAGGGG - Exonic
1029109160 7:98203490-98203512 TGCGCCTGCCAGTGGGGAAGCGG + Intronic
1029144927 7:98439133-98439155 GTCTCATGGCAGAGGGGAAGGGG - Intergenic
1029295444 7:99536744-99536766 TCCTTCTGGCTGGGGAGAAGTGG - Intergenic
1029508564 7:100978283-100978305 GGCTCCTGGCTGAGTTGTAGAGG - Intronic
1029532065 7:101132083-101132105 TGCTGTGGGCTGTGGGGAAGGGG - Intronic
1029624866 7:101714355-101714377 TCCTCCAGGCTCAGAGGAAGTGG - Intergenic
1032391265 7:131556687-131556709 GGCTCCTGGGGGAGGGGGAGGGG - Intronic
1032414433 7:131725485-131725507 TGGCCCTGGCTCAGGGGAGGAGG + Intergenic
1032476962 7:132218080-132218102 TGCTCCTGTCTCAGGGCATGGGG + Intronic
1032530435 7:132615396-132615418 CGCCCCTGGCGGAGGGGACGGGG + Intronic
1032651281 7:133881290-133881312 TGTTCATGGCTGGGGTGAAGGGG - Intronic
1033283337 7:140021425-140021447 TGCTCCTGGCTGAAGGGGATGGG - Intergenic
1033328742 7:140400535-140400557 TGCCCATGGCTGGAGGGAAGGGG + Intronic
1034254904 7:149719598-149719620 GGCTCCTGGAGGAGGGGCAGAGG + Exonic
1034414126 7:150955957-150955979 GGCTGCTGGCGGAGGGGGAGGGG - Intronic
1035040657 7:155924637-155924659 TATTCATGGCAGAGGGGAAGGGG - Intergenic
1036623457 8:10444700-10444722 TGATCCTGGGAGAGGTGAAGAGG + Intergenic
1036767504 8:11558115-11558137 TCCTGCTGGCTGAGAGGATGGGG - Intronic
1037582510 8:20253971-20253993 TGCTCCAGGCTTAATGGAAGAGG - Intronic
1037998111 8:23368157-23368179 TGCGCCTGGCTGGGCAGAAGAGG - Exonic
1038676818 8:29630311-29630333 TCCTGCTGGCTGAGGGGTAAAGG - Intergenic
1039901152 8:41753426-41753448 AGTTGCTGACTGAGGGGAAGGGG - Intronic
1041203162 8:55471379-55471401 TGCTGCTGGTTGAGGGGAAAAGG - Intronic
1042203875 8:66308721-66308743 TGCTACTGGAGGATGGGAAGAGG - Intergenic
1042555803 8:70033066-70033088 TGCGCCAGGTGGAGGGGAAGGGG + Intergenic
1042657530 8:71116227-71116249 TGCTGCTGGCTGAGACCAAGTGG + Intergenic
1043453497 8:80391924-80391946 TGCTCTGGGTTGAGGGGAATGGG + Intergenic
1044199930 8:89422474-89422496 TGGTTCCCGCTGAGGGGAAGGGG - Intergenic
1044608966 8:94073330-94073352 CGCTCCTGGCTTAGGAGAAATGG + Intergenic
1045353277 8:101361846-101361868 TTCTCCTTGATGAGTGGAAGTGG - Intergenic
1045461961 8:102433084-102433106 TGCTTGTGCCTGAGAGGAAGAGG + Intergenic
1048309640 8:133310438-133310460 TGTTCCTGGATGAGGGCAAGGGG + Intergenic
1049164565 8:141117990-141118012 TGCTCAAGGCAGAGGGGACGTGG + Intronic
1049276613 8:141723264-141723286 TGCTTCTGGCAAAGAGGAAGAGG - Intergenic
1049831740 8:144705226-144705248 GGCTCCAGGCTGAGGGGGAGAGG - Intergenic
1050138192 9:2490406-2490428 TGATCTAGGCTCAGGGGAAGTGG + Intergenic
1052974701 9:34402061-34402083 GGCTCCTTCCTGAGGGGATGGGG + Intronic
1053449706 9:38182815-38182837 TGCTTATGGCTGGGGGGCAGTGG - Intergenic
1054746148 9:68855826-68855848 TCCTCCTCTCTGAGAGGAAGTGG + Intronic
1054746305 9:68857333-68857355 TCCTCCTCTCTGAGAGGAAGTGG - Intronic
1055421407 9:76147360-76147382 TGCTCCTGGCATGAGGGAAGGGG + Intronic
1056554377 9:87676690-87676712 AGCTCCTGGTGGAGGGGAAGGGG + Intronic
1056840594 9:89995705-89995727 GGCCCCTGCCTGAGGGAAAGAGG - Intergenic
1056936559 9:90919340-90919362 TGGCCCTGGCTGAGGAGAACAGG - Intergenic
1057206657 9:93177452-93177474 TGCTAGGGGCTGAGGGGAGGAGG + Intergenic
1057341361 9:94204792-94204814 CGCTGCTGGCTGTGGGGAGGGGG - Intergenic
1057955979 9:99408351-99408373 TGCTCCTCACACAGGGGAAGAGG - Intergenic
1058672076 9:107368066-107368088 TGCTCCAGGATGATGGGCAGTGG + Intergenic
1059681995 9:116594860-116594882 TGCTTTTGGCTGAGGGTATGGGG - Intronic
1060325912 9:122615415-122615437 TGCCCTTGGCTGAGGGGATCCGG - Exonic
1060347394 9:122828667-122828689 TACTCCCAGCTGAGGGGCAGGGG + Intergenic
1060478193 9:124000346-124000368 TGCTCCCGGCTCAGTGGCAGCGG - Intergenic
1060734339 9:126056831-126056853 TGGCCCTGGCTGAGGGAGAGAGG - Intergenic
1060897044 9:127224950-127224972 TGCTCCGGGCTGAGGGCGCGGGG + Intronic
1062067665 9:134537423-134537445 TGCTCCTGGAAGATGGGAGGGGG - Intergenic
1062093577 9:134691124-134691146 TGCTCCTGGCTGGAGGCCAGAGG - Intronic
1062232074 9:135487297-135487319 TGCTCCTGCCCGAGGGGATCCGG + Exonic
1062492738 9:136815082-136815104 TGCCCCTGCCTCAGGGGATGAGG - Intronic
1185613055 X:1403443-1403465 CGCTCCTGGATGAGGAGAAGAGG - Exonic
1185846372 X:3441444-3441466 CTCCCTTGGCTGAGGGGAAGGGG + Intergenic
1186465330 X:9780241-9780263 TCCTGGTGGCTGAGAGGAAGTGG - Intronic
1186511770 X:10135014-10135036 TGGTCCTGGCAAAGGGGCAGTGG + Intronic
1187275970 X:17816936-17816958 TGCATCAAGCTGAGGGGAAGGGG - Intronic
1191971939 X:66826439-66826461 TACTCCTGGCAGAAGGCAAGTGG - Intergenic
1192776270 X:74248953-74248975 TGCTGCTGGCTGAGTAGAGGCGG - Intergenic
1193494695 X:82196913-82196935 TTCTCCTGGCTGGGGAGCAGGGG + Intergenic
1195283679 X:103361291-103361313 TGCTCTTTGTTCAGGGGAAGAGG + Intergenic
1196733137 X:118961530-118961552 TGCTCAGGGCTGAAGGGAATAGG + Intergenic
1198940071 X:141944699-141944721 TTCACCTGAATGAGGGGAAGTGG - Intergenic
1199609156 X:149598882-149598904 TGCTCCCGGGTGCGGGGTAGGGG + Intronic
1199629962 X:149770473-149770495 TGCTCCCGGGTGCGGGGTAGGGG - Intergenic
1199714043 X:150493260-150493282 TGCTCCAGGCAGAGGGGATTAGG - Intronic
1199770003 X:150969228-150969250 AGGACCTGGCTGAGGGGAGGGGG - Intergenic
1199856064 X:151759629-151759651 TGCTCAGGGCTGAGGGCAGGAGG - Intergenic
1200136190 X:153875882-153875904 GGCTCCGGCCGGAGGGGAAGGGG + Exonic
1200136951 X:153879833-153879855 TGCTGCTGGCTGGGAGTAAGTGG + Intronic
1201680699 Y:16641443-16641465 TGCTCCTGGCTGAGGACAGCAGG - Intergenic