ID: 1083852123

View in Genome Browser
Species Human (GRCh38)
Location 11:65374332-65374354
Sequence CCATGTGCCCAGGTGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083852113_1083852123 4 Left 1083852113 11:65374305-65374327 CCCATGTGCCCAGGTGGAGCAGG No data
Right 1083852123 11:65374332-65374354 CCATGTGCCCAGGTGGAGCAGGG No data
1083852111_1083852123 6 Left 1083852111 11:65374303-65374325 CCCCCATGTGCCCAGGTGGAGCA No data
Right 1083852123 11:65374332-65374354 CCATGTGCCCAGGTGGAGCAGGG No data
1083852112_1083852123 5 Left 1083852112 11:65374304-65374326 CCCCATGTGCCCAGGTGGAGCAG No data
Right 1083852123 11:65374332-65374354 CCATGTGCCCAGGTGGAGCAGGG No data
1083852115_1083852123 3 Left 1083852115 11:65374306-65374328 CCATGTGCCCAGGTGGAGCAGGG No data
Right 1083852123 11:65374332-65374354 CCATGTGCCCAGGTGGAGCAGGG No data
1083852118_1083852123 -5 Left 1083852118 11:65374314-65374336 CCAGGTGGAGCAGGGTAGCCATG No data
Right 1083852123 11:65374332-65374354 CCATGTGCCCAGGTGGAGCAGGG No data
1083852117_1083852123 -4 Left 1083852117 11:65374313-65374335 CCCAGGTGGAGCAGGGTAGCCAT No data
Right 1083852123 11:65374332-65374354 CCATGTGCCCAGGTGGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083852123 Original CRISPR CCATGTGCCCAGGTGGAGCA GGG Intergenic
No off target data available for this crispr