ID: 1083847686

View in Genome Browser
Species Human (GRCh38)
Location 11:65345508-65345530
Sequence GGGGAAGTGGCCGTCACTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 123}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083847683_1083847686 -5 Left 1083847683 11:65345490-65345512 CCTGATGCTCCTGGCTGAGGGGA 0: 1
1: 0
2: 0
3: 22
4: 215
Right 1083847686 11:65345508-65345530 GGGGAAGTGGCCGTCACTCAAGG 0: 1
1: 0
2: 0
3: 6
4: 123
1083847672_1083847686 20 Left 1083847672 11:65345465-65345487 CCCCAGAAGCTAGAGAGCCCCAC 0: 1
1: 0
2: 1
3: 10
4: 135
Right 1083847686 11:65345508-65345530 GGGGAAGTGGCCGTCACTCAAGG 0: 1
1: 0
2: 0
3: 6
4: 123
1083847674_1083847686 18 Left 1083847674 11:65345467-65345489 CCAGAAGCTAGAGAGCCCCACGG 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1083847686 11:65345508-65345530 GGGGAAGTGGCCGTCACTCAAGG 0: 1
1: 0
2: 0
3: 6
4: 123
1083847677_1083847686 3 Left 1083847677 11:65345482-65345504 CCCCACGGCCTGATGCTCCTGGC 0: 1
1: 0
2: 2
3: 21
4: 1654
Right 1083847686 11:65345508-65345530 GGGGAAGTGGCCGTCACTCAAGG 0: 1
1: 0
2: 0
3: 6
4: 123
1083847678_1083847686 2 Left 1083847678 11:65345483-65345505 CCCACGGCCTGATGCTCCTGGCT 0: 1
1: 0
2: 1
3: 9
4: 165
Right 1083847686 11:65345508-65345530 GGGGAAGTGGCCGTCACTCAAGG 0: 1
1: 0
2: 0
3: 6
4: 123
1083847679_1083847686 1 Left 1083847679 11:65345484-65345506 CCACGGCCTGATGCTCCTGGCTG 0: 1
1: 0
2: 2
3: 29
4: 251
Right 1083847686 11:65345508-65345530 GGGGAAGTGGCCGTCACTCAAGG 0: 1
1: 0
2: 0
3: 6
4: 123
1083847673_1083847686 19 Left 1083847673 11:65345466-65345488 CCCAGAAGCTAGAGAGCCCCACG 0: 1
1: 0
2: 0
3: 7
4: 112
Right 1083847686 11:65345508-65345530 GGGGAAGTGGCCGTCACTCAAGG 0: 1
1: 0
2: 0
3: 6
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083847686 Original CRISPR GGGGAAGTGGCCGTCACTCA AGG Intronic
900108927 1:997645-997667 GGGGAAGGGGGCCTCCCTCACGG + Intergenic
900318743 1:2072193-2072215 GGAGAAGTGGCCGTGCCTCGTGG + Intronic
900597971 1:3491046-3491068 GGGGAAGTGGAGGTCCCTGAAGG - Intronic
902581737 1:17412075-17412097 GGGGAAGTGGAAGCCAGTCAGGG - Intronic
904263511 1:29304712-29304734 GGGGAAGGGGCCCTCAGTGAGGG + Intronic
905186914 1:36203615-36203637 GGCTAAGTGGCAGTCACCCAAGG + Intergenic
907311833 1:53543239-53543261 GGGGAAGTGGTCCTCCCTCATGG + Intronic
907411621 1:54287467-54287489 TGGGAAATGGAGGTCACTCAAGG + Intronic
915331409 1:155114979-155115001 GGGGAAGTGGCAGTTAATCTGGG + Intergenic
919067107 1:192706396-192706418 GGGGAAGAGGCCTGCGCTCAAGG + Intergenic
919645520 1:200090829-200090851 GGGGCAGAGGCTGACACTCAGGG - Intronic
1070472486 10:76796498-76796520 GGGGAAGAGGCCCGGACTCAGGG + Intergenic
1070488551 10:76954023-76954045 GAGGAAGTGGTTGTCACTGAAGG + Intronic
1074699780 10:116082927-116082949 GGGGAAGTGGCCTCCACTATTGG - Intronic
1075178592 10:120188919-120188941 GTGGATGTGGCCTTCACTCTGGG - Intergenic
1075267796 10:121019459-121019481 GTGGAGGTGGCAGCCACTCAAGG - Intergenic
1077377982 11:2214561-2214583 GTGGAAGAGGCCGTCCCGCAAGG - Intergenic
1077530753 11:3093725-3093747 GGGTAAGGGGCCGTCCCTCAGGG - Exonic
1083163813 11:60871486-60871508 GGGGAAATGTCCCTCTCTCAGGG + Intronic
1083320430 11:61842634-61842656 GGGGATGTGGGCTCCACTCATGG + Intronic
1083847686 11:65345508-65345530 GGGGAAGTGGCCGTCACTCAAGG + Intronic
1084518549 11:69649273-69649295 GGGGAAGCGGTTTTCACTCAGGG - Intronic
1084571414 11:69962273-69962295 GGGGACGTGGCCCCCACTCGGGG + Intergenic
1084739218 11:71128146-71128168 GGTGAAGAGGCCGAGACTCATGG - Intronic
1084907061 11:72356510-72356532 GAACAAGTTGCCGTCACTCAGGG - Intronic
1089681060 11:120119243-120119265 GGAGAAGTGTGCGTCACCCATGG - Intronic
1090957857 11:131529732-131529754 GGGTAGGTGGGCGTCACTCCAGG - Intronic
1096414837 12:51404043-51404065 AGGGAAGTAGGCTTCACTCAGGG + Intronic
1101846742 12:108368881-108368903 GGAGAAGTGGGGTTCACTCAGGG + Intergenic
1104323967 12:127778317-127778339 GGGGAAGGGACCCTCACTCTGGG - Intergenic
1104831237 12:131753257-131753279 GGGGCGGTGGTCGTCACTCCAGG - Exonic
1108779849 13:53816253-53816275 GGAAAAGTGGCCTTCACTCATGG - Intergenic
1110006344 13:70275862-70275884 AGGGGAGTGGCAGTCAATCATGG - Intergenic
1111882709 13:93978144-93978166 GAGGAAGTGGCCATCAGCCAAGG + Intronic
1113266195 13:108620763-108620785 TGGGAAGTGGAGGCCACTCAAGG - Intronic
1113897255 13:113773478-113773500 CTGGCAGTGGCCGTCACTCTTGG - Intronic
1117827031 14:59714667-59714689 TGGGAAGTGGCTCTCAGTCACGG - Intronic
1124497144 15:30193467-30193489 GGGGGAGGGGCAGTCATTCAGGG + Intergenic
1124746430 15:32345180-32345202 GGGGGAGGGGCAGTCATTCAGGG - Intergenic
1125003860 15:34796478-34796500 GGGGCAGAGGCCCTCACTCCAGG + Intergenic
1128309223 15:66620169-66620191 GGGGAACTGGTTGTCCCTCAGGG - Intronic
1129858724 15:78843762-78843784 GGGGACGTTGCTGACACTCATGG + Intronic
1130577611 15:85106284-85106306 GGGGAAGTGGCAGATTCTCAAGG - Intronic
1132574471 16:658150-658172 TGGTAAGTGGCCGACAGTCAGGG - Intronic
1134091801 16:11395482-11395504 GGGGAAGTGACAGTCAGTCCCGG + Intronic
1136061889 16:27732375-27732397 TGGGAAGTGACCTTCATTCATGG - Intronic
1136282294 16:29220929-29220951 GAGGAAGCGGCTGTGACTCACGG + Intergenic
1141763434 16:86043855-86043877 GGGGAAGGAGCCGTGAGTCAAGG + Intergenic
1142001043 16:87664707-87664729 GGGCCAGTGGCCTTCACTCCGGG - Intronic
1142086666 16:88186847-88186869 GAGGAAGCGGCTGTGACTCACGG + Intergenic
1146214799 17:30970844-30970866 GGGCAAGAGGCCGCCACTGAAGG + Exonic
1148587061 17:48788446-48788468 GGGGAAGTGGGGGTCAGACAGGG + Intronic
1150268872 17:63849631-63849653 GGGGCAGTGGCCCTCACACAAGG + Intergenic
1151299149 17:73209562-73209584 GTGGAAGTGGGCCTCCCTCAGGG + Exonic
1151727850 17:75894885-75894907 GAGGAGGTGACCCTCACTCATGG + Intronic
1156466142 18:37348847-37348869 GAGGAAGAAGCAGTCACTCAAGG + Intronic
1160223013 18:76990938-76990960 GGGGAAGTGACGGTAATTCAAGG + Intronic
1163777171 19:19225392-19225414 GGGGGCGTGGCCCTCACCCAGGG - Intronic
1165832527 19:38736599-38736621 GGAGAGGTGGCCGCCGCTCAGGG + Intronic
1166400009 19:42471644-42471666 GAGGATGTGGCCCTCAGTCAGGG + Intergenic
1167794733 19:51702137-51702159 GGGGAAATAGTCGTCCCTCAAGG - Intergenic
925426399 2:3751969-3751991 GGGGAACTGACAGTCACTGAGGG - Intronic
927513456 2:23658578-23658600 GGGGAGGTGGCCGTCCATGAGGG + Intronic
928437195 2:31262197-31262219 GGGCCAGTGGCCATCACACATGG + Intronic
930878831 2:56249200-56249222 GAGGAAGTGGCTGTCACTATAGG + Intronic
933682757 2:85117498-85117520 GGGGAATTTGCAGTCTCTCAGGG - Intergenic
934031923 2:88055804-88055826 GGGGAAGTCGCCGCCACTACCGG + Intergenic
934665135 2:96164367-96164389 GGGGAAGGAGCCCTCACTCTGGG + Intergenic
947742031 2:232489038-232489060 GGGGCAGAGGCCGGCACTCAGGG - Intergenic
949075150 2:242052505-242052527 GGGGCAGTGCCTGACACTCAGGG + Intergenic
1168841392 20:912206-912228 GGGGGAATGGCAGTCACACACGG + Intronic
1172054607 20:32145355-32145377 GTGGATCTGGACGTCACTCATGG - Exonic
1172452716 20:35039272-35039294 TGGGAAGTGCCCGGTACTCAGGG + Intronic
1172992757 20:39048412-39048434 GGGGAAGTGGGGGACACACAAGG - Intergenic
1174308295 20:49630910-49630932 GGGGCAGTGCCCGCCTCTCAAGG + Intergenic
1175357214 20:58377937-58377959 GGGGAAGTGGCCATGAGCCAAGG + Intergenic
1184842952 22:47063291-47063313 GGGCTAGTGGCTGTCACTAAGGG + Intronic
949940641 3:9151727-9151749 AGGGAAGTGGCTGTCAGACATGG + Intronic
952422630 3:33145430-33145452 GGGGAGATGGCCTTCACCCACGG + Exonic
957307869 3:78481144-78481166 GTGGAAGTTGCAGCCACTCATGG + Intergenic
960811884 3:121633925-121633947 GAGGAAGGGGCCGTCACTTCAGG - Intronic
966937682 3:184723944-184723966 GGGGAATTTGCACTCACTCACGG - Intergenic
968064797 3:195752738-195752760 GGAGAAGTGGCCCTCACGCTAGG + Intronic
968127429 3:196170077-196170099 GGGGAAGTTGCCGTCCATCCTGG - Intergenic
975648874 4:76572438-76572460 GGGGAAGTGTCAGTCACACAGGG - Intronic
976536200 4:86221084-86221106 TGGGAAGTGCCCATCAGTCAGGG + Intronic
981098181 4:140803173-140803195 GGGGAAGTTGCAGTGAGTCAAGG - Intergenic
982068269 4:151673276-151673298 GTGGAGGTGCCCATCACTCATGG + Intronic
985528802 5:421721-421743 GAGGAGGTGGCCCTCACTAAAGG - Intronic
987078880 5:14408733-14408755 GGGAAAGTGGCCCGCATTCAGGG + Intronic
989812848 5:45697553-45697575 GGAGAAGGGGCAGGCACTCAAGG + Intergenic
992181883 5:74205565-74205587 GTTGAAGTGGCCAGCACTCATGG - Intergenic
996409846 5:123145749-123145771 GGAAAAGTGGCCGTCTGTCAAGG - Intronic
996588636 5:125120238-125120260 GGGGCAGTGACGGTCACTGAGGG + Intergenic
997207583 5:132059206-132059228 GGTGAAGAGGCTGTGACTCAAGG - Intergenic
1000017597 5:157291590-157291612 GGGGAAGTGACAGTCACGTAAGG - Intronic
1002205215 5:177558094-177558116 GGGGACTTTGCAGTCACTCAGGG + Intergenic
1002457420 5:179353515-179353537 GGTGAAGAGGCTGACACTCAGGG + Intergenic
1003612024 6:7622403-7622425 GGGGCAGTGGACTTCACTCTAGG - Intergenic
1005677407 6:28169135-28169157 GAGGAAATGGACCTCACTCAGGG + Intergenic
1010556841 6:77292567-77292589 GGGGAGGTGTGCCTCACTCAAGG + Intergenic
1018724103 6:166597328-166597350 GAGGAGGTGGCAGTCACTGAAGG + Intronic
1021621259 7:22552930-22552952 GGGGCCATGGCAGTCACTCAGGG - Intronic
1026342880 7:69449185-69449207 GGGGAAGTTTCCTTCACACAAGG + Intergenic
1026869089 7:73840068-73840090 GGGCACCTGGCCGTCACTGAGGG + Exonic
1034567357 7:151926173-151926195 GGGGTGGTGGTTGTCACTCAAGG - Intergenic
1035270328 7:157715995-157716017 GGGGCAGTGGCTGTCTCACATGG - Intronic
1038419303 8:27422188-27422210 GGGTGGGTGGCTGTCACTCAGGG + Intronic
1040300189 8:46183956-46183978 GGGCGGGTGGCAGTCACTCAGGG - Intergenic
1040302039 8:46193052-46193074 GGGAGAGTGGCCGGGACTCAGGG + Intergenic
1040310237 8:46233095-46233117 GGGAAAGTGGCAGAGACTCAGGG + Intergenic
1040311215 8:46237809-46237831 GGGCAAGTGGCAGGGACTCAGGG + Intergenic
1040338799 8:46429567-46429589 GGGCAAGTGGCAGAAACTCAAGG + Intergenic
1040508786 8:48075325-48075347 GGGGAAGGTGCTGTGACTCAGGG + Intergenic
1047968730 8:130066830-130066852 GGGGCAGTGGCCCTCAGTCTTGG - Intronic
1048333757 8:133488689-133488711 GGGGAAGTGGTAGTGACTGAGGG + Intronic
1048987767 8:139744392-139744414 TGGGAAGGGGCCTTCTCTCAGGG + Intronic
1049377478 8:142296083-142296105 GGGGAGGGGGTGGTCACTCATGG + Intronic
1049377567 8:142296339-142296361 GGGGAGGCGGTGGTCACTCATGG + Intronic
1049653604 8:143788167-143788189 GGGCAAGTGGCATTCACACACGG + Intergenic
1050247167 9:3703064-3703086 GGGGAATTGGCTATCACTGAAGG - Intergenic
1051842959 9:21419160-21419182 GAGGAAGAGGCCATCACTGAGGG + Intronic
1053271683 9:36754349-36754371 GGGGAAGAGGCCAGCACTGAAGG - Intergenic
1055030515 9:71768554-71768576 AGGGAAGTGCGCGTCACTCTCGG - Exonic
1059736070 9:117101199-117101221 GGGGAGGTGGCAGCCACCCAAGG + Intronic
1060053606 9:120394110-120394132 CGGGGAGTGGCAGTCCCTCAGGG - Intronic
1186357173 X:8800803-8800825 GGGGAAGTGGCAGACAGGCAGGG - Intronic
1187751106 X:22465950-22465972 GAGGAAGAGGCCGTCGGTCAGGG - Intergenic
1187832303 X:23394771-23394793 GGTAGAGTGGCCATCACTCATGG + Exonic
1190831946 X:54066456-54066478 GGGGAAGTGGCCATCTATCTTGG - Intergenic