ID: 1083851237

View in Genome Browser
Species Human (GRCh38)
Location 11:65368530-65368552
Sequence AAACTCTAGCTGGCATACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083851237_1083851239 13 Left 1083851237 11:65368530-65368552 CCTCTGTATGCCAGCTAGAGTTT No data
Right 1083851239 11:65368566-65368588 TTTGTTTTGTTTTTTTGAGACGG 0: 930
1: 1831
2: 93465
3: 76899
4: 89973

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083851237 Original CRISPR AAACTCTAGCTGGCATACAG AGG (reversed) Intergenic
No off target data available for this crispr