ID: 1083854154

View in Genome Browser
Species Human (GRCh38)
Location 11:65384120-65384142
Sequence CAGCAAGGCTGTAGGGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083854154_1083854161 0 Left 1083854154 11:65384120-65384142 CCCACTTCCCTACAGCCTTGCTG No data
Right 1083854161 11:65384143-65384165 AAGGGAAGCCCACCTAAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083854154 Original CRISPR CAGCAAGGCTGTAGGGAAGT GGG (reversed) Intergenic
No off target data available for this crispr