ID: 1083852116

View in Genome Browser
Species Human (GRCh38)
Location 11:65374306-65374328
Sequence CCATGTGCCCAGGTGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083852107_1083852116 25 Left 1083852107 11:65374258-65374280 CCAGGGTGGTGTGGGGGGAGTTG No data
Right 1083852116 11:65374306-65374328 CCATGTGCCCAGGTGGAGCAGGG No data
1083852106_1083852116 26 Left 1083852106 11:65374257-65374279 CCCAGGGTGGTGTGGGGGGAGTT No data
Right 1083852116 11:65374306-65374328 CCATGTGCCCAGGTGGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083852116 Original CRISPR CCATGTGCCCAGGTGGAGCA GGG Intergenic
No off target data available for this crispr