ID: 1083854451

View in Genome Browser
Species Human (GRCh38)
Location 11:65385879-65385901
Sequence ATGGTGTGAACCCCAGGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1605
Summary {0: 14, 1: 307, 2: 305, 3: 324, 4: 655}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083854451_1083854459 7 Left 1083854451 11:65385879-65385901 CCGCCCCCTGGGGTTCACACCAT 0: 14
1: 307
2: 305
3: 324
4: 655
Right 1083854459 11:65385909-65385931 CCTCAGCCTTCCCGCGTAGCTGG No data
1083854451_1083854460 8 Left 1083854451 11:65385879-65385901 CCGCCCCCTGGGGTTCACACCAT 0: 14
1: 307
2: 305
3: 324
4: 655
Right 1083854460 11:65385910-65385932 CTCAGCCTTCCCGCGTAGCTGGG No data
1083854451_1083854462 16 Left 1083854451 11:65385879-65385901 CCGCCCCCTGGGGTTCACACCAT 0: 14
1: 307
2: 305
3: 324
4: 655
Right 1083854462 11:65385918-65385940 TCCCGCGTAGCTGGGACTACAGG 0: 392
1: 56827
2: 179806
3: 270892
4: 192530

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083854451 Original CRISPR ATGGTGTGAACCCCAGGGGG CGG (reversed) Intergenic
900070745 1:770016-770038 ATTGTTTGAACCCAGGGGGGCGG + Intergenic
900168913 1:1256798-1256820 ATGGCGTGAACCCCGGGGGGCGG + Intronic
900272527 1:1799004-1799026 ATGGCGTGAACCCCGGGGGGCGG - Intronic
900279300 1:1855617-1855639 CTGGCATGAACCCCGGGGGGCGG + Intronic
900717459 1:4154082-4154104 ATGGTGTGACCCCCAGCGTGAGG + Intergenic
901385589 1:8906678-8906700 AAGGCGTGAACCCCGGGAGGCGG - Intergenic
901809909 1:11761800-11761822 CTGGTAGGAACCCCAGGGGCAGG - Exonic
901830742 1:11890588-11890610 ATGGTGTGAACCCAGGAGGCGGG + Intergenic
901847591 1:11993647-11993669 ATGGTGTGAACCCCAGGGGGCGG + Intronic
902035081 1:13452179-13452201 ATGGTGTGAACCTTGGGAGGTGG - Intergenic
902347930 1:15832673-15832695 ATGGCATGAACCCCGGGAGGCGG - Intergenic
902454971 1:16526834-16526856 ATGGTGTGAACCCAGGAGGGTGG - Intergenic
902455060 1:16527393-16527415 ATTGCTTGAACCCCAGGGGCTGG + Intergenic
902497111 1:16880508-16880530 ATTGCTTGAACCCCAGGGGGTGG - Intronic
902497199 1:16881069-16881091 ATGGTGTAAACCCGGGAGGGCGG + Intronic
902547050 1:17196691-17196713 ATCGTGAGAACCACAGCGGGTGG + Intergenic
902572938 1:17358479-17358501 ATGGCGTGAACTCCAGGGGGCGG + Intronic
902576182 1:17379197-17379219 ATGGCGTGAACCCCAGGGGGCGG - Intronic
902815458 1:18913915-18913937 ATGGCGTGAACCCCAGGGGGCGG - Intronic
903123056 1:21228925-21228947 ATGGCGTGAACCCCGGGGGGCGG - Intronic
903134614 1:21301406-21301428 ATGGCGTGAACCCCAGGGGGCGG + Intronic
903350620 1:22714215-22714237 AGGCTGTGAACCCCCCGGGGCGG + Intronic
903362896 1:22788145-22788167 AGGGTGTGAATGCCAGGAGGTGG + Intronic
903713137 1:25341342-25341364 ATGGCGTGAACCCCGGGAAGCGG - Intronic
903785432 1:25858079-25858101 ATGGCGTGAACCCCGGAGGTGGG + Intronic
903901453 1:26648955-26648977 ATGGCGTGAACCCCGGGGGGCGG + Intergenic
903940327 1:26925452-26925474 ATGGCGTGAACCCCGGGGGGCGG + Intronic
904171304 1:28593597-28593619 ATTCTGTGGATCCCAGGGGGAGG + Intronic
904514582 1:31044313-31044335 ATGGCGGGAACCCCAGGGGGCGG + Intronic
904713969 1:32452769-32452791 ATGGCGTGAATCCCAGGGGGCGG + Intergenic
904887234 1:33749182-33749204 ATGGCGTGAACCTGGGGGGGTGG - Intronic
905147984 1:35903090-35903112 ATGGCGTGAAACCCGGGAGGTGG - Intronic
905379201 1:37548064-37548086 ATGGCGTGAACCCCGGGAGGCGG + Intronic
905583826 1:39102088-39102110 ATGGCGTGAACCCCGGGGGGCGG + Intronic
906042480 1:42798827-42798849 ATGGCGTGAATCCCGGGGGGCGG - Intergenic
906050161 1:42864241-42864263 ATGGTGTGAACCCCGGGGGGCGG + Intergenic
906066482 1:42984755-42984777 ATGGTGGGACTCCCATGGGGTGG - Intergenic
906468004 1:46102069-46102091 ATGGCGTGAACCCCAGGGGGCGG - Intronic
906478721 1:46186746-46186768 ATGGCGTGAACCCCAGGGGGCGG - Intergenic
906500314 1:46337172-46337194 ATGGCGTGAACCCCCGGGGGCGG + Intergenic
906541343 1:46588719-46588741 ATGGCGTAAACCCCGGGGGGCGG + Intronic
906611505 1:47206994-47207016 ATGGTGTGAACCCGGGAGGCGGG + Intergenic
906736317 1:48132644-48132666 ATGGCGTGAACCCCGTGGGGCGG - Intergenic
906874850 1:49526004-49526026 ATGGCGTGAACCCTGGGAGGTGG + Intronic
907137697 1:52155318-52155340 ATGGCATGAACCCCGGGGGGCGG - Intronic
907383254 1:54108884-54108906 ATGGTGTGAACCCGGGTGGCGGG + Intronic
907781303 1:57569170-57569192 ATGGCGTGAACCCCAGGGGGCGG + Intronic
909322679 1:74309280-74309302 ATGGCGTGAACCCCAGGGGGCGG + Intronic
909723270 1:78802021-78802043 ATGGCGTGAACCCGGGGGGCGGG + Intergenic
910335271 1:86121140-86121162 ATGGGGTGAAGGGCAGGGGGAGG + Intronic
910453548 1:87371962-87371984 ATGGCGTGAACCCCGGGGGGCGG - Intergenic
910973271 1:92878732-92878754 ATAGCGTGAACCCCGGGGGGCGG + Intronic
911148693 1:94576440-94576462 GTGGAGTGAACCCCAGGGGGCGG - Intergenic
911175795 1:94816596-94816618 AGGGTGTAAACACCAGGAGGTGG + Intergenic
911183110 1:94878146-94878168 ATGGCGTGAACCCCAGGGGGCGG + Intronic
911186232 1:94907772-94907794 ATGGTGTGAACCCGGGAGGCGGG + Intronic
911698482 1:100923100-100923122 ATGGCGTGAACCCCAGGGGGCGG - Intronic
911807395 1:102228837-102228859 ATGGCGTGAACCCCGGGGGGTGG + Intergenic
911825518 1:102480162-102480184 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
912356072 1:109055203-109055225 ATGGCGTGAACCCCAGGGGGCGG - Intergenic
912399299 1:109375455-109375477 ATGGCGTGAACCCCAGGGGGCGG + Intronic
912619092 1:111137165-111137187 ATGGTGTGAACCCCGGGGGGCGG + Intronic
912697862 1:111855085-111855107 ATGAAGTGGACCCCAGGGGGTGG - Intronic
912817897 1:112844155-112844177 ATGGCGTGAACCCGGGAGGGCGG + Intergenic
912912317 1:113774589-113774611 ATGGTGTGAACCCGGGAGGAGGG + Intronic
913002075 1:114590690-114590712 ATGGTGTGAACCCCGGAGGGTGG + Intronic
913256663 1:116960420-116960442 ATGCAGTGAACCCCAGAGGAAGG + Intronic
913579207 1:120209502-120209524 ATGGCGTGAACCCCAGGGGGCGG - Intergenic
913598613 1:120402248-120402270 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
913628966 1:120688885-120688907 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
913667071 1:121058211-121058233 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
914249193 1:145907854-145907876 ATGGCGTGAACCCAGGGGGGCGG - Intronic
914288694 1:146252279-146252301 ATGGCGTGAACCCCAGGGGGTGG + Intergenic
914306946 1:146428471-146428493 ATGGCGTGAACTCCAGGGGGCGG + Intergenic
914549729 1:148703023-148703045 ATGGCGTGAACCCCAGGGGGTGG + Intergenic
914561137 1:148820935-148820957 ATGGCGTGAACCCCAGGGGGCGG - Intronic
914611697 1:149309273-149309295 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
914734304 1:150401088-150401110 ATGGTGTGAACCCGGGAAGGTGG + Intronic
914745002 1:150495091-150495113 ATGGCGTGAACCCTGGGGGGTGG + Intronic
914762783 1:150612501-150612523 ATGGCATGAACCCCGGGAGGTGG - Intronic
915158336 1:153897113-153897135 ATGGCGTGAACCCCAGGGGGTGG - Intronic
915177083 1:154025012-154025034 ATGCCGTGAACCCCGGGGGGCGG - Intronic
915308793 1:154996856-154996878 ATGGTGTGAACCCGGGAGGCAGG - Intergenic
915359115 1:155274911-155274933 ATGGCGTGAACCCCAGGGGGCGG + Intronic
915688970 1:157667666-157667688 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
915923528 1:159997362-159997384 ATGGCGTGAACCCCGGGGGGCGG - Intergenic
916067516 1:161148356-161148378 ATGACGTGAACCCCGGGGGGCGG - Intergenic
916122207 1:161538426-161538448 ATGGCGTGAATCCCGGGGGGCGG + Intergenic
916325131 1:163548429-163548451 ATGGCGTGAACCCCAGGGGGCGG - Intergenic
916538690 1:165730248-165730270 ATGGCACGAACCCCAGGGGGCGG + Intronic
916540783 1:165752339-165752361 ATGGCGTGAACCCGGGGGGACGG - Intronic
917026565 1:170649969-170649991 ATGGCGTGAACCCCGGGGGGCGG - Intergenic
917331568 1:173885791-173885813 ATGGTGTGATCCCCATGTGTAGG - Exonic
917335973 1:173924732-173924754 ATGGCGTGAACCTGGGGGGGCGG - Intergenic
917492368 1:175508383-175508405 AGGGTGTGAATACCAGGAGGTGG - Intronic
917809198 1:178641384-178641406 ATAGCTTGAACCCCAGGAGGCGG + Intergenic
917830663 1:178881534-178881556 ATTGCTTGAACCCCAGGCGGCGG - Intronic
917888620 1:179414509-179414531 ATGGCGTGAACCCCAGGGGGCGG - Intronic
917949424 1:180015318-180015340 ATGGCATGAACCCCGGGGGGCGG - Intronic
918134079 1:181654896-181654918 ATGGCGTGAACCCCAGGGGGCGG + Intronic
918442917 1:184586367-184586389 ATGGCGTGAACCCCAGGGGGCGG - Intronic
918602611 1:186381411-186381433 ATGGCGTGAACCCCAGGGGGCGG - Intronic
918753870 1:188310171-188310193 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
918806111 1:189048012-189048034 ATGGCGTGACCCCCGGGAGGCGG - Intergenic
918963898 1:191315841-191315863 ATGGCATGAACCCCGGGAGGAGG - Intergenic
918998463 1:191794428-191794450 ATGGCGTGAACCCCGGGGGGCGG + Intergenic
919126157 1:193395996-193396018 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
919202974 1:194382211-194382233 ATGGCGTGAACCCCGGGGGGCGG - Intergenic
919332439 1:196189016-196189038 ATGGCGTGAACCCCAGGGGGCGG - Intergenic
919427191 1:197447498-197447520 AAGGTGTAAACACCAGGAGGTGG + Intronic
920118390 1:203637343-203637365 ATGGCGTGAACCCCCGGGGGGGG + Intronic
920237792 1:204520189-204520211 ATGGCATGAACCCCGGGGGGTGG + Intronic
920547141 1:206827602-206827624 ATGGCATGAACCCCGGGGGGCGG + Intronic
920997132 1:211004005-211004027 ATGGCGTGAACCCCGGGGGACGG + Intronic
921119718 1:212126173-212126195 ATGGCATGAACCCCAGGAGGTGG + Intergenic
921227909 1:213038686-213038708 ATGGCGTGAACCCCAGGGGGCGG - Intergenic
921295986 1:213704299-213704321 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
921808248 1:219480358-219480380 ACGGCGTGAACCCCGGGGAGCGG - Intergenic
921974689 1:221189593-221189615 ATGGCGTGAACCCCGGGAGGCGG + Intergenic
922108820 1:222537543-222537565 ATGGCGTGAACCCCGGGAGGTGG + Intronic
922280334 1:224117251-224117273 ATCGCTTGAACCCCAGGAGGTGG - Intronic
922285497 1:224167450-224167472 ATGGCGTGAACCCCGAGGGGCGG - Intergenic
922420316 1:225455943-225455965 ATGGCGTGAACCCCGGGGGGCGG + Intergenic
922496084 1:226059160-226059182 ATTGCTTGAACCCCAGGAGGCGG - Intergenic
922559660 1:226559885-226559907 ATGGCGTGAACCCGGGGGGGCGG + Intronic
922625422 1:227036513-227036535 ATGGCGTGAACCCCGGGGGGCGG - Intronic
922799463 1:228358385-228358407 TTGCTGTGCACCCCAAGGGGTGG + Intronic
923484839 1:234419084-234419106 ATGGCGTGAACCCTGGGGGGCGG + Intronic
923562338 1:235050728-235050750 ATGGCCTGAACCCAGGGGGGCGG + Intergenic
923760757 1:236841975-236841997 ATGGCGTGAACCCCGGGGGGCGG - Intronic
924137590 1:240986666-240986688 ATGGCGTGAACCCCAGGGGGCGG - Intronic
924476468 1:244386089-244386111 ATTGTTTGAACCCCAGGAGGCGG + Intronic
924522762 1:244819732-244819754 ATGGTGTGAACCCCGGGAGGTGG - Intergenic
924793927 1:247278510-247278532 ATGGTGTGAACCCGGGAGGCGGG + Intergenic
1062964796 10:1598872-1598894 AAGGAGTGAAGCCCAGGGGAGGG + Intronic
1063222598 10:3984372-3984394 ATGGCATGAACCCTGGGGGGCGG + Intergenic
1063468226 10:6262366-6262388 ATGGCGTGAACCCTGGGGGGCGG + Intergenic
1063586017 10:7352922-7352944 ATGGTGTGAACCCAGGAGGTGGG + Intronic
1063750111 10:8934286-8934308 ATCGCTTGAACCCCAGGAGGCGG + Intergenic
1063830504 10:9947205-9947227 ATGGCGTGAACCCGGGGGGGCGG - Intergenic
1063989752 10:11547624-11547646 ATGGCGTGAACCCCGGGAGGCGG - Intronic
1064200785 10:13283213-13283235 ATGGCGTGAACCCCAGGGGGTGG - Intronic
1064386102 10:14893087-14893109 ATGGCGTGAACCCCAGGGGGCGG - Intronic
1064413190 10:15126054-15126076 CAGCTGTGAACCCCAGGAGGTGG - Intronic
1064966610 10:21020871-21020893 ATGATGTGATCCCCAGGTGATGG - Intronic
1065017674 10:21476770-21476792 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
1065031634 10:21592540-21592562 ATGGCGTGAACCCCGGGGGGTGG - Intronic
1065032563 10:21602813-21602835 ATGGTGTGAACCCTGGGAGGTGG - Intronic
1065331061 10:24600045-24600067 ATGGTGTGAACCCGGGAGGCAGG + Intronic
1065395216 10:25228947-25228969 ATGGTATGAACCCCGGAGGCGGG + Intronic
1065534512 10:26703993-26704015 ATGGCGTGAACCCTGGGGGGCGG + Intronic
1065577163 10:27132731-27132753 ATTGCTTGAACCCCAGGAGGAGG + Intronic
1065644912 10:27824052-27824074 ATGGCGTGAACCCCAGGGGGCGG + Intronic
1065803376 10:29372691-29372713 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
1065883142 10:30054753-30054775 ATGGCGTGAACCCCAGGGGGCGG - Intronic
1066421675 10:35269713-35269735 ATCGCTTGAACCCCAGGAGGCGG - Intronic
1066535058 10:36382311-36382333 ATGGCGTGAACCCCGGGGGGCGG - Intergenic
1066540627 10:36442789-36442811 ATGGCATGAACCCCAGGGGGCGG + Intergenic
1066728075 10:38411902-38411924 ATTGTTTGAACCCAGGGGGGCGG - Intergenic
1067030641 10:42877176-42877198 ATGGTGTGAACCCCAGTCCAGGG - Intergenic
1067115733 10:43434435-43434457 ATGGCGTGAACCCCGCGGGGCGG - Intergenic
1067208401 10:44238959-44238981 ATGGCGTGAACCCCAGGGGGCGG - Intergenic
1067211433 10:44262883-44262905 AGGGTGTGTACGCCAGGGGATGG - Intergenic
1067415485 10:46098652-46098674 ATGTTGACAACACCAGGGGGAGG + Intergenic
1067435524 10:46273727-46273749 ATGTTGACAACACCAGGGGGAGG + Intergenic
1067714890 10:48683243-48683265 ATGGCGTGAACCCCGGGGGGCGG + Intergenic
1068486668 10:57667575-57667597 ATGGCGTGAGCCCCAGGGGGCGG - Intergenic
1068692364 10:59930430-59930452 ATGGCGTGAACCCCGGGGGGTGG - Intergenic
1068808407 10:61226680-61226702 ATGGCGTGAATCCCGGGGGGTGG + Intergenic
1069189109 10:65465348-65465370 ATGGCGTGAACCCCGGGGGGCGG + Intergenic
1069523907 10:69150481-69150503 ATGGTGTGAAACCCAGGAGGTGG - Intronic
1069697282 10:70396125-70396147 AGGGTGTGAGCACCAGGAGGTGG + Intergenic
1070110690 10:73484354-73484376 ATGGCATGAACCCCGGGGGGCGG - Intronic
1070141969 10:73744809-73744831 AGGGTGACAACCCAAGGGGGCGG - Intronic
1070912346 10:80129611-80129633 ATGGCGTGAACCCAGGAGGGCGG + Intergenic
1070989776 10:80721472-80721494 ATGGTGTGAACCCAGGGAGGTGG - Intergenic
1070997658 10:80800132-80800154 ATGGTGTGAATCCCAGTTTGAGG - Intergenic
1071000345 10:80824394-80824416 ATGGTGTGAAACCCGGGGGGCGG - Intergenic
1071040869 10:81308044-81308066 ATGGTGTGAACCCCAGGGGGCGG - Intergenic
1071530135 10:86383677-86383699 ATGGCATGAACCCCAGGAGGCGG + Intergenic
1071924695 10:90392315-90392337 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
1072100827 10:92227675-92227697 ATGGCGTGAACCCCGGGGGGCGG - Intronic
1072222682 10:93339991-93340013 ATGGCGTGAACCCCGGGGGGCGG + Intronic
1072466706 10:95669975-95669997 ATGGCGTGAACCCCAGGGGGCGG + Intronic
1072658682 10:97348634-97348656 ATGGCGTGAACCCCAGGGGGCGG - Intergenic
1073054496 10:100690514-100690536 ATGGCGTGAACCCCGTGGGGCGG - Intergenic
1073156062 10:101347837-101347859 ATGGCGTGAACCCCGCGGGGCGG - Intergenic
1073237808 10:102033502-102033524 ATGGCGTGAACCCTGGGGGGCGG - Intronic
1073258891 10:102173836-102173858 ATGGCGTGAACCCGAGGAGGTGG - Intergenic
1073435640 10:103514173-103514195 ATTGCTTGAACCCCAGGAGGCGG - Intronic
1073641304 10:105255100-105255122 ATGGCGTGAACCCGGGGGGGCGG + Intronic
1073663072 10:105498992-105499014 ATGGTGTGAAACCCGGGAGGCGG + Intergenic
1074087775 10:110221796-110221818 GTGGGGGGAACGCCAGGGGGAGG - Intronic
1074124299 10:110516093-110516115 ATGGCGTGAACCCCAGGGGGCGG - Intergenic
1074432888 10:113408716-113408738 ATGCTATGAACCCCAGGGTGAGG - Intergenic
1074487972 10:113906895-113906917 ATGGCGTGAACCCGGGAGGGAGG + Intronic
1074595900 10:114866743-114866765 ATGGTGTGAGCCCCAGGGAAAGG + Intronic
1074696474 10:116054109-116054131 ATGTTGTGAACCACAGAGAGAGG + Intergenic
1074740366 10:116480319-116480341 ATGGCGTGAACCCCGGGAGGCGG + Intergenic
1075386987 10:122062117-122062139 ATGGAGTGAACCCAGGGAGGCGG - Intronic
1075755162 10:124805245-124805267 ATGGCGTGAACCCCGGGAGGCGG + Intronic
1075770091 10:124927039-124927061 ATGGCGTGAACCCCAGGGGGCGG - Intergenic
1075791030 10:125084566-125084588 GTGGTGTGAACCTCAGGGCTGGG - Intronic
1075937772 10:126358090-126358112 ATGGCATGAACCCCGGGGGGTGG + Intronic
1076147672 10:128137398-128137420 ATGGCGTGAACCCCAGGGGGCGG - Intergenic
1076452514 10:130566552-130566574 ATGGCGTGAACCCCCGGGGGCGG + Intergenic
1076463472 10:130662173-130662195 ATTGCTTGAACCCCAGGTGGTGG - Intergenic
1077004693 11:347919-347941 ATGGCGTGAACCCCGGGAGATGG + Intergenic
1077005259 11:352029-352051 ATGGCATGAACCCCGGGGGGCGG + Intergenic
1077084901 11:744754-744776 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
1077439432 11:2561114-2561136 ATGGTGTGAACCCCAGGGGGTGG + Intronic
1077587752 11:3466885-3466907 ATGGTGTGAACCCCGAGAGGTGG + Intergenic
1077904117 11:6515869-6515891 ATGGCTTGAGCCCAAGGGGGTGG - Intronic
1078286205 11:9958442-9958464 ATGGCGTGAACCCCAGGGGGCGG - Intronic
1078783181 11:14459700-14459722 ATCACCTGAACCCCAGGGGGTGG - Intronic
1078983850 11:16569781-16569803 ATGGTGTGAACCCGGGAGGTGGG + Intronic
1079172285 11:18107858-18107880 ATGACGGGAACCCCAAGGGGCGG - Intergenic
1079294713 11:19222594-19222616 AGGGTGTAAACACCAGGAGGTGG + Intergenic
1079474324 11:20812920-20812942 ATGGCGTGAACCCCAGGGGGCGG + Intronic
1079616926 11:22506712-22506734 ATGGCGTGAACCCAGGGAGGCGG - Intergenic
1079680418 11:23289851-23289873 ATTGTTTGAAACCCAGGAGGCGG - Intergenic
1079820079 11:25115446-25115468 ATGGCGTGAACCCTGGGGGGCGG + Intergenic
1080181736 11:29433814-29433836 ATGGCGTGAACCCCGCGGGGCGG + Intergenic
1080396556 11:31895276-31895298 ATGGCGTGAACCCCAGGGGGCGG - Intronic
1080438166 11:32265301-32265323 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
1080472787 11:32562317-32562339 ATGGCGTAAAACCCAGGAGGCGG - Intergenic
1080524068 11:33095733-33095755 ATGGCGTGAACCCCAGGGGGCGG + Intronic
1080621921 11:33993871-33993893 ATGGCGTGAACCCCAGGGGGCGG - Intergenic
1080942871 11:36939161-36939183 ATGGCGTGAACCCCGGGGAGTGG - Intergenic
1081171610 11:39876367-39876389 ACGGCGTGAACCCCGGGGGGCGG + Intergenic
1081344623 11:41968078-41968100 ATGGCGTGAACCCCGGGAGGCGG + Intergenic
1081472027 11:43383436-43383458 ATCGCTTGAACCCCAGGAGGCGG - Intronic
1081696996 11:45119542-45119564 ATTGCGTGAACCCCAGTGGGTGG + Intronic
1081907107 11:46677195-46677217 CTGGTCTGTACCCCAGGGAGCGG - Exonic
1082033646 11:47626130-47626152 ATCGCTTGAACCCCAGGAGGCGG - Intronic
1082171171 11:49007484-49007506 ATGGTGTGAACCCAGGGTTGGGG - Intergenic
1082843801 11:57711437-57711459 ATCGTTTGAACCCCGGGAGGCGG - Intronic
1083078555 11:60067297-60067319 ATGCTGTGAACCCAGGAGGGCGG - Intronic
1083315708 11:61813877-61813899 ATGGCGTGAACCCCGGGGGAGGG + Intronic
1083402771 11:62435495-62435517 ATGGCGGGAACCCCGGGGGGCGG - Intronic
1083554728 11:63616895-63616917 ATGGCGTGAACCCCGGGGGGCGG + Intergenic
1083566916 11:63726773-63726795 ATCGCTTGAACCCCTGGGGGTGG + Intronic
1083790098 11:64979196-64979218 ATGGCGTGAACCCCAGGGGATGG - Intergenic
1083854451 11:65385879-65385901 ATGGTGTGAACCCCAGGGGGCGG - Intergenic
1083909966 11:65701389-65701411 ATGGCGTGAACCCCGGGGGACGG - Intergenic
1083957553 11:65993497-65993519 ATGGCGTGAACCCCGGGGGGCGG + Intergenic
1083972226 11:66086222-66086244 ATGGCGTGAACCCCGGGGGGCGG - Intronic
1084235327 11:67784545-67784567 ATGGTATGAACCCGAGAGGCGGG + Intergenic
1084243456 11:67838553-67838575 ATGGCGTGAACCCCAACAGGTGG + Intergenic
1084450033 11:69231205-69231227 AGGGTGTGAAAACCAGGAGGCGG + Intergenic
1084510134 11:69598179-69598201 ATGGTGTGAGCACCTGGGGTAGG + Intergenic
1084605614 11:70170038-70170060 GTGGGATGATCCCCAGGGGGAGG + Intronic
1084619858 11:70262408-70262430 ATGGCGTGAACCCCGGGGGGTGG - Intergenic
1084669908 11:70599519-70599541 ATGGCGTGAACCCCAGGGGGCGG + Intronic
1084829229 11:71756020-71756042 ATGGCATGAACCCCAGGAGGTGG - Intergenic
1085091956 11:73724570-73724592 ATGGCGTGAACCCCGGGAGGCGG - Intronic
1085100365 11:73795590-73795612 ATGGTGTGAACCCGGGAGGCGGG - Intronic
1085639473 11:78183719-78183741 ATGGCGTGAACCCTGGGAGGCGG - Intronic
1085909471 11:80804449-80804471 ATGGTGTGAACCCCGGGGGGTGG - Intergenic
1086112580 11:83216408-83216430 ATGGCGTGAACCCCAGGGGGTGG - Intronic
1086371512 11:86159969-86159991 AGGGTGTGAAAACCAGGAGGTGG - Intergenic
1086633344 11:89051168-89051190 ATGGCGTGAACCCGAGAGGCAGG + Intronic
1086819025 11:91412076-91412098 ATGGCGTGAACCCCAGGGGGCGG - Intergenic
1086960370 11:92974686-92974708 ATGGCATGAACCCCAGGGGGCGG - Intronic
1086997071 11:93369843-93369865 ATGGCGTGAACCCCAGGGGGCGG + Intronic
1087346498 11:96978017-96978039 ATGGCGTGAACCCCGGGAGGCGG + Intergenic
1087455010 11:98373505-98373527 ATGGCGTGACCCCCGGGAGGCGG + Intergenic
1087681935 11:101228232-101228254 ATGGTGAGAACCCTGGGGGGTGG + Intergenic
1087779488 11:102287555-102287577 ATGGTGTGAACCCGGGAGGCGGG - Intergenic
1087814942 11:102648154-102648176 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
1088213846 11:107485671-107485693 ATAGCGTGAACCCCAGGGGGCGG + Intergenic
1088261147 11:107945095-107945117 ATCGCTTGAACCCCAGGGGGCGG + Intronic
1088276343 11:108090402-108090424 ATGGCATGAACCCTGGGGGGCGG + Intronic
1088483698 11:110320842-110320864 ATCGCTTGAACCCCAGGGGGCGG - Intergenic
1088789990 11:113216233-113216255 ATGGCGGGAACCCCAGGGGGCGG - Intronic
1089432098 11:118433645-118433667 ATGGCGTGAACCCCGGGGGGTGG - Exonic
1089468740 11:118704062-118704084 AGGGTGTGAACACCAGGGAGTGG + Intergenic
1089577733 11:119458692-119458714 ATGGCGTGAACCCCGTGGGGTGG + Intergenic
1089982509 11:122784024-122784046 ATCGCTTGAACCCCAGGGGCAGG - Intronic
1090214722 11:124951714-124951736 AAGGTGTGAACACCAAGAGGTGG + Intergenic
1090301116 11:125640453-125640475 ATGGCGTGAACCCCGGGGGGCGG + Intronic
1090327388 11:125900922-125900944 ATGGCGTGAACCCCAGGGGGCGG + Intronic
1091254512 11:134172148-134172170 ATGGTGGGAGCACCACGGGGAGG - Intronic
1091412042 12:248315-248337 ATGGAGTGAACCCCGGGGGGCGG + Intronic
1091493269 12:950483-950505 ATGGCGTGAACCCCGGGGGACGG + Intronic
1091495778 12:971832-971854 ATGGCGTGAACCCCGGGGGGCGG - Intronic
1091513651 12:1155560-1155582 ATGGTGTGAACCCAGGGAGGTGG - Intronic
1091876367 12:3936820-3936842 ATGGCGTGAACCCTGGGAGGCGG + Intergenic
1091983574 12:4887088-4887110 ATGGCGTGAACCCCGGGGGGCGG + Intergenic
1092340467 12:7671746-7671768 ATGGCGTGAACCCCGGGAGGCGG - Intergenic
1092414003 12:8275655-8275677 ATGGCGTGAACCCCAGGAGGTGG + Intergenic
1092795521 12:12107294-12107316 ATGGCGTGAACCCCGGGGGGTGG + Intronic
1092805579 12:12219289-12219311 ATCGTTTGAACCCCGGGTGGTGG - Intronic
1093007372 12:14064850-14064872 ATGGCGGGAACCCCGTGGGGCGG + Intergenic
1093075385 12:14752795-14752817 ATGGCATGAACCCCGGGGGGCGG + Intergenic
1093127553 12:15348699-15348721 ATGACGTGAACCCCGGGGGGCGG + Intronic
1093367751 12:18324132-18324154 ATGACGTGAACCCCGGGGGGCGG + Intronic
1093587633 12:20860039-20860061 ATGGTGTGAACCCGGGAGGCGGG - Intronic
1093738633 12:22655050-22655072 ATCGCTTGAACCCAAGGGGGAGG - Intronic
1094010198 12:25799744-25799766 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
1094737963 12:33256698-33256720 ATGGCGTGAATCCCAGAGGGTGG - Intergenic
1094746153 12:33346360-33346382 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
1095172976 12:39056885-39056907 ATCGCTTGAACCCCAGGAGGTGG - Intergenic
1095241603 12:39866563-39866585 ATGGCGTGAACCCCGGGGGGCGG - Intronic
1095463566 12:42467200-42467222 ATTGCTTGAACCCCAGGAGGCGG - Intronic
1095593500 12:43933284-43933306 ATGGCGTGAACCCTGGGGGGCGG - Intronic
1095648430 12:44577561-44577583 ATGGTGTGAACCCGGGAGGCGGG - Intronic
1095654996 12:44658788-44658810 ATGTTGTGAACCCTGGGGGCTGG + Intronic
1095675879 12:44917540-44917562 AGGGTATGAACACCAAGGGGTGG - Intronic
1095784805 12:46098303-46098325 ATGGAGTGAAACCCAGGAGGTGG + Intergenic
1095966814 12:47873445-47873467 ATGGCGTGAACCCCAGGGGGCGG - Intronic
1096123814 12:49105555-49105577 AAGGTGGGAACCCCTGAGGGAGG - Intronic
1096223230 12:49845602-49845624 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
1096387598 12:51205123-51205145 ATGGCGTGAACCCGGGGGGGTGG - Intronic
1096629286 12:52915285-52915307 ATGGCGTGAACCCCAGGGGACGG + Intronic
1096824446 12:54263955-54263977 ATGGTGTGAACCCAGGAGGCGGG + Intronic
1096935213 12:55266840-55266862 ATGGCGTGAACCCCAGGGGGCGG - Intergenic
1097024922 12:56047704-56047726 ATGGTGTGAACCCGGGAGGCGGG + Intergenic
1097114042 12:56683871-56683893 ATGGCGTGAACCCCAGGGGGCGG + Intronic
1097227484 12:57486797-57486819 ATGGCGTGAACCCCGGGGGACGG + Intronic
1097311863 12:58127561-58127583 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
1097490831 12:60269236-60269258 ATGGCGTGAACCCCGGGAGGCGG - Intergenic
1097987067 12:65794773-65794795 ATGGCGTGAACCCTGGGGGGCGG + Intergenic
1098122453 12:67256373-67256395 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
1098619996 12:72584015-72584037 ATGGCGTGAACCCCAGGGGGCGG - Intronic
1098804671 12:75008548-75008570 ATGGTGTGAACCCCGGGAGGTGG - Intergenic
1098812592 12:75114948-75114970 ATGGCGTGAACCCCGGGGGGCGG - Intronic
1098814861 12:75146038-75146060 ATGGTGTGAACCCCGGGAGGTGG - Intronic
1098879481 12:75902410-75902432 ATGGCGTGAACCCCGGAGGTGGG + Intergenic
1099006858 12:77244190-77244212 ATGGCGTGAACCCCGGGGGGCGG + Intergenic
1099052841 12:77802746-77802768 ATGGTGTGAACCCAGGAGGCGGG - Intergenic
1099574505 12:84362592-84362614 ATGGGGTGAATCCAAGGGGGTGG + Intergenic
1099862333 12:88235463-88235485 ATGGTGTCAGCCCCAGGTGAGGG - Intergenic
1099968906 12:89480684-89480706 ATGGCGTGAACCCCAGGGGGCGG - Intronic
1099999840 12:89819959-89819981 ATGGCGTAAACCCCGGGGGGCGG + Intergenic
1100173090 12:91999421-91999443 ATAGCGTGAACCCCAGGGGGCGG + Intronic
1100239792 12:92699896-92699918 ATGGCCTGAACCCCAGGGGATGG - Intergenic
1100251898 12:92834964-92834986 ATGGCGTGAACCCCGAGAGGCGG - Intronic
1100592612 12:96043519-96043541 ATGGCGTGAACCCCGGGGGGCGG + Intronic
1101143835 12:101822325-101822347 ATGGCGTGAACCCCGGGGGGCGG + Intronic
1101509489 12:105379940-105379962 ATGGCGTGAACCCCAGGGGGCGG + Intronic
1101655081 12:106712895-106712917 ATTGTCTGATCCCCAGAGGGAGG - Intronic
1101934956 12:109049727-109049749 ATCGCTTGAACCCCAGGAGGTGG + Intronic
1101941240 12:109100757-109100779 ATGGTGTGAACACCAAGGGGAGG + Intronic
1102113327 12:110381707-110381729 ATGGTGTGAATCCGTGGGTGTGG - Intronic
1102354847 12:112224350-112224372 ATGGCGTGAACCCCGGGAGGTGG - Intronic
1102979294 12:117228865-117228887 ATGGCGTGAACCCCGGGAGGCGG - Intronic
1103289372 12:119831781-119831803 ATGGCGTGAACCCAGGGGGGCGG + Intronic
1103312771 12:120025134-120025156 ATGGTGTGAACCCCAGGGGGCGG - Intronic
1103376440 12:120459768-120459790 ATGGCGTGAACCCCAGGGGGCGG + Intronic
1103489071 12:121302802-121302824 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
1103709511 12:122901302-122901324 ATGGTGTGAACCCCAGGGGGCGG - Intergenic
1104263953 12:127213008-127213030 ATTGCTTGAACCCCAGGAGGTGG - Intergenic
1104852293 12:131882862-131882884 ATGGTGTGAACCCTGGAGGCGGG + Intergenic
1104995441 12:132651587-132651609 AGGGTGTGAACACCAGGAAGTGG - Intronic
1105325289 13:19365125-19365147 ATGGTGTGAACCCGGGAGGTGGG + Intergenic
1105494054 13:20914928-20914950 ATGGTGTGAACCCTGGGGGGCGG - Intergenic
1105549480 13:21379899-21379921 ATGGCGTGAACCCCGGGGGTTGG - Intronic
1105581142 13:21697891-21697913 ATGGCGTGAACCCGGGAGGGCGG - Intronic
1105758961 13:23495423-23495445 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
1105885411 13:24637503-24637525 ATGGCGTGAACCCCGGGGGGCGG + Intergenic
1105975239 13:25467635-25467657 ATGGCGTGAACCCCGGGGGGCGG - Intronic
1106184462 13:27396938-27396960 ATGGTGTGAACCCAGGAGGCAGG - Intergenic
1106265600 13:28106832-28106854 ATTGCTTGAACCCCAGGAGGCGG + Intergenic
1106705291 13:32273306-32273328 ATGGCGTGAACCCCAGGGGGCGG - Intronic
1107053171 13:36074401-36074423 ATGGCGTGAACCCTGGGGGGCGG + Intronic
1107356640 13:39574394-39574416 ATGGCGTGAACCCCAAGAGGCGG + Intronic
1107366510 13:39684333-39684355 ATGGCGTGAACCCCAGGGGGCGG - Intronic
1107563714 13:41581084-41581106 ATGGCGTGAACTCCAGGGGGCGG - Intronic
1107780447 13:43896632-43896654 ATGGCGTGAACCCCGGGAGGCGG - Intergenic
1107781725 13:43910678-43910700 ATGGCGTGAACCCCGAGGGGCGG - Intergenic
1107926077 13:45263312-45263334 ATGGTGTGAACCTTGGGAGGCGG - Intronic
1108114801 13:47115549-47115571 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
1108407407 13:50119234-50119256 ATGGCGTGAACCCCAGGGGGCGG - Intronic
1108831061 13:54478615-54478637 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
1109196777 13:59386528-59386550 ATTGCTTGAACCCCAGGAGGTGG + Intergenic
1109382165 13:61577043-61577065 ATGGCGTGAATCCTGGGGGGCGG + Intergenic
1109479137 13:62926108-62926130 ATGGCATGAACACCAGGGGACGG + Intergenic
1109597218 13:64571581-64571603 ATGGCGTGAACCCGGGGAGGCGG - Intergenic
1109822061 13:67669834-67669856 ATGGCGTGGACCCCCGGGGGCGG - Intergenic
1110043918 13:70804115-70804137 ATGGCGTGAACCCCGGGGTTCGG + Intergenic
1110349876 13:74494533-74494555 ATGGCATGAACCCTGGGGGGCGG + Intergenic
1110516984 13:76425343-76425365 ATGGCATGAACCCGGGGGGGCGG - Intergenic
1110709464 13:78633979-78634001 ATGGCGTAAACCCCGGGGGGCGG + Intronic
1110749898 13:79101085-79101107 ATGGCATGAACCCCCGGAGGCGG - Intergenic
1110976769 13:81847466-81847488 ATGGCGTGAACCCCCGGGGGCGG - Intergenic
1111140608 13:84113497-84113519 ATGGCGTGAACCCCAGGGGGCGG - Intergenic
1111580284 13:90213895-90213917 ATGGCGTGAACCCCGGGAGGCGG - Intergenic
1111734415 13:92119483-92119505 ATGGTGTGAACCCCGGGGGGCGG - Intronic
1111845801 13:93506970-93506992 ATGGTGTGAACCCGGGAGGGAGG + Intronic
1111884660 13:94004974-94004996 ATCGCTTAAACCCCAGGGGGAGG + Intronic
1112008410 13:95273900-95273922 ATCGCGTGAACCCCGGGGGGCGG - Intronic
1112091037 13:96084435-96084457 ATGGCGTGAACCCCCGGGGGCGG - Intergenic
1112274306 13:98002098-98002120 ATGGTGTGAACCCGGGGGGGCGG - Intronic
1112302841 13:98246179-98246201 ATGGCGTGAACCCCAGGGGGCGG - Intronic
1112549115 13:100403498-100403520 ATGGTGAGAACCACAGTGAGCGG + Intronic
1112685518 13:101821032-101821054 ATGGCGTGAATCCCGGGGGGCGG - Intronic
1112845311 13:103635647-103635669 ATGGCTTGAACCCCAGAGGCAGG + Intergenic
1113327901 13:109300353-109300375 ATGGCGTGAACCCGGGGAGGCGG + Intergenic
1113419605 13:110160354-110160376 ATGGCGTGAACCCCGGGAAGCGG + Intronic
1113549637 13:111182528-111182550 ATGGTGTCATGCCCAGGGGTGGG + Intronic
1113845733 13:113389760-113389782 ATGGCATGAACCCGGGGGGGCGG + Intergenic
1114072240 14:19121503-19121525 ATGGCGTGAACCCCGGGGAGCGG + Intergenic
1114090017 14:19278470-19278492 ATGGCGTGAACCCCGGGGAGCGG - Intergenic
1114294891 14:21320374-21320396 ACGGCGTGAACCCCAGGGGGCGG - Intronic
1114400450 14:22405414-22405436 TTGCTTTCAACCCCAGGGGGAGG - Intergenic
1114855174 14:26430432-26430454 ATGGCGTGAACCCTGGGGGGTGG - Intergenic
1115201484 14:30858788-30858810 ATGGCGTGAACCCCGGGGGGCGG + Intergenic
1115219028 14:31040987-31041009 ATGGTGTGAACCCAGGGAGGTGG + Intronic
1115271964 14:31562688-31562710 ATGGCGTGAACCCCGGGAGGCGG - Intronic
1115403405 14:32989556-32989578 ATGGCGTGAACCCCAGGGGGCGG + Intronic
1115424879 14:33246451-33246473 ATGGCGTGAACCCCGGGGGACGG + Intronic
1115608221 14:35026855-35026877 ATGGTGTGAACCCGGGAGGCGGG + Intronic
1115627052 14:35203776-35203798 ATGGCATGAACCCCAGGGGGCGG + Intronic
1115693711 14:35874127-35874149 ATGGCGTGAACCCCAGGAGGCGG + Intronic
1115806398 14:37056402-37056424 ATGGCGTGAACCCCGGGGGGCGG + Intronic
1115995834 14:39194645-39194667 ATGGCGTGAACCCCGGGGGGCGG + Intergenic
1116067335 14:40001114-40001136 ATGGCGTGAACCCCGGGGGGCGG + Intergenic
1116261904 14:42640748-42640770 ATGGCGTGAACCCGGGGAGGCGG - Intergenic
1116315717 14:43389370-43389392 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
1116388809 14:44366447-44366469 ATGGCGTGAACCCCAGGGGGCGG - Intergenic
1116636298 14:47400841-47400863 ATGGCGTGAACCCCGGGAGGCGG - Intronic
1116646897 14:47540097-47540119 ATGGCGTGAACCCCGGGGGGCGG - Intronic
1116824201 14:49656267-49656289 ATGGCGTGAACCCCGGGGGGCGG + Intronic
1117459757 14:55933734-55933756 AGGGTGTGAATCCCAGGAAGCGG - Intergenic
1117610902 14:57482354-57482376 CTGATGTGAACCTCAGGGAGGGG + Intronic
1117659047 14:57985310-57985332 ATCGCTTGAACCCCAGGAGGCGG + Intergenic
1117997100 14:61488065-61488087 ATAGTGTGAACCGCAGGGGGCGG + Intronic
1118174309 14:63422638-63422660 ATGGCGTGAACCCCGGAGGACGG + Intronic
1118561320 14:67086563-67086585 ATGGCGTGAACCCCAGGGGGCGG + Intronic
1119055679 14:71417383-71417405 ATGGCGTGAACCCCAGGGGGCGG + Intronic
1119232182 14:72989014-72989036 ATGGCTTGAACCCCTGGAGGTGG - Intronic
1119406283 14:74401632-74401654 AAGGTGTCAGCCCCAGGGAGGGG + Intergenic
1119412304 14:74440426-74440448 ATGGCGTGAACCCGGGGAGGTGG + Intergenic
1119467302 14:74868749-74868771 ATGGCGTGAACCCAGGGGGGCGG + Intronic
1119832528 14:77716228-77716250 ATGGCGTGAACCCCAGGGGGTGG + Intronic
1119968032 14:78938929-78938951 ATGGCGTGAACCCCAGGGGGCGG - Intronic
1119994195 14:79234468-79234490 ATGGCTTGAACCTCAGGAGGTGG - Intronic
1120145406 14:80973317-80973339 ATGGCGTGAACCCCGGGGGGCGG + Intronic
1120195714 14:81480273-81480295 ATGGCGTGAACCCTGGGGGGCGG - Intronic
1120209293 14:81619153-81619175 ATGGTGACAAGCCCAGGTGGGGG - Intergenic
1120741801 14:88117103-88117125 ATGGCGTGAACCCCGGGGGGCGG - Intergenic
1120919142 14:89738889-89738911 ATGGCGTGAACCCTGGGGGACGG - Intergenic
1121531364 14:94656606-94656628 ATGGCGTGAACCCCATGGGGTGG + Intergenic
1121566604 14:94914713-94914735 TTGGGGTGAACCCCAGGGTGGGG - Intergenic
1121915361 14:97832995-97833017 GTGGTGTGAGCCCCAGAGGGGGG + Intergenic
1121982243 14:98465065-98465087 ATGGCGTGAACCCCAGGGGGCGG - Intergenic
1122022043 14:98846196-98846218 AGGGTGTGAATGCCATGGGGTGG - Intergenic
1122219339 14:100226190-100226212 ATCGCTTGAACCCCAGGAGGCGG + Intergenic
1122590306 14:102844981-102845003 ATGGTGTGAACCCAGGAGGCAGG - Intronic
1122718799 14:103710653-103710675 ATGGTGTGAACCCCGGGAGGCGG + Intronic
1122936663 14:104961426-104961448 ATGGCGTGAACCCCGGGGGGCGG + Intronic
1123446443 15:20334280-20334302 ATGGTGTGAACCTGAGAGGTGGG - Intergenic
1123830289 15:24129036-24129058 ATGGTGTGAACCCCAGGGGGCGG + Intergenic
1123837116 15:24206295-24206317 ATGGCATGAACCCCAGGGGGTGG + Intergenic
1123892358 15:24794320-24794342 ATGGCGTGAACCCGGGAGGGCGG + Intergenic
1124145350 15:27120021-27120043 AATGTGTGAACACCAGGAGGTGG + Intronic
1124247697 15:28085019-28085041 AGGGTGTGAACACCAGGAGGTGG + Intronic
1124507841 15:30294038-30294060 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
1124735714 15:32244620-32244642 ATGGCGTGAACCCCAGGGGGCGG - Intergenic
1124967594 15:34448162-34448184 ATGGCGTGAACCCCGGGGGGCGG - Intergenic
1125091369 15:35796484-35796506 AAGGCGTGAACACCGGGGGGCGG + Intergenic
1125186422 15:36936279-36936301 AAGGCGTGAACCCCGGGAGGCGG - Intronic
1125259702 15:37809041-37809063 ATGGCGTGAACCCCAGTGGGCGG + Intergenic
1125633064 15:41163656-41163678 ATGGCGTGAACCCTGGGGAGCGG + Intergenic
1126026929 15:44455934-44455956 ATGGCGTGAACCCCAGGGGGCGG - Intronic
1126027298 15:44459439-44459461 ATGGCTTGAACCCTAGGGGGCGG + Intronic
1126193547 15:45904778-45904800 GTGGCGTGAACCCCAGGGGGCGG - Intergenic
1126197147 15:45944785-45944807 ATGGCGTAAACCCCAGGGGGCGG + Intergenic
1126205912 15:46044486-46044508 AGGGTATGTACTCCAGGGGGTGG + Intergenic
1126259414 15:46670906-46670928 ATGGCGTGAACCCCGGGGGGCGG - Intergenic
1126382872 15:48066618-48066640 ATGTGGTGATCCCCAGGGGGTGG + Intergenic
1126619324 15:50621071-50621093 ATGCCGTGAACCCCTGGGGGCGG + Intronic
1126620742 15:50637038-50637060 ATGGTGTGAACCCAGGAGGCAGG + Intronic
1126801129 15:52297238-52297260 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
1127044021 15:55007237-55007259 ATGGCGTGAACCCCGCGGGGCGG + Intergenic
1127126012 15:55812757-55812779 ATGGCGTGAACCCCCGGGGGCGG - Intergenic
1127450302 15:59109898-59109920 ATGGCGTGAACCCTGGGGGCCGG + Intronic
1127486267 15:59420803-59420825 ATGGCGTGAACCCCAGGGGGCGG - Intronic
1127778050 15:62284256-62284278 ATTGTTTGAATCCCAGGAGGCGG - Intergenic
1127821252 15:62658212-62658234 AAGGTGTGAACGCCAGTGTGGGG + Intronic
1128187756 15:65657555-65657577 ATGGCGTGAACCCCGGGGGGCGG + Intronic
1128295292 15:66513655-66513677 ATGGTGTGAACCCGGGAGGCGGG - Intronic
1128836425 15:70812580-70812602 ATGGCGTGAACCCCGGGAGGCGG + Intergenic
1129022542 15:72535035-72535057 ATGGCATGAACCCCAGGGGGCGG - Intronic
1129058564 15:72840332-72840354 AGGGTGTGAGTGCCAGGGGGTGG + Intergenic
1129146511 15:73652843-73652865 ATGGCGTGAACCCCGGGGGGCGG + Intergenic
1129289018 15:74549158-74549180 ATGGCGTGAACCCCGGGGGGTGG - Intronic
1129351835 15:74959726-74959748 AGGGTGGGAACCCCAGGGTGGGG + Intronic
1129370870 15:75094032-75094054 ATGGCGTAAACCTCGGGGGGCGG + Intronic
1129418882 15:75406599-75406621 ATGGCGTGAACCCCAGGAGGCGG + Intronic
1129533644 15:76291662-76291684 ATGGCGTGAACCCCGGGGGGCGG + Intronic
1129558474 15:76539629-76539651 ATGGCATGAACCCCAAGGGGCGG - Intronic
1129776392 15:78239492-78239514 ATGGTGTGAACCTGAGGAGGTGG - Intronic
1130080243 15:80726596-80726618 ATGGTGTGAACGCGGGGGGGCGG - Intronic
1130191188 15:81737864-81737886 ATGGCGTGAACCCCAGGGGGCGG - Intergenic
1130352722 15:83106400-83106422 ATGGCGTGAACCCCGGGAGGTGG + Intergenic
1130448509 15:84027622-84027644 ATGGTGTGAACCCGGGAGGCAGG + Intronic
1130900908 15:88206257-88206279 ATAGCGCGAACCCCGGGGGGCGG + Intronic
1131219816 15:90573244-90573266 AAGGCGTGAACACCAGGAGGTGG + Intronic
1131393789 15:92070555-92070577 ATTGCTTGAACCCCAGGAGGTGG + Intronic
1131415950 15:92257894-92257916 ATGGTGTGAACCCAGGGAGGCGG + Intergenic
1131427470 15:92358181-92358203 ATGGTGTGAACCCGGGAGGCGGG + Intergenic
1131890196 15:96964335-96964357 ATGGCTTGAACCCCGGGGGGCGG + Intergenic
1131986428 15:98046487-98046509 ATGGTATCAAACCCAGGGGAGGG + Intergenic
1131996488 15:98137729-98137751 ATGGTGTGAACCCAGGAGGTGGG + Intergenic
1132036187 15:98486922-98486944 ATGGGGTGAATCACATGGGGTGG + Intronic
1132164577 15:99573200-99573222 ATGGCGTGAACCCTGGGAGGCGG + Intronic
1132491976 16:236818-236840 ATGGCGGAAACCCCGGGGGGCGG + Intronic
1132739210 16:1402904-1402926 ATGGTGTGAACCCAGGAGGCAGG + Intronic
1132746936 16:1440362-1440384 ATGGTGTGAACCCGGGAGGTGGG + Intronic
1132812524 16:1808384-1808406 ATGGTGTGAACCCAGGAGGCGGG - Exonic
1132940668 16:2506437-2506459 ATGGTGTGAACCCAGGAGGTGGG - Intronic
1132943926 16:2521868-2521890 ATGGCGTGAACCCTGGGGGGCGG - Intronic
1133068624 16:3229777-3229799 ATGGCATGAACCGCAGGGGGCGG + Intronic
1133075244 16:3275207-3275229 GTGGTGTGACCTCCAGGGTGAGG - Intronic
1133606272 16:7391207-7391229 TTGGTGTTAATCCCATGGGGTGG + Intronic
1133965217 16:10526226-10526248 ATGGCGTGAACCCGGGGGGGCGG + Intergenic
1134056004 16:11170288-11170310 GTGGTGTGAACCCCTGGGGGAGG + Intronic
1134394551 16:13851226-13851248 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
1134483925 16:14641773-14641795 ATCGCTTGAACCCCAGGAGGTGG + Intronic
1134636223 16:15794027-15794049 ATGGTGTGAACCTGGGGGGCGGG - Intronic
1134830225 16:17316906-17316928 ATGGCGTGAACCCCAGGTGACGG - Intronic
1135014827 16:18916427-18916449 ATGGCGTGAACCCCGGGGGGTGG + Intronic
1135028528 16:19017754-19017776 CTGGCGTGAACCCCGGGGGGCGG - Intronic
1135163921 16:20121890-20121912 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
1135462665 16:22658768-22658790 AAGGCGTGAACACCGGGGGGCGG + Intergenic
1135515240 16:23126539-23126561 ATGGTGTGAACCCGGGAGGTGGG + Intronic
1135837572 16:25841089-25841111 ATGGCATGAACCCCGGGGGGCGG - Intronic
1136047593 16:27626876-27626898 ATCGCTTGAACCCCAGGAGGTGG + Intronic
1136475030 16:30507371-30507393 ATGGCATGAACCCCAGGGGGCGG + Intronic
1136538995 16:30918069-30918091 ATTGCGTGAACCCCGGTGGGTGG - Intergenic
1136589778 16:31210935-31210957 ATGGCGTGAACCCAGGAGGGCGG + Intergenic
1136623310 16:31444322-31444344 AGGGTGTGAACACCAGGAGTAGG - Intergenic
1136735053 16:32459596-32459618 ATGGCGTGAACCCCGGGGGGCGG - Intergenic
1137011664 16:35327775-35327797 ATGGCGTGAACCCCAGGGGGCGG - Intergenic
1137389499 16:48069644-48069666 ATGGCGTGAACCCCAGGGGGCGG - Intergenic
1137475579 16:48805552-48805574 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
1137773017 16:51033146-51033168 ATCGCTTGAACCCCAGGAGGTGG - Intergenic
1137809822 16:51342488-51342510 ATGGCGTGAACCCCAGGGGGCGG - Intergenic
1137840459 16:51636390-51636412 ATGGCGTGAACCCCAGGGGGCGG - Intergenic
1138130124 16:54472287-54472309 ATGGTGTGATCCCCAGGCCTTGG + Intergenic
1138425000 16:56925733-56925755 ATTGCTTGAACCCCAGGAGGCGG - Intergenic
1138562797 16:57812126-57812148 ATGGCGTGAACCCTAGGGGATGG - Intronic
1138614412 16:58153147-58153169 ATGGCGTGAACCCCGGGAGGTGG + Intergenic
1138897201 16:61221585-61221607 ATGGCGTGAACCCCGGGGGGCGG - Intergenic
1139695600 16:68672104-68672126 ATGGCGTGAACCCCAGGGGGCGG + Intronic
1140076708 16:71707038-71707060 ATGGCGTGAACCCCAGGGGGCGG - Intronic
1140077991 16:71720053-71720075 ATGGCATGAACCCCGGGGGGCGG - Intronic
1140215135 16:73000988-73001010 AGGGTGTGAATGCCACGGGGTGG - Intronic
1140356490 16:74311307-74311329 ATGGCGTGAACCCCAGGGGGTGG - Intergenic
1140380389 16:74481869-74481891 ATGGTGTAAAACCCGGGAGGCGG - Intronic
1140403740 16:74693687-74693709 ATGGCGTGAACCCCGCGGGGCGG - Intronic
1141120701 16:81353203-81353225 ATGGCGTGAACCCCAGGGGGCGG + Intronic
1141169489 16:81682115-81682137 ATCATTTGAACCCCGGGGGGCGG + Intronic
1141252040 16:82367960-82367982 ATGGTGTGAACCCCGGGGGGCGG + Intergenic
1141267166 16:82507809-82507831 AAGGTGTGCACACCAGGGGGTGG - Intergenic
1141290109 16:82710444-82710466 ATGGCGTGAACCCAGGAGGGCGG + Intronic
1141454564 16:84131763-84131785 ATGGCGTGAACCCCAGGGGGCGG - Intronic
1141465355 16:84202260-84202282 ATGGCGTAAACCCCAGGGGGCGG - Intergenic
1141579583 16:84988082-84988104 ATGGCATGAACCCCTGGGGGCGG + Intronic
1141792408 16:86245608-86245630 AGGGTGTGCACACCAGGGTGTGG + Intergenic
1142001834 16:87668738-87668760 ATGGTGTGAGCACCAGGGCTGGG - Intronic
1142082717 16:88158423-88158445 GTGCTGTGGACCCCATGGGGAGG + Intergenic
1142163915 16:88574913-88574935 ATGGCGTGAACCCAGGGGGCGGG - Intronic
1142209679 16:88803127-88803149 ATGGCGTGAACCCCGTGGGGCGG - Intergenic
1203018026 16_KI270728v1_random:369997-370019 ATGGCGTGAACCCCGGGGGGCGG + Intergenic
1203036361 16_KI270728v1_random:643155-643177 ATGGCGTGAACCCCGGGGGGCGG + Intergenic
1142594925 17:1025033-1025055 ATGGCGTGAACCCCAGGGGGCGG + Intronic
1142663995 17:1451104-1451126 ATGGCATGAACCCCACGGGGCGG + Intronic
1143298942 17:5894997-5895019 ATGGCGTGAACCCCAGGGGGTGG - Intronic
1143336234 17:6173622-6173644 ATGGTGAGAGCCCCGTGGGGTGG - Intergenic
1143346385 17:6252397-6252419 ATGGTGTGAACCCCGGCGGGTGG + Intergenic
1143360244 17:6363408-6363430 ATGGCGTGAACCCCGGGAGGTGG + Intergenic
1143459146 17:7089335-7089357 ATGGCGTGAACCCCGGGGGGCGG + Intergenic
1143465848 17:7135776-7135798 ATGGTGTGGTCGCCAGGGGGAGG + Intergenic
1143726599 17:8851408-8851430 ATGGCGTGAACCCCGGGAGGCGG + Intronic
1143733001 17:8891680-8891702 ATGGTGTGAACCCGGGAGGCGGG - Intronic
1143762163 17:9112737-9112759 ATGGTGTGAACGCTGCGGGGTGG + Intronic
1143808377 17:9449472-9449494 ATGGCGTGAACCCCGGGGGACGG + Intronic
1144041706 17:11417476-11417498 ATTGTCAGAACCCCAGGGTGAGG - Intronic
1144144111 17:12380798-12380820 ATGGCGTGAACCCCGGGGGGCGG - Intergenic
1144234889 17:13250413-13250435 ATGGCGTGAACCCCGGGGGGCGG + Intergenic
1144323664 17:14156313-14156335 ATGGTGTGAACCCTCCCGGGAGG - Intronic
1144477648 17:15602711-15602733 ATGGCGTGAACCCCAGGGGGCGG - Intronic
1144487165 17:15676519-15676541 ATGGCGTGAACCCCAGGAGGTGG - Intronic
1144612392 17:16733415-16733437 ATGGCGTGAACCCTGGGTGGCGG + Intronic
1144774779 17:17779859-17779881 ATGGCGTGAACCCCGGGGGGCGG - Intronic
1144900337 17:18581873-18581895 ATGGCGTGAACCCTGGGTGGCGG - Intergenic
1144903661 17:18622130-18622152 ATGGCATGAACCCCAGGGGGTGG + Intergenic
1144913869 17:18705799-18705821 ATGGCGTGAACCCCAGGAGGTGG + Intronic
1144927402 17:18823855-18823877 ATGGCATGAACCCCAGGGGGTGG - Intergenic
1145128915 17:20324599-20324621 ATGGCATGAACCCCAGGGGGTGG - Intergenic
1145132109 17:20363807-20363829 ATGGCATGAACCCTAGGTGGCGG + Intergenic
1145180337 17:20744263-20744285 ATCGCTTGAACCCCGGGGGGCGG - Intergenic
1145195754 17:20893012-20893034 ATGGCATGAACCCCAGGGGGTGG + Intronic
1145735624 17:27229047-27229069 ATGGTGTGAACCCCGGGGGGCGG + Intergenic
1145949043 17:28801365-28801387 ATGGTGTGAACCCCGGGGGGCGG + Intronic
1145992606 17:29088138-29088160 ATGGCGTGAACCCCGGGGGGCGG - Intronic
1146101455 17:29986731-29986753 ATGGCGTGAACCCCAGGGGGCGG - Intronic
1146228550 17:31088995-31089017 ATGGTGTGAACCCAGGAGGCGGG - Intergenic
1146237799 17:31184561-31184583 ATGGCGTGAACCCCAGGGGGCGG + Intronic
1146261617 17:31425832-31425854 ATGGTGTGTGCCCCAGGGTGGGG + Intronic
1146294561 17:31639557-31639579 ATGCTCTGAACCCCATGGGGGGG - Intergenic
1146352790 17:32109926-32109948 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
1146409924 17:32573936-32573958 ATGGCGTGAACCCTGGGGGGCGG - Intronic
1146805866 17:35864687-35864709 ATGGTGTGAGCCCAAGGGAAGGG + Intronic
1147032961 17:37655881-37655903 ATGGCGTGAACCCAAGGAGGCGG + Intergenic
1147439909 17:40441755-40441777 ATCGCTTGAACCCCAGGAGGAGG - Intergenic
1147452234 17:40512828-40512850 ATGGCGTGAAACCCGGGAGGCGG - Intergenic
1147659213 17:42108225-42108247 GTGGTGTGAGCTCCAGAGGGAGG + Intronic
1147737817 17:42652058-42652080 ATGGCGTGAACCCCGGGGGGCGG - Intergenic
1147750913 17:42732680-42732702 ATGGCGTGAACCCCAGGGGGCGG + Intronic
1147999403 17:44379030-44379052 ATGGCGTGAACCCCGGGGGGCGG - Intronic
1148037985 17:44682768-44682790 ATGGCGTGAACCCGGGGAGGCGG + Intronic
1148496855 17:48058230-48058252 AGTGTGTGAGCCCCAGGGGAGGG + Intronic
1148509821 17:48158872-48158894 ATGGCGTGAACCCCAGGGGGCGG + Intronic
1148769550 17:50059036-50059058 ATGGTTAGAAACCCAGGGGTGGG + Intronic
1149679344 17:58494232-58494254 ATGGCGTGAACCCGGGAGGGCGG + Intronic
1149767798 17:59294471-59294493 ATGGCGTGAACCCCGGGGGGCGG + Intergenic
1149899680 17:60462862-60462884 ATGATGTGAACCCTGGGGGGCGG + Intronic
1149904593 17:60513907-60513929 ATGGTGTTTACTCCAGGGGTAGG - Intronic
1150279811 17:63923061-63923083 ATGGCATGAACCCAGGGGGGCGG - Intergenic
1150376141 17:64683369-64683391 ATCGCTTGAACCCCGGGGGGCGG - Intergenic
1150428134 17:65093671-65093693 ATGGCTTGAACCCCGGGGGGCGG - Intergenic
1150681921 17:67291444-67291466 ATGGCGTGAACCCCAGGGGGCGG - Intergenic
1150689606 17:67353391-67353413 ATCGCTTGAACCCCAGGAGGCGG - Intronic
1150917260 17:69449697-69449719 ATGGCGTGAACCCCAGGGGGCGG - Intronic
1150970672 17:70023944-70023966 ATGGCGTGAACCCGGGGGGGCGG - Intergenic
1151211987 17:72551314-72551336 ATGGCGTGAATCCCGGGGGGCGG - Intergenic
1151217853 17:72590038-72590060 ATGGCGTGAATCCCGCGGGGCGG + Intergenic
1151419109 17:73985734-73985756 ATGGAGTGAACCCCATGGGAGGG - Intergenic
1151523210 17:74645901-74645923 ATGGTGTGAACCCCAGGGGGCGG + Intergenic
1151531513 17:74708827-74708849 ATGACGTGAACCCGGGGGGGCGG + Intronic
1151746834 17:76016056-76016078 ATTGCTTGAACCCCAGGAGGTGG + Intronic
1151794291 17:76332975-76332997 ATGGCGTGAACCTCGGGGGGCGG - Intronic
1151897710 17:76991542-76991564 ATGGCGTGAACCCCAGGGGGCGG - Intergenic
1152035775 17:77871668-77871690 ATTGCTTGAACCCCAGGAGGAGG + Intergenic
1152329554 17:79664430-79664452 ATGGCGTGAACCCCGGGGGGCGG - Intergenic
1152914819 17:83028436-83028458 ATGGCGTGAACCCCAGGGGGCGG + Intronic
1152929534 17:83102782-83102804 ATGGTGTGAACCCAGGAGGCGGG + Intergenic
1153296006 18:3547213-3547235 ATGGCTTGAACCCCCGGGGGCGG + Intronic
1153671001 18:7411965-7411987 ATCGCTTGAACCCCAGGAGGAGG - Intergenic
1154031651 18:10758529-10758551 ATGGTGTGAACCCAGGAGGTGGG - Intronic
1154127980 18:11710959-11710981 ATGGTGTGAACCCGGGAGGTGGG - Intronic
1154251234 18:12746844-12746866 ATGGTGTGAACCCAGGAGGCGGG + Intergenic
1154481685 18:14833332-14833354 ATGGTGTGAACCCGGGAGGTGGG - Intronic
1154971154 18:21411290-21411312 ATGGTGTGAACCCGGGAGGCGGG - Intronic
1154997016 18:21649851-21649873 ATGGCGTGAACCCCGGGGGGCGG + Intergenic
1155145100 18:23077045-23077067 ATGGTGTGAACCCAGGAGGCGGG - Intergenic
1155781736 18:29846032-29846054 ATGGCGTGAACCCCGGGGGACGG - Intergenic
1155862708 18:30923363-30923385 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
1155948016 18:31877524-31877546 ATGGCATGAACCCCGGGGGGCGG + Intronic
1155950196 18:31902961-31902983 ATGGCGTGAACCCCGGGGAGCGG + Intronic
1156687730 18:39670047-39670069 ATGGCGTGACCCCCGGGAGGCGG + Intergenic
1157121057 18:44911591-44911613 ATGGTGAGACACCCAGAGGGTGG - Intronic
1157179402 18:45482809-45482831 ATGGTGAGAACACAAGGGGGTGG + Intronic
1157358555 18:46957338-46957360 ATGGCGTGAACCCCGGGGGGCGG - Intronic
1157672851 18:49544925-49544947 TTGGTAAGAACCGCAGGGGGAGG - Intergenic
1158039355 18:53073437-53073459 ATGGTATGAAACCTGGGGGGCGG + Intronic
1158108746 18:53916504-53916526 ATGGCGAGAACCCCGGGGAGCGG - Intergenic
1158301478 18:56057848-56057870 ATGGCGTGAACCCCAGGGGGCGG - Intergenic
1158424584 18:57327613-57327635 ATGGCGTGAACCCCAGGAGGCGG - Intergenic
1158463733 18:57670790-57670812 ATCGCTTGAACCCCAGAGGGAGG - Intronic
1158514487 18:58119787-58119809 TGGGTGTGAACCCCAGGGCATGG - Intronic
1159156738 18:64592961-64592983 ATGGCGTGAACCCCGGGAGGCGG + Intergenic
1159173151 18:64798803-64798825 ATTGCTTGAACCCCAGGAGGCGG + Intergenic
1159278899 18:66258412-66258434 ATGGCGTGAACCCCGGGGGGCGG + Intergenic
1159320427 18:66840190-66840212 ATGGTGTGAACCCCAGGGGCCGG + Intergenic
1159420912 18:68218232-68218254 ATGGCGTGAACCCGGGGAGGCGG + Intergenic
1159522952 18:69549007-69549029 ATGGCGTGAACCCCGGGTGACGG + Intronic
1159658132 18:71057330-71057352 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
1160334149 18:78022471-78022493 ATGGCGTGAACCCCAGGGGGCGG - Intergenic
1160964129 19:1738435-1738457 ATGGCGTGAACCCGGGGGGGTGG + Intergenic
1161172382 19:2819432-2819454 ATCGCTTGAACCCGAGGGGGCGG + Intergenic
1161183984 19:2903799-2903821 ATGGCGTGAACCCCGGAGGGCGG - Intronic
1161214391 19:3086337-3086359 ATGGCGTGAACCCCAGGGGGCGG - Intergenic
1161439174 19:4280611-4280633 ATCGCTTGAACCCCAGGAGGTGG - Intronic
1161720414 19:5899233-5899255 ATGGTGTGAACCCAGGAGGCGGG - Intronic
1161729163 19:5948364-5948386 ACGGCGTGAACCCCAGGAGGCGG + Intronic
1161810937 19:6471039-6471061 ATGGCTTGAGCCCCAGGAGGTGG - Intronic
1162221846 19:9183869-9183891 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
1162406067 19:10474600-10474622 GTGGCGTGAACCCCGGGGGGTGG + Intergenic
1162421940 19:10570461-10570483 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
1162475677 19:10898019-10898041 ATGGCGTGAACCCCAGGGAGTGG + Intronic
1162558676 19:11403119-11403141 ATGGCGTGAACCCCGGGGGGCGG - Intronic
1162573558 19:11486034-11486056 ATGGTGTGAACCCGGGGGGGTGG - Intronic
1162692666 19:12446982-12447004 ATGGCGTGAACCCCAGGGGGCGG - Intronic
1162694274 19:12460250-12460272 ATTGCTTGAACCCCAGGAGGTGG - Intronic
1162735298 19:12743813-12743835 ATGGCATGAACCCCAGGGGGCGG - Intronic
1162741461 19:12775961-12775983 ATGGCGTGAACCCCAGGGGGCGG - Intronic
1162832329 19:13293530-13293552 ATGGTGTAAAACCCGGGAGGCGG - Intronic
1163053671 19:14703116-14703138 ATGGCGTGAACCCCAGGGGGCGG + Intronic
1163331199 19:16639206-16639228 ATGGCGTGAACCTGGGGGGGCGG - Intronic
1163590143 19:18188697-18188719 ATGGCGTGAACCCGGGGAGGTGG - Intergenic
1163915477 19:20237396-20237418 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
1163971217 19:20797290-20797312 ATGGCGTGAACCCCAGGGGGCGG - Intronic
1164152484 19:22567055-22567077 ATGGCTTGAACCCCGTGGGGCGG - Intergenic
1164215632 19:23143156-23143178 ATGGTGTGAACCCCGGGAGGCGG + Intronic
1164648289 19:29874352-29874374 CTGTTGTAAACCCCATGGGGTGG + Intergenic
1164948713 19:32318084-32318106 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
1165019610 19:32912954-32912976 ATGGCGTGAACCCCGGGGGGCGG + Intronic
1165221867 19:34323115-34323137 ATGGCGTGAACCCCGGGGGGCGG - Intronic
1165239979 19:34458472-34458494 ATGGCGTGAACCCCAGGGGGCGG + Intronic
1165417078 19:35701389-35701411 ATGGCTTGAACCCCGGGAGGTGG + Intergenic
1165497628 19:36162810-36162832 ATGGCGTGAACCCTGGGAGGTGG + Intergenic
1165573355 19:36793625-36793647 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
1165671546 19:37683690-37683712 ATTGTGTGAACATCAGAGGGTGG - Intronic
1165684684 19:37809063-37809085 ATGGCGTGAACCCTGGGGAGCGG + Intronic
1165737758 19:38187629-38187651 ATGGCGTGAACCCCAGGGGGCGG + Intronic
1165798685 19:38534567-38534589 AGGGTGTGAGCCCCAGGGGATGG + Intronic
1166058202 19:40306873-40306895 ATGGCGTGAACCCCGGGGGGCGG - Intergenic
1166189891 19:41169586-41169608 ATGGCGTGAACCCCGAGAGGTGG - Intergenic
1166377842 19:42337590-42337612 ATGGCGTGAAACCCGGGGGGTGG - Intronic
1166408699 19:42542095-42542117 ATGGCGTGAACCCCGGGGGGCGG - Intronic
1166728122 19:45041133-45041155 ATGGTGTGAACCGGGGAGGGGGG + Intronic
1166746434 19:45144097-45144119 ATGGTGTGAACCCAGGAGGTGGG - Intronic
1166839826 19:45690243-45690265 ATGGCGTGAACCCCAGGGGGCGG + Intronic
1166858778 19:45797292-45797314 ATGGCGTGAACCCTGGGAGGCGG + Intronic
1167245812 19:48372562-48372584 ATGGCGTGAACCCCGGGGGCCGG + Intronic
1167443979 19:49526573-49526595 ATGGCGTGAACCCAGGGAGGCGG - Intergenic
1167481873 19:49737700-49737722 ATGGCGTGAACCCCAGGGGGCGG - Intergenic
1167990500 19:53356841-53356863 ATGGCGTGAACCCAGGGGGGCGG + Intergenic
1168004623 19:53476747-53476769 ATGGTGTGAACCCAGGAGGCGGG - Intronic
1168035885 19:53718922-53718944 ATCACTTGAACCCCAGGGGGCGG + Intergenic
1168300154 19:55400392-55400414 TGGGTGTGCACACCAGGGGGTGG - Exonic
1168598470 19:57698878-57698900 ATTGTTTGAACCCCGGGAGGTGG - Exonic
925401039 2:3573464-3573486 ATGGCGTGAACCGCCGGGGGCGG - Intergenic
925631194 2:5895256-5895278 ATGGCGTGAACCCCAGGGGGCGG - Intergenic
925724223 2:6857719-6857741 ATGGCATGAACCCCAGGGGGTGG - Intronic
926118432 2:10227845-10227867 ATGGTGTGAACCCCGGGAGGCGG - Intergenic
926359089 2:12068350-12068372 ATGGTGTGAACCCGGGAGGCGGG - Intergenic
926571751 2:14536824-14536846 AGGGTGTGAACACCAAGGGGTGG - Intergenic
926736198 2:16074841-16074863 GTGGAGTGAACCCCGGGGGGCGG + Intergenic
926835813 2:17018646-17018668 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
927188890 2:20502457-20502479 ATGGTGTGAACCCGGGAGGCAGG - Intergenic
927422259 2:22945855-22945877 ATGGCGTGAACCCCGGGGGGCGG + Intergenic
927541416 2:23914754-23914776 ATGGCGTGAACCCCGGGGGGCGG + Intronic
927542326 2:23924095-23924117 ATGGCGTGAACCCCGGGGGGCGG + Intronic
927560386 2:24068047-24068069 ATGGCGTGAACCCCAGGGGGTGG - Intronic
927629828 2:24763451-24763473 ATGGCATGAACCCCGGGGGGCGG + Intronic
927668173 2:25046587-25046609 ATGGCGTGAACCCCAGGGGGCGG - Intronic
927753263 2:25688603-25688625 ATGGAGTGAACCCCAGGGGGCGG - Intergenic
927921265 2:26973639-26973661 ATGGCGTGAACCCCGGGAAGCGG - Intronic
928156461 2:28881254-28881276 ATGGCGTGAACCCCGGGGGGCGG + Intergenic
928289583 2:30025703-30025725 ATGGCGTGAACTCCAGGGGGCGG - Intergenic
928464917 2:31514766-31514788 ATGGTGTGAACCCGGGAGGCGGG - Intergenic
928501042 2:31895927-31895949 GTGGTGTGAACCCCGGGGGGCGG - Intronic
928545151 2:32322517-32322539 ATGGCGTGAACTCCAGAGGGCGG + Intergenic
928565151 2:32537878-32537900 ATGGCCTGAACCCCAGAGGGCGG + Intronic
928701766 2:33905714-33905736 ATTGCTTGAACCCCAGGAGGTGG - Intergenic
929048176 2:37811058-37811080 ATGGTGTGAACCCGGGAGGCCGG + Intergenic
929106425 2:38370066-38370088 ATGGCGTGAACCCCGGGGGGCGG + Intronic
929137329 2:38637452-38637474 ATGGCGTGAACCCCGGGGGGCGG + Intergenic
929520600 2:42647068-42647090 ATGGCGTGGAACCCAGGAGGCGG + Intronic
929696204 2:44118064-44118086 ATGGCGTGAACCCGGGAGGGCGG - Intergenic
929854150 2:45621616-45621638 ATGGTGTGAACCCAGGGAGGAGG + Intergenic
930240531 2:48931718-48931740 ATGGCGTGAACCACAGGGGGCGG - Intergenic
930490724 2:52066655-52066677 ATGGTGTGAACCCGGGAGGCGGG + Intergenic
930727104 2:54693119-54693141 ATGGCGTGAAACCCAGGAGGCGG - Intergenic
930827404 2:55708393-55708415 ATGGCGTGAACCCAGCGGGGCGG - Intergenic
931307877 2:61049685-61049707 ATTGCTTGAACCCCAGGAGGCGG + Exonic
931398223 2:61907190-61907212 ATGGCTCGAACCCCAGGAGGTGG - Intronic
931524541 2:63138536-63138558 ATGGCATGAACCCCGGGGAGCGG - Intronic
931781179 2:65580468-65580490 ATGGCGTGAACCCCAGGGGGCGG - Intergenic
932041321 2:68302931-68302953 ATGGCGTGAACCCCGGGGGGCGG - Intronic
932225189 2:70034066-70034088 ATGGCGTGAACCCCGGGGGGTGG + Intergenic
932233695 2:70103741-70103763 ATGCTGTGATCCCCAGTAGGGGG + Intergenic
932241082 2:70157366-70157388 ATGGCGTGAACCCCAGGGGGCGG + Intronic
932245034 2:70189629-70189651 ATGGCGTGAACCCTGGGGGGTGG + Intronic
932278081 2:70466419-70466441 ATGGCGAGAACCCCGGGGGGCGG + Intronic
932438068 2:71714803-71714825 AGAGTGTAAACCCCAGGAGGAGG + Intergenic
932760065 2:74433573-74433595 ATGGCATGAACCCCAGGAGGTGG - Intronic
932798742 2:74720687-74720709 ATTGCTTGAACCCCAGGAGGCGG + Intergenic
932941031 2:76165619-76165641 ATGGCGTGAACCCCGGAGGCGGG + Intergenic
933452068 2:82467250-82467272 ATGGCGTGAACCCCGAGGGGCGG + Intergenic
933593729 2:84261384-84261406 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
933726945 2:85432484-85432506 ATGGCGTGAACCCCAGGGGGCGG - Intronic
934074044 2:88412135-88412157 ATGGTGTGAACCCGGGAGGTGGG + Intergenic
934484771 2:94695432-94695454 ATGGCGTGAACCCAGCGGGGCGG + Intergenic
934581833 2:95448238-95448260 ATGGTGTAAACCCCAGGTCAAGG - Intergenic
934597617 2:95628476-95628498 ATGGTGTAAACCCCAGGTCAAGG + Intergenic
935142977 2:100370785-100370807 ATGGCGTGAACCCCGGGGGGCGG - Intergenic
935221621 2:101019984-101020006 ATGGTGTGGAACCCGGGAGGCGG + Intronic
935258899 2:101337565-101337587 ATCGCTTGAACCCCAGGAGGTGG + Intergenic
935668296 2:105533784-105533806 ATGGCGTGAACCCTGGGGGGCGG - Intergenic
935826115 2:106951883-106951905 ATGGTGTGAACCCAGGAGGCAGG - Intergenic
936407021 2:112214030-112214052 ATGGTGTGAACCCCAGGGGGCGG - Exonic
936445200 2:112589408-112589430 ATGGCACGAACCCCGGGGGGCGG - Intergenic
936912894 2:117611013-117611035 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
937395574 2:121531507-121531529 ATGGCGTGAATCCGGGGGGGTGG + Intronic
937563010 2:123247778-123247800 ATGGTGTGAACCCTGGGAGGTGG + Intergenic
937878828 2:126849996-126850018 ATGGTGTGAACCCAAGAAGTAGG - Intergenic
938413700 2:131086977-131086999 ATGGTGTGAACCCCAGGGGGCGG + Intronic
938486484 2:131714909-131714931 ATGGCGTGAACCCCGGGGGGCGG + Intergenic
938943124 2:136186813-136186835 ATCGCTTGAACCCCAGGAGGTGG - Intergenic
939020682 2:136954628-136954650 ATGGTGTGAACCCCGGGGAGCGG + Intronic
939475117 2:142677157-142677179 ATGGCGTGAACCCCAGGGGGCGG - Intergenic
939491572 2:142883278-142883300 ATGGCGTGAACCCCGGGGGGTGG - Intronic
940026341 2:149212294-149212316 ATGGTGTGAACCCGGGAGGCAGG + Intronic
940242041 2:151574058-151574080 ATGGCGTGAAACCCAGGAGGCGG - Intronic
940580774 2:155576404-155576426 ATGGCGTGAACCCCAGGGGACGG + Intergenic
940907388 2:159181380-159181402 ATGGTGTGAACCCCAGGGGGCGG - Intronic
941234199 2:162948474-162948496 ATGGTGTGAACCCCGGGGGGCGG + Intergenic
941485217 2:166071802-166071824 ATGGCGTGAACCCGAGAGGTGGG + Intronic
941521491 2:166550198-166550220 ATGGCGTGAACGCCGGGGGGCGG - Intergenic
941893898 2:170610252-170610274 ATGGCGTGAACCCCGGAGGGTGG + Intronic
942047994 2:172111138-172111160 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
942064564 2:172258415-172258437 ATGGCGTGAACCCGGAGGGGTGG - Intergenic
942184733 2:173414339-173414361 ATGGCGTGATCCCCAGGGGGCGG - Intergenic
942466056 2:176208506-176208528 ATGGCGTGAACTCCAGGGGGCGG + Intergenic
942524421 2:176838363-176838385 ATTGCTTGAACCCCAGGAGGTGG + Intergenic
942871303 2:180737352-180737374 ATGGCGTGAACCCCGGGGGGCGG - Intergenic
943017646 2:182532857-182532879 ATGGCGTGAACCCCGGGAGGCGG + Intergenic
943456971 2:188120420-188120442 ATGGCGTGAACCCCAGGGGGCGG - Intergenic
944025871 2:195166675-195166697 ATGGCGTGAACCCCAGGGGGCGG - Intergenic
944109866 2:196120952-196120974 ATTGCTTGAACCCCAGGTGGTGG - Intergenic
944237279 2:197452156-197452178 ATGGCGTGAACCCCAGGGGGCGG - Intergenic
944487101 2:200218384-200218406 ATGGCGTGAACCCCGTGGGGCGG + Intergenic
944553686 2:200867708-200867730 ATTGTTTGAACCCCGGGAGGCGG - Intergenic
944702148 2:202255398-202255420 ATGGCGTAAAACCCAGGAGGCGG - Intergenic
944704180 2:202272236-202272258 ATGGCGTGAACCCCAGGGGGCGG - Intronic
944730665 2:202514220-202514242 ATGGCGTGAACCCTGGGGGGCGG - Intronic
944744865 2:202645373-202645395 ATGGCGTGAACCCCGGGGGGCGG - Intronic
944833022 2:203551432-203551454 ATGGTGTGAACCCCGCAGGGCGG + Intergenic
944992553 2:205254748-205254770 ATGGCGTGAACCCCGGGGGGCGG - Intronic
945302830 2:208230127-208230149 ATGGCATGAACCCCGGGGGGCGG + Intergenic
945392494 2:209280918-209280940 ATGGCGTGAACCCCGTGGGGCGG - Intergenic
945551497 2:211227040-211227062 ATGGCGTGAACCCCAGGGGGCGG - Intergenic
945879176 2:215309109-215309131 ATGGCATGAACCCCGGGGGGCGG - Intergenic
945911130 2:215651027-215651049 ATGGCGTGAATCCCGCGGGGCGG - Intergenic
946000037 2:216474667-216474689 ATCACTTGAACCCCAGGGGGCGG + Intronic
946021328 2:216642390-216642412 ATGGCATCAACCCCAGGAGGCGG - Intronic
946187279 2:217988220-217988242 CTGGTGTGAACCGGAGGGGAGGG - Intronic
946272923 2:218609054-218609076 ATAGCGTGAACCCCGGGGGGCGG + Intronic
946411803 2:219518988-219519010 ATGGCATGAACCCCGGGGGGCGG - Intronic
946564300 2:220946308-220946330 ATGGCGTGAACCCAGGAGGGGGG - Intergenic
946835627 2:223769828-223769850 ATGGCGTGAACCCCGGGGGGCGG - Intronic
946929547 2:224658268-224658290 ATGGCGTGAACCCCGGGAGGTGG - Intergenic
947404691 2:229762638-229762660 ATGGCGTGAACCCCGGGGGCCGG - Intergenic
947489502 2:230581458-230581480 ATGGCGTGAACCCCGGGGGGCGG + Intergenic
947603495 2:231468758-231468780 GTAGTGGGAACCCCAGGAGGGGG - Intronic
947633769 2:231669941-231669963 ATGGAGTGCACCCCGAGGGGTGG - Intergenic
948249175 2:236511868-236511890 ATCGCTTGAACCCCAGGAGGCGG - Intergenic
948913178 2:241016279-241016301 ATAGCGTGAACCCCGGGTGGTGG - Intronic
1169067777 20:2704179-2704201 AGGGCATGAATCCCAGGGGGTGG + Intronic
1169129539 20:3158558-3158580 GTGGCGTGAACCCCGGGAGGCGG - Intronic
1169179929 20:3555085-3555107 ATGGCGTGAACCCCAGGGGGCGG - Intronic
1169181144 20:3568203-3568225 ATGATGTGAACCCCAGGAGGTGG + Intronic
1169442166 20:5641657-5641679 AGGGTATGAACACCAGGAGGTGG + Intergenic
1169615953 20:7445512-7445534 ATGGCGTGAACCCTGGGAGGCGG + Intergenic
1170547826 20:17450112-17450134 ATGGCGTGAACCCCAGGGGGCGG - Intronic
1170677927 20:18499641-18499663 ATGGCGTGAACCCCAGGGGGCGG - Intergenic
1170866066 20:20159480-20159502 AAGGTGTGAAACCCATGGGGTGG - Intronic
1171061212 20:21962285-21962307 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
1171943650 20:31355318-31355340 ATGGTGTGAACCCAGGAGGCAGG - Intergenic
1172244604 20:33437339-33437361 ATTGTTTGAGCCCCGGGGGGTGG + Intronic
1172284887 20:33733303-33733325 ATGGCGTGAACCCCGGGAAGCGG - Intronic
1173116486 20:40248295-40248317 ATGGCGTGAACCCCAGGGGGCGG - Intergenic
1173219195 20:41117470-41117492 ATGGCGTGAACCCCAGGAGGCGG - Intronic
1173535964 20:43813697-43813719 ATGGTGTGAACCCAGGAGGCGGG - Intergenic
1173656011 20:44700800-44700822 ATGGGGTTAACCCCAGAGGAAGG + Intergenic
1173919568 20:46733668-46733690 GTGGTGGGAACCCCAGTGGAAGG + Intronic
1174165207 20:48579390-48579412 ATGGCGTGAACCCTGGGGGGTGG - Intergenic
1174247998 20:49196348-49196370 ATGGCGTGAACCCCGGGGGGCGG + Intergenic
1174372845 20:50104569-50104591 ATGGCGTGAACCCCAGGGGGCGG + Intronic
1174488278 20:50874721-50874743 ATGGTGTCAAGTGCAGGGGGAGG + Intronic
1174632140 20:51967406-51967428 ATGGCGTGAACCCCAGGGGGCGG - Intergenic
1174824818 20:53759547-53759569 AAGGCGTGAACCCCGGGGGGCGG - Intergenic
1175116560 20:56686886-56686908 ATGGCGTGAACCTCGGGGGGCGG - Intergenic
1175121269 20:56717988-56718010 ATCGTTTGAACCCCAGGAAGTGG - Intergenic
1175143872 20:56881375-56881397 ATGGTGAGAACCCAGGGAGGCGG - Intergenic
1175268769 20:57719104-57719126 AGGGTGTGAGCTCCACGGGGAGG + Intergenic
1175386657 20:58600300-58600322 CTGCTGTGACCCCCAGGGAGGGG - Intergenic
1175886286 20:62292952-62292974 ATGGTGTGAACCCGGAGGGGCGG - Intronic
1175914479 20:62419325-62419347 AGAGTGTGACCCCGAGGGGGAGG - Intronic
1176287457 21:5025693-5025715 ATGGCGTGAACCCCAGAGTCGGG + Intronic
1176425299 21:6545048-6545070 ATCGCTTGAACCCCAGGAGGCGG - Intergenic
1176798928 21:13403289-13403311 ATGGTGTGAACCCGGGAGGCGGG + Intergenic
1177157081 21:17511452-17511474 ATGGCGTGAACCCCGGGAGGGGG - Intergenic
1177174744 21:17691439-17691461 ATGGCGTGAACCCCGGGGGGCGG - Intergenic
1177200307 21:17946331-17946353 ATGGCGTGAACCCCCGGGGGCGG + Intronic
1177205301 21:18003035-18003057 ATGGCGTGAACCCCGGGGGGCGG + Intronic
1177315784 21:19459112-19459134 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
1177546679 21:22567906-22567928 ATGGTGTGAACCCAGGAGGTGGG - Intergenic
1177715499 21:24835765-24835787 ATGGCGTGAACCCCTGGGGGCGG - Intergenic
1177832635 21:26155909-26155931 ATGGCGTGAACCCAGGAGGGAGG + Intronic
1177835939 21:26186243-26186265 ATGGTGTGAACCCGGGAGGTGGG - Intergenic
1178034701 21:28566725-28566747 ATGGCGTGAACCCCGGGGGACGG + Intergenic
1178074705 21:29004089-29004111 ATCGCTTGAACCCCAGGCGGCGG + Intergenic
1178325337 21:31641212-31641234 ATGGCGTGAACCCCAGGGGGCGG - Intergenic
1178559061 21:33620989-33621011 ATGGCGTGAACCCCAGGGGGCGG - Intronic
1178700862 21:34833188-34833210 ATGGTGTGAACCCGGGAGGTTGG - Intronic
1179158739 21:38874534-38874556 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
1179496943 21:41778157-41778179 CTGGTGTGTAGCCCAGGGGCCGG + Intergenic
1179525266 21:41971879-41971901 ATGGCGTGAACCCGAGAGGCGGG + Intergenic
1179700790 21:43153365-43153387 ATCGCTTGAACCCCAGGAGGCGG - Intergenic
1179721049 21:43316227-43316249 ATGGTGAAAACCTCAGTGGGAGG - Intergenic
1179869724 21:44237782-44237804 ATGGCGTGAACCCCAGAGTCGGG - Intronic
1179980611 21:44893769-44893791 AGGGTGTGAGCCTCAGGGGTGGG + Intronic
1180021854 21:45133590-45133612 AAGGTGTGTACCCCAGGGGCAGG + Intronic
1180206251 21:46262879-46262901 ATGGCGTGAACCCCGGGGGGCGG + Intronic
1180211655 21:46298513-46298535 ATGGCGTGAACCCCGGCGGGCGG - Intergenic
1180490682 22:15843856-15843878 ATGGCGTGAACCCCGGGGAGCGG + Intergenic
1180638838 22:17281977-17281999 ATGGCGTGAACCCCGGGAGCTGG - Intergenic
1180668532 22:17534591-17534613 ATGGTGTGAACCCGGGAGGCGGG - Intronic
1180672615 22:17565164-17565186 ATGGCGTGAACCCGGGGGGGCGG - Intronic
1180687379 22:17680126-17680148 ATTGCTTGAACCCCGGGGGGCGG + Intronic
1180736256 22:18019896-18019918 ATGGCGTGAACCCCGGGGGGCGG - Intronic
1180791943 22:18579589-18579611 ATGGCGTGAACCCCGGGGGGCGG + Intergenic
1180792786 22:18585776-18585798 ATGGCGTGAACCCCAGGAGGCGG + Intergenic
1180826005 22:18862033-18862055 ATGGCGTGAACCCCGGGACGTGG + Intergenic
1180920866 22:19520928-19520950 ATGGTGAGACCCACAGGTGGAGG - Intergenic
1181091550 22:20476497-20476519 ATGGTGTGAACCCCGGGGGGCGG - Intronic
1181186729 22:21112518-21112540 ATGGCGTGAACCCCGGGACGTGG - Intergenic
1181212473 22:21297976-21297998 ATGGCGTGAACCCCGGGACGTGG + Intergenic
1181228950 22:21409543-21409565 ATGGCGTGAACCCCAGGAGGCGG - Intergenic
1181229793 22:21415720-21415742 ATGGCGTGAACCCCGGGGGGCGG - Intergenic
1181248856 22:21519146-21519168 ATGGCGTGAACCCCGGGGGGCGG + Intergenic
1181249701 22:21525322-21525344 ATGGCGTGAACCCCAGGAGGCGG + Intergenic
1181382503 22:22518009-22518031 ATGGCGTGAACCCCGCGGGGCGG - Intronic
1181482520 22:23209630-23209652 ATGGTGTGAACCCGGGAGGCAGG - Intronic
1181576246 22:23797082-23797104 ATGGCGTGAACCCCAGGGGGCGG - Intronic
1181590980 22:23884480-23884502 ATCCTGAGAACCCCAGGGGGAGG + Intronic
1181662901 22:24366277-24366299 ATGGCATGAACCCCAGGGGGCGG - Intronic
1181982806 22:26777979-26778001 AGGGTATGAATCCCAGGAGGTGG - Intergenic
1182359217 22:29736939-29736961 ATGGCGTGAACCCCAAGAGGTGG + Intronic
1182412790 22:30201501-30201523 ATGGCGTGAACCCCGCGGGGCGG - Intergenic
1182820647 22:33212930-33212952 ATGGTGTGAACCCAGGAGGCGGG + Intronic
1182943989 22:34305247-34305269 ATGGTGTGAACCCTGGGGGGCGG - Intergenic
1183399477 22:37593738-37593760 ATGGTGTGAACCCGGGAGGCAGG - Intergenic
1183488101 22:38100438-38100460 ATCGCTTGAACCCTAGGGGGCGG + Intronic
1183946881 22:41331467-41331489 ATGGTGTGAACCCAGGAGGCGGG + Intronic
1183967377 22:41450249-41450271 ATGGCGTGAACCCCGGGAGACGG - Intergenic
1183997914 22:41649767-41649789 ATGGCGTGAACCCCGGTGGGTGG + Intronic
1184032367 22:41902611-41902633 ATGGTGGGACTCCCATGGGGTGG + Intronic
1184136482 22:42553237-42553259 ATGGCGTGAACCCGGGGGAGCGG - Intergenic
1184374210 22:44101321-44101343 ATGGCATGAACCCCGGGGGGCGG + Intronic
1184531263 22:45057183-45057205 ATGGCGTGAACCCCAGGGAGCGG + Intergenic
1184623053 22:45697714-45697736 ATGGCGTGAACCCCAGGGGGCGG - Intronic
1184948513 22:47821871-47821893 ATGGCGTGAACCCAGGAGGGAGG - Intergenic
1203276147 22_KI270734v1_random:87939-87961 ATGGCGTGAACCCCGGGACGTGG + Intergenic
949186893 3:1202452-1202474 ATGGCGGGAACCCCGGGGGGCGG + Intronic
950838885 3:15947760-15947782 ATGGCATGAACCCCGGGGGGCGG + Intergenic
950892014 3:16412612-16412634 AAAGTGTGAACACCAGGAGGTGG - Intronic
951267595 3:20588031-20588053 ATGGCGTCAACCCCAGAAGGCGG - Intergenic
951351331 3:21610687-21610709 ATGGTGTGAACCCAGGAGGCGGG + Intronic
951382985 3:22008437-22008459 ATGTTGTGAACTCCGGGGGGCGG - Intronic
951879541 3:27466363-27466385 ATGGTGTGAACCCCGGGGGACGG + Intronic
951935897 3:28022881-28022903 ATAGTGTGACCTCCAGGGGTGGG - Intergenic
952145312 3:30525811-30525833 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
952150802 3:30588501-30588523 ATGGCGCGAACCCCAGGGGGCGG - Intergenic
952381655 3:32810053-32810075 ATGGTGTGAACCCCGGGGGGCGG - Intergenic
952434587 3:33259649-33259671 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
952598989 3:35056103-35056125 ATGGCGTGAACCCCGGGGGGCGG - Intergenic
952806771 3:37362866-37362888 ATGGTGTGAACCCAGGAGGCGGG - Intronic
952932165 3:38368820-38368842 AAGGGGTGAACACCAGGAGGTGG + Intronic
952951756 3:38531385-38531407 ATGGTGTTAACCTGAGGTGGTGG + Intronic
953318558 3:41951056-41951078 ATGGCGTGAACCCCGGGAGGCGG + Intronic
953321741 3:41978844-41978866 ATGGCGTGAACCCTGGGAGGCGG - Intergenic
953478324 3:43225724-43225746 ATGGCGTGAACCCCAGGGGGCGG - Intergenic
953508771 3:43513594-43513616 ATGGCGTGAACCCTTGGAGGTGG - Intronic
953573169 3:44088939-44088961 ATGGTGTGAACCCAGGAGGCAGG + Intergenic
953584456 3:44187103-44187125 AGGGTGTGAATACCAGGAGGTGG - Intergenic
953695694 3:45156778-45156800 ATCGCTTGAACCCCAGGAGGTGG + Intergenic
953977055 3:47389752-47389774 ATGGCGTGAACCCGGGGGGGTGG + Intronic
953987307 3:47454279-47454301 ATGGTGTGAACCCCGGGGGACGG + Intronic
954086986 3:48252706-48252728 ATGGCGTGAACCCCAGGGGGCGG - Intronic
954575978 3:51676450-51676472 ATGTGGTGGACCCCATGGGGTGG + Intronic
954617989 3:51980006-51980028 ATGGCATGAACCCCGGGGGGCGG - Intronic
954695023 3:52419514-52419536 ATGGCGTGAACCCGAGAGGGTGG - Intronic
954899511 3:54006980-54007002 ATGGCGTGAACCCCGGGGGGCGG - Intergenic
955044463 3:55346805-55346827 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
955112742 3:55965167-55965189 AGGGTGTGAAAACCAGGGGGTGG + Intronic
956395438 3:68821431-68821453 ATGGCGTGAACCCCAGGGGGTGG - Intronic
956585044 3:70855197-70855219 AAGGTGTGAATACCAGGGTGTGG - Intergenic
957059030 3:75466525-75466547 ATGGCGTGAACCCCGGGAGGTGG + Intergenic
957151286 3:76488996-76489018 ATTGCTTGAACCCCAGGAGGTGG + Intronic
957462952 3:80546052-80546074 ATCGCTTGAACCCCAGGTGGCGG - Intergenic
957747332 3:84362750-84362772 ATGGCGTGAACCCCAGGAGGCGG - Intergenic
957883713 3:86255722-86255744 ATGGCGTGAACCCCAGGAGGCGG - Intergenic
957977462 3:87465419-87465441 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
958054815 3:88396189-88396211 ATGGCGTGAACCCCAGGGGGCGG - Intergenic
958547434 3:95572636-95572658 ATGGCGTGAACCCAGGGAGGAGG - Intergenic
958627352 3:96643229-96643251 ATGGAGAGAACTGCAGGGGGAGG + Intergenic
958766417 3:98373358-98373380 ATGGCGTGAACCCCGGGGGGCGG - Intergenic
958989136 3:100821687-100821709 ATTGCTTGAACCCCAGGAGGTGG - Intronic
959055408 3:101562563-101562585 ATGGCGTGAACCCTGGGAGGCGG + Intronic
959068303 3:101679357-101679379 ATGGTGTGAACCCCGGGGGACGG - Intergenic
959494966 3:107039530-107039552 ATGGTGTGAACCCGGGAGGCGGG + Intergenic
959700134 3:109290977-109290999 ATGGCATGAACCCCGGGGGGCGG - Intergenic
959850212 3:111076887-111076909 ATTGCTTGAACCCCAGGGGGAGG + Intronic
960025350 3:113002874-113002896 CTGGTGAGAAGCCCAGGGGCAGG + Exonic
960045993 3:113199109-113199131 CTGCTGTGAAACCCATGGGGAGG - Intergenic
960056344 3:113279095-113279117 CTGATGTGAACACCAGTGGGTGG + Intronic
960057991 3:113289632-113289654 AGGGTGTGAATGCCAGGTGGGGG - Exonic
960111682 3:113850886-113850908 ATGGTGTGAACCCGGGGAAGCGG - Intronic
960194440 3:114747830-114747852 ATGGCGTGAACCCCAGGGGGCGG + Intronic
960226536 3:115175776-115175798 ATGGCATGAACCCCGGGGGGTGG + Intergenic
960347837 3:116556630-116556652 ATGGCGTGAACCCCAGGGGGCGG + Intronic
960802737 3:121555648-121555670 ATGGCGTGAACCCCAGGGGGCGG - Intergenic
961194193 3:124987607-124987629 ATGGCGTGAACCTGGGGGGGCGG - Intronic
961246532 3:125458726-125458748 ATGGCGTGAATCCCGGGGGGCGG + Intronic
961250532 3:125500711-125500733 ATGGTGTGAACCCCAGAGGGTGG + Intronic
961294417 3:125873206-125873228 ATGGCATGAACCCCGGGAGGTGG - Intergenic
961548160 3:127650740-127650762 ATGGTGTGAACCCAGGAGGCGGG - Intronic
961714355 3:128848445-128848467 AAGGTGGGAACCCCAGAGGAAGG + Intergenic
961759369 3:129154154-129154176 ATGGCGTGAACCCCGGGGGGCGG + Intronic
961953330 3:130773263-130773285 ATGGCGTGAACCCCAGGGGGCGG - Intergenic
962182926 3:133227277-133227299 ATGGCGTGAACCCCAGGGGGCGG - Intronic
962218222 3:133541185-133541207 GTGGTGTGAATACCAGGAGGTGG - Intergenic
962425089 3:135262582-135262604 ATGCTGTGCAGCCCAGGGTGTGG + Intergenic
962580826 3:136796348-136796370 ATGGCATGAACCCCAGGGCGGGG + Intergenic
962791711 3:138817250-138817272 ATGGCATGAACCCCGGGGGGCGG + Intronic
963166853 3:142212918-142212940 ATGGCGTGAACCCCAGGGGGCGG - Intronic
963185536 3:142411906-142411928 ATGGCGTGAACCCCCGGGGGCGG - Intronic
963189594 3:142454525-142454547 ATGGCGTGAACCCCAGGGGGCGG - Intronic
963336995 3:143986636-143986658 ATGGCGTGAACCCCAGGGGGCGG + Intronic
963378588 3:144501459-144501481 AAGGTGTGAACCCTAGGGGAGGG - Intergenic
963737417 3:149035570-149035592 ATGGCCTGAACCCCGGGAGGCGG + Intronic
963739094 3:149057021-149057043 ATGGCGTGAACCCCAGGGGGCGG + Intronic
963752358 3:149195778-149195800 ATGGTGTGAACCCAGGAGGTGGG + Intronic
963946447 3:151151121-151151143 ATGGCGTGAACCCCGGGACGTGG - Intronic
964112436 3:153101606-153101628 ATGGCTTGAACCCCGGGGGGCGG + Intergenic
964352153 3:155814054-155814076 ATGGCGTGAACCACAGGGGGTGG - Intergenic
964411082 3:156398504-156398526 ATGGCATGAACCCCGGGGGGCGG + Intronic
964568663 3:158088494-158088516 ATGGCGTGAACCCCAGGAGGAGG + Intergenic
964789287 3:160436710-160436732 ATGGTGTGAACCCGGGAGGCGGG + Exonic
964838771 3:160970874-160970896 ATGGCGTGAACCCCAGGGGGCGG - Intronic
965090328 3:164153527-164153549 ATGGCGTGAACCCCAGGGGGTGG + Intergenic
965544142 3:169898291-169898313 ATGGCGTGAACCCCGGGGGGCGG + Intergenic
965574627 3:170205742-170205764 ATCGCTTGAACCCCGGGGGGTGG - Intergenic
965911335 3:173781056-173781078 ATGGCGTGAACCCAGGAGGGTGG + Intronic
965958918 3:174405554-174405576 ATGGCGTGAACCCCGGGGGGCGG + Intergenic
965959145 3:174408000-174408022 ATGGTGAGAACTCCAAGTGGTGG - Intergenic
966163612 3:176992524-176992546 ATGGCGTGAACCCCGCGGGGCGG + Intergenic
966196540 3:177319485-177319507 ATGGGGTGAACCCTCGGGGGCGG + Intergenic
966219256 3:177534504-177534526 ATGGCGTGAACCCCGGGGGGCGG - Intergenic
966377687 3:179313474-179313496 ATGGCGTGAACCCCGGGGGGCGG + Intergenic
966462529 3:180193259-180193281 ATGGTGTGAACCCGGGAGGTGGG - Intergenic
966681409 3:182645526-182645548 ATGGTGTGAACCCGGGAGGCAGG - Intergenic
966781244 3:183586098-183586120 ATGATGTGAACCTGGGGGGGCGG + Intergenic
967108081 3:186269939-186269961 TTGGTGAGAATTCCAGGGGGAGG - Intronic
967142555 3:186573469-186573491 ATGGCGTAAAACCCAGGAGGCGG - Intronic
967177869 3:186876337-186876359 ATGGCGTGAACTCCAGGGGGCGG - Intergenic
967253098 3:187563195-187563217 AAGATGTGAACACCAGGAGGTGG + Intergenic
967470696 3:189858317-189858339 ATGGCGTGAACCCCAGGGGGCGG + Intronic
967564174 3:190954248-190954270 ATGGTGTGAACCCGGGAGGCTGG + Intergenic
968398563 4:267216-267238 ATGGTGTGAACCCTGGGGGGCGG + Intergenic
968587001 4:1423609-1423631 ATGGCATGAACCCCAGGGGGTGG - Intergenic
968624539 4:1621187-1621209 ATGGCATGAACCCTGGGGGGCGG - Intronic
968669367 4:1840579-1840601 ATGGTGTGGACCCCGGGGGGCGG + Intronic
968760749 4:2441892-2441914 ATGGTGTGGCTCCCAGGAGGTGG + Intronic
968886050 4:3333133-3333155 ATGGCGTGAACCCTGGGGGACGG - Intronic
968968693 4:3782307-3782329 AGGCTGTGAAGCCCAGGGTGTGG - Intergenic
969172435 4:5375092-5375114 ATGGTGAGACCACCAGGGGTGGG - Intronic
969372835 4:6744952-6744974 ATGGTGTGAACCCGGGAGGGAGG + Intergenic
969400694 4:6953543-6953565 ATGGCGTGAACCCCAGGGGGCGG + Intronic
969751078 4:9111810-9111832 ATGGCGTGAACCCCAGGAGGTGG - Intergenic
969810990 4:9648102-9648124 ATGGCGTGAACCCTGGGAGGTGG - Intergenic
970415499 4:15852894-15852916 ATGGCGTGAACCCCAGGGGGTGG - Exonic
970602205 4:17649496-17649518 ATGGTGTGAACCCGGGTGGTGGG + Intronic
970652178 4:18191032-18191054 TTGGCGTGAACCCCGGGGGGCGG - Intergenic
971051345 4:22866319-22866341 ATGGTGTGAACCCCGGGGGCCGG + Intergenic
971252626 4:24986065-24986087 ATGGCGTGAACCCCAGGGGGTGG - Intergenic
971289640 4:25325155-25325177 ATGGCGTGAATCCCGGGAGGCGG + Intronic
971315796 4:25566962-25566984 ATGGCGTGAACCCCAGGGGGCGG - Intergenic
971407485 4:26335704-26335726 ATGGCGTAAAACCCAGGAGGTGG - Intronic
971482651 4:27128078-27128100 ATCGTTTGAACCCCAAGAGGGGG - Intergenic
971736216 4:30455836-30455858 ATGGCGTGAACCCCGGGGGGTGG + Intergenic
972176135 4:36408976-36408998 ATGGCGTGAACCCCGGGAGGCGG - Intergenic
972194929 4:36641907-36641929 ATGGCGTGAACCCGCGGGGGCGG + Intergenic
972508106 4:39740454-39740476 ATGGCGTGAACCCCGGGAGGCGG + Intronic
972625384 4:40792663-40792685 ATGGCTTGAACCCCGGGGGGCGG + Intronic
972770686 4:42194347-42194369 ATGGCGTGAACCCCGGGGGGCGG - Intergenic
972878700 4:43396703-43396725 ATGGCGGGAACCCCGGGAGGCGG + Intergenic
973059230 4:45699669-45699691 ATGGCGTGAACCCCAGGGGGCGG - Intergenic
973761153 4:54117063-54117085 ATGGCGTGAACCCCGGGGGGCGG - Intronic
974070758 4:57121423-57121445 ATCGCTTGAACCCCAGGAGGTGG - Intergenic
974184944 4:58432894-58432916 ATGGTGTGAACCCGGGAGGTGGG + Intergenic
974484204 4:62485634-62485656 ATGGCGTGAACCCCGGGAGGAGG + Intergenic
974783744 4:66589974-66589996 TTATTGTGAACCCCGGGGGGCGG - Intergenic
975229826 4:71919420-71919442 ATGACGTGAACCCCGGGGGGCGG + Intergenic
976171031 4:82304574-82304596 ATGGCGTGAACCCCGGGGGGCGG - Intergenic
976247630 4:83019549-83019571 ATGTCGTGAATCCCAGGGGGCGG + Intergenic
976307440 4:83574960-83574982 ATGGCGTGAACCCCAGGGGGCGG - Intronic
976410054 4:84703008-84703030 ATGGCATGAACCCCAGGGGGCGG + Intronic
976646224 4:87390240-87390262 ATGGCGGGAACCCCGCGGGGCGG - Intronic
976671662 4:87661305-87661327 ATGGCGTGAACCCCAGGGGGCGG - Intronic
976702977 4:87991225-87991247 ATGGTGTGAACCCCGGAGGCCGG + Intergenic
976765779 4:88595933-88595955 ATGGCATGAACCCCGGGGGGCGG - Intronic
977197037 4:94076291-94076313 ATGGCGTGAATCCCGGAGGGCGG + Intergenic
977215764 4:94281951-94281973 ATTGTTTGAGCCCCGGGGGGCGG + Intronic
977315644 4:95444415-95444437 ATGGCGTGAAGCCAGGGGGGCGG - Intronic
977372806 4:96161627-96161649 ACGGCGTGAACCCCGGGGGGCGG + Intergenic
977636540 4:99304579-99304601 ATGGCGTGAACCCCGGGGGGCGG + Intergenic
977750220 4:100600936-100600958 ATGGCGTGAACCCTGAGGGGCGG + Intronic
978145265 4:105365142-105365164 ATGGCGTGAACCCCGGGGGGCGG - Intergenic
978311485 4:107388728-107388750 AGGGTGTGAATCCCAGCAGGTGG - Intergenic
978364753 4:107969807-107969829 ATTGCTTGAACCCCAGGAGGTGG + Intergenic
978516826 4:109577694-109577716 ATGGCGTGAACCCCGGGGGGCGG - Intronic
978665531 4:111176918-111176940 ATGGCGTGAACCCTGGGGGCCGG + Intergenic
978787435 4:112625497-112625519 ATGGCGTGAAACCCGGGAGGCGG + Intronic
978967180 4:114754409-114754431 ATGGCGTGAACCCCGGGGGGCGG + Intergenic
979009292 4:115346400-115346422 ATGTTGTGAACCCGGGGAGGTGG - Intergenic
979255055 4:118600182-118600204 ATTGTTTGAACCCAGGGGGGCGG - Intergenic
979333906 4:119445831-119445853 ATTGTTTGAACCCCGGGGGGCGG + Intergenic
979441816 4:120758839-120758861 ATGGTGTGAACCCGGGAGGCAGG - Intronic
979470588 4:121091591-121091613 ATGGTGTGAACCCGGGAGGCGGG + Intergenic
979769229 4:124502010-124502032 ATGCTGTGAACCCTAGAGGAGGG - Intergenic
979772354 4:124543470-124543492 ATGGCGTGAACCCTGGGGGGCGG + Intergenic
980048075 4:128011232-128011254 ATGGTGTGAACCCTGGGGGGCGG - Intronic
980104680 4:128576232-128576254 ATGTTGTGAACCCCGGGAGGCGG + Intergenic
980143741 4:128954402-128954424 ATGGTGTGAACCCAGGAGGCGGG - Intronic
980453365 4:133006611-133006633 ATGGCGTGAACCCGGGGGGCGGG - Intergenic
980471333 4:133256459-133256481 ATGGCGTGAACCCCGCGGGGCGG - Intergenic
980821191 4:138019734-138019756 ATGGCGTGAACCCCGGGGGGCGG + Intergenic
980825511 4:138067124-138067146 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
981143690 4:141300622-141300644 ATGGTGTGAACCCGGGAGGCGGG + Intergenic
981449524 4:144880041-144880063 ATGGCGTGAACCCCGGGGGGCGG + Intergenic
982041265 4:151399203-151399225 ATGGCGTGAACCCTGGGGGGCGG + Intergenic
982242816 4:153317561-153317583 ATGGTGTGAACCCCGGGAGGCGG + Intronic
982495081 4:156080996-156081018 ATGGCGTGAACCCCAGGGGGCGG - Intergenic
983216175 4:165004925-165004947 ATGGCGTGAACCCCGGGGGGCGG + Intergenic
983634891 4:169887461-169887483 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
983901969 4:173145625-173145647 AGGGTGTGAATACCAGGAGGCGG + Intergenic
984039912 4:174719047-174719069 ATGGGGTGAACCCCAGGGGGCGG - Intronic
984153724 4:176167558-176167580 ATGGCGTGAACCCCAGGGGGCGG + Intronic
984259713 4:177429767-177429789 ATGGTGTGAACCCATGAGGCGGG + Intergenic
984384876 4:179043794-179043816 ATGGCGTGAACCCCAGGGGGCGG - Intergenic
984556456 4:181219549-181219571 ATGGTGTGAACCCGGGAGGCGGG + Intergenic
984696863 4:182787646-182787668 ATGGCTTGAACCCCGGGAGGCGG + Intronic
984807893 4:183768212-183768234 ATGGTGTGAAGAGCAGGTGGAGG + Intergenic
985285886 4:188336317-188336339 ATGGCGGGAACCCCGGGGGGCGG - Intergenic
985312453 4:188617125-188617147 ATGGCATGAACCCCGGGAGGTGG - Intergenic
985325647 4:188765867-188765889 ATGGCGTGAACCCCAGAGGGCGG + Intergenic
985340562 4:188948523-188948545 ATGGCGGGAACCCCGGGGGGCGG - Intergenic
985340582 4:188948575-188948597 ATGGCGTGAACCCCTGAGGCAGG - Intergenic
985356202 4:189122198-189122220 ATGGCGGGAACCCCGGGAGGCGG + Intergenic
986809271 5:11339022-11339044 ATGGCGTGAACCCCAGGGGGCGG - Intronic
986927244 5:12769867-12769889 ATGGCATGAACCCTGGGGGGCGG + Intergenic
987226389 5:15845883-15845905 ATGGCGTGAACCCCAGGAGGCGG + Intronic
987231460 5:15897897-15897919 AAGGTGTGAAACCCATTGGGAGG + Intronic
987620517 5:20334217-20334239 ATGGCGTGAACCCCAGGGGGCGG - Intronic
987772617 5:22326319-22326341 ATGGCGTGAACCCCGGGGGGCGG - Intronic
987927246 5:24358601-24358623 ATGGCGTGAACCCCGGGGGGCGG - Intergenic
988175143 5:27713362-27713384 ATGGCGTAAACCCCGGGGGGCGG + Intergenic
988252759 5:28781745-28781767 ATGGTGTGGCTCCCAGGTGGAGG - Intergenic
988259531 5:28866682-28866704 ATGGCGTGAGCCCAAGGAGGTGG + Intergenic
988512640 5:31878644-31878666 ATGGCGTGAACCCCGGGGGGCGG - Intronic
988709857 5:33762420-33762442 ATGGTGTGAACCCGGGAGGCGGG + Intronic
988825780 5:34932960-34932982 AAGGTGTGAATGCCAGGAGGCGG + Intronic
988864621 5:35321319-35321341 ATGGCGTGAACCCCGGGGGGCGG + Intergenic
989169704 5:38462080-38462102 ATGGCGTGAACCCCGGGGGGCGG + Intronic
989186981 5:38635523-38635545 ATGGCGTGAACCCCGGGGGGCGG - Intergenic
989228105 5:39053804-39053826 ATGGCGTGAACCCCAGGGGGCGG + Intronic
989266520 5:39481230-39481252 ATGGCGTGAACCCCGGGGGGCGG - Intergenic
989585352 5:43070380-43070402 ATGGTGTGAACCCGGGAGGTGGG - Intronic
989586610 5:43078660-43078682 ATGGCGTGAACCCCAGGGGGCGG + Intronic
989587329 5:43085635-43085657 ATGGCATGAACCCAAGGAGGTGG + Intronic
989673763 5:43950135-43950157 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
990074247 5:51823104-51823126 ATGGCGTGAAACCCAGGAGGCGG + Intergenic
990500766 5:56394722-56394744 ATGGCATGAACCCAGGGGGGCGG + Intergenic
990779050 5:59337416-59337438 ATGGCGTGAACCCCGGGGGACGG - Intronic
990848066 5:60167352-60167374 ATGGCGTGAACCCCAGGGGGCGG - Intronic
991082829 5:62619765-62619787 ATGGCGTGAACCCAGGAGGGTGG + Intronic
991178417 5:63719114-63719136 AGGATGTGTACACCAGGGGGTGG - Intergenic
991686685 5:69188452-69188474 ATCGTTTGAACCCGGGGGGGCGG - Intergenic
991697166 5:69283874-69283896 ATGGTGTGAACCCAGGAGAGCGG - Intronic
991944057 5:71882671-71882693 ATGGCATGAACCCCGGGGGGCGG + Intergenic
991972909 5:72158092-72158114 ATGGCGTGAACCCCGGGGGGCGG - Intronic
992436473 5:76760039-76760061 ATGGCGTGAACCCCGCGGGGCGG + Intergenic
992545358 5:77809603-77809625 ATGGCGTGAACCCCAGGGGGCGG + Intronic
992629937 5:78670114-78670136 ATGGCGTGAACCTCGGGAGGCGG - Intronic
992813325 5:80411051-80411073 ATCGCTTGAACCCCAGGAGGCGG - Intronic
992844260 5:80729327-80729349 ATGGCGTGAACCCAGGGAGGTGG + Intronic
993033043 5:82726755-82726777 ACGGCGTGAACCCCGGGGGGCGG + Intergenic
993887987 5:93439378-93439400 ATGGCGTGAACCCCGGGGGGCGG - Intergenic
993976863 5:94493572-94493594 ATGGCGTGAACCCGGCGGGGTGG - Intronic
994159628 5:96542222-96542244 ATGGCGTGAACCCCGGGGGGCGG + Intronic
994182397 5:96782094-96782116 ATGGCGTGAACCCGGGAGGGCGG - Intronic
994194944 5:96912102-96912124 ATGGTGTGAACCCCGGGGGGCGG + Intronic
994513614 5:100741421-100741443 ATGGCATGAACCCAGGGGGGCGG - Intergenic
994759094 5:103830947-103830969 ATGGTGTGAACCCGGGAGGCGGG + Intergenic
994814575 5:104568717-104568739 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
994933333 5:106218143-106218165 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
995181689 5:109235759-109235781 ATGGCGTGAACCTCGGGGGGCGG + Intergenic
995359773 5:111281970-111281992 ATGGCGTGAACCCCAGGGGGCGG + Intronic
995813298 5:116134705-116134727 ATGGCGTGAACCCCAGGGGGCGG - Intronic
995880790 5:116842399-116842421 ATGGCGTGAACCCCGGAGGGCGG + Intergenic
995895769 5:117008631-117008653 ATGGCGTGAACCCCAGGAGACGG - Intergenic
996064436 5:119066093-119066115 ATGGTGTAAAACCCGGGAGGTGG - Intronic
996081402 5:119261981-119262003 GTGGTGGGAAGCCCAGAGGGAGG - Intergenic
996133137 5:119807036-119807058 ATGGTGTAAACTCTGGGGGGTGG - Intergenic
996202569 5:120694596-120694618 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
996243370 5:121229421-121229443 ATGGCGTGAACCCCAGGGGGCGG - Intergenic
996733418 5:126737327-126737349 ATGGCGTGAATCCGAGGCGGAGG + Intergenic
996734303 5:126744310-126744332 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
996741012 5:126799102-126799124 ATGGCGTGAACCCCAGGGGGCGG - Intronic
996823121 5:127652594-127652616 TTGGTGTGAACCCTAAGGGAGGG + Intronic
996851392 5:127957162-127957184 ATAGTGTCAACCCCAGGAGGAGG - Intergenic
997082245 5:130753923-130753945 ATGGCGTGAACCCCAGGGGGCGG - Intergenic
997116401 5:131130389-131130411 ATGGCGTGAACCCCAGGGGGCGG - Intergenic
997413050 5:133704713-133704735 ATTGGGTACACCCCAGGGGGTGG - Intergenic
997421201 5:133768144-133768166 TGGGTGTGGACCCCAGGAGGAGG - Intergenic
997501237 5:134375711-134375733 ATGGCGTGAACCCCAGGGGGCGG + Intronic
997917577 5:137943657-137943679 ATTGCTTGAACCCCAGGAGGTGG + Intronic
997924026 5:138011503-138011525 ATGGCGTGAACCCGGGGAGGCGG - Intronic
997942949 5:138174973-138174995 ATGGTGTGAACCCAGGAGGCGGG - Intronic
997948192 5:138221030-138221052 ATGGCGTGAACCCCGGGGGGCGG - Intergenic
997982115 5:138474613-138474635 ATGGTGTGAACCCAGGAGGCAGG + Intergenic
998330103 5:141317764-141317786 ATGGTGTGAACCCAGGAGGCGGG + Intergenic
998631575 5:143904595-143904617 ATGGCGTGAACCCCGGGGGGCGG - Intergenic
998777044 5:145615410-145615432 ATGGCGTGAACCCCAGGGGGCGG - Intronic
999014298 5:148082693-148082715 ATGGCGTGAACCCCAGGGGGCGG - Intronic
999151077 5:149426683-149426705 ATGGTTTGAACCCGGGGAGGTGG - Intergenic
999528657 5:152437057-152437079 ATGGCATGAACCCAGGGGGGTGG - Intergenic
1000342532 5:160288742-160288764 ATGGCATGAACCCGGGGGGGCGG + Intronic
1000737214 5:164919775-164919797 ATGGCGTGAACCCCAGGGGGCGG - Intergenic
1000760934 5:165223702-165223724 ATGGCGTGAACCCTGGGAGGTGG - Intergenic
1000935231 5:167298515-167298537 ATGGCGTAAACCCCAGGGGGCGG + Intronic
1001068260 5:168558244-168558266 ATGGTGTGAACCCCAGGGGGCGG - Intronic
1001242376 5:170080452-170080474 ATGGTGTCACCCCCAGGAAGTGG - Intronic
1001318453 5:170661224-170661246 ATGATGTGAAGCACATGGGGGGG + Intronic
1001838697 5:174854643-174854665 ATGGTGTGAACCCCGGGAAGTGG - Intergenic
1002103328 5:176868120-176868142 ATGGTGGGCAGCCCTGGGGGCGG - Exonic
1002404595 5:179020483-179020505 ATGGCGTGAACCCCGGGGGGCGG - Intergenic
1002514572 5:179747722-179747744 ATGGCGTGAACCCCGGGAGGCGG + Intronic
1002530662 5:179842612-179842634 ATGGTGTGAACCCGGGAGGCGGG + Intronic
1002725243 5:181290248-181290270 ATTGTTTGAACCCAGGGGGGCGG - Intergenic
1002989091 6:2221472-2221494 ATGGTGTGAACCCGGGAGGCCGG - Intronic
1004142634 6:13034101-13034123 ATGGCGTGAACCCCAGGGGGCGG - Intronic
1004469055 6:15912282-15912304 AGGGTGTGAATACCAGGAGGTGG + Intergenic
1004669195 6:17779824-17779846 ATGGTGTGAACCCCAGGGGGCGG - Intronic
1005156644 6:22814572-22814594 ATGGCGTGAACCCCAGGGGGCGG - Intergenic
1005480098 6:26247462-26247484 ATGGCATGAACCCCGTGGGGTGG + Intergenic
1005897160 6:30188131-30188153 ATGGCGTGAACCCCAGGAGGCGG + Intronic
1005983268 6:30853725-30853747 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
1006024663 6:31139278-31139300 AGGGTGTGAAAACCAGGGTGGGG - Exonic
1006325527 6:33350978-33351000 ATTGCTTGAACCCCAGGAGGTGG - Intergenic
1006597516 6:35204147-35204169 ATGGTGTGAACCCCAGGAGGCGG - Intergenic
1007372598 6:41436430-41436452 ATGGCGTGAACCCCAGGGGGCGG - Intergenic
1007460441 6:42014279-42014301 ATGGCGTGAACCCCGGGGGGCGG + Intronic
1007579148 6:42945657-42945679 ATGGTGTGAACCCAAGGAGGCGG - Intergenic
1007580368 6:42955520-42955542 ATGGTGTGAACCCTGGGGGACGG - Intergenic
1007586844 6:42995945-42995967 ATGGCGTGAACCCCGGGGGGCGG - Intronic
1007888134 6:45256083-45256105 ATGGTGTGAACCCGGGAGGCGGG + Intronic
1008009944 6:46455768-46455790 ATGGCGTGAACCCAAGGAGGTGG + Intronic
1008739850 6:54593881-54593903 ATGGTGTGAACCTCAGGAGGTGG - Intergenic
1008980171 6:57474259-57474281 ATGGCATGAACCCCGGGAGGCGG - Intronic
1008985927 6:57543023-57543045 ATGGCGTGAAGCCCAGGGGGCGG - Intronic
1009168273 6:60367190-60367212 ATGGCATGAACCCCGGGAGGCGG - Intergenic
1009177788 6:60481841-60481863 ATGGCGTGAACCCCAGGGGGCGG - Intergenic
1009413257 6:63390771-63390793 ATGGCGTGAACCCCGGGGGACGG + Intergenic
1009763229 6:68035881-68035903 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
1009821444 6:68807322-68807344 ATGGCGTGAACCCCGCGGGGCGG - Intronic
1010178670 6:73058324-73058346 ATGGCGTGAACCCCGGGGGGCGG + Intronic
1010243764 6:73643244-73643266 ATGGTGTGAACCCCAAGGGGTGG - Intronic
1010257251 6:73772417-73772439 ATGGCATGAATCCCAGGAGGCGG + Intronic
1010280029 6:74013094-74013116 ATGGCGTGAACCCCAGTGGGCGG - Intergenic
1010329060 6:74600639-74600661 ATGGCGTGAACCCCGGGGGGTGG - Intergenic
1010347383 6:74827478-74827500 ATGGCGTGAACCCGGGGGGGTGG - Intergenic
1010900982 6:81427235-81427257 ATGGCGTGAACCCCAAGGGGCGG - Intergenic
1011037869 6:82997631-82997653 ATGGTGTGAACCCAGGAGGCGGG + Intronic
1011486128 6:87844063-87844085 ATGGCGTGAACCCGGGGAGGCGG - Intergenic
1011683465 6:89804948-89804970 ATGGTGTGAACCCCGGGAGGCGG + Intronic
1011767529 6:90639123-90639145 ATGGTGTCAATCTCAGGGTGTGG + Intergenic
1012026124 6:93994331-93994353 ATAGCTTGAACCCCAGGAGGTGG - Intergenic
1012317743 6:97800726-97800748 ATGGCGTGAACCCCAGGGGATGG + Intergenic
1012513042 6:100026619-100026641 ATGGCGTGAACCCCAGGGGGCGG - Intergenic
1012707529 6:102550836-102550858 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
1013350695 6:109303012-109303034 ATGGTGTGAACCCGGGAGGCGGG + Intergenic
1014585600 6:123194121-123194143 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
1015249074 6:131107732-131107754 ATAGCTTGAACCCCAGGAGGTGG + Intergenic
1015363884 6:132375509-132375531 ATGGCGTGAACCCTGGGAGGTGG - Intronic
1015468344 6:133573690-133573712 ATGGCGTGAACCCCGGGGGGCGG + Intergenic
1015667211 6:135645180-135645202 ATGGCGTGAACCCCGGGGGGCGG + Intergenic
1015752516 6:136574773-136574795 ATGGCATGAACCCCAGGGGGTGG - Intronic
1016022726 6:139252903-139252925 ATGGCGTGAACCCCGGGAGGTGG + Intronic
1016265856 6:142232153-142232175 ATTGCTTGAACCCCAGGAGGTGG + Intergenic
1016330461 6:142947352-142947374 CTGGTGTGCACCCTCGGGGGAGG + Intergenic
1016723830 6:147335712-147335734 ATGGCGTGAACCCCAGGGGGCGG + Intronic
1017074302 6:150602993-150603015 ATGGCGTGAACCCCGGGGGGCGG + Intronic
1017372465 6:153728771-153728793 ATGGCGTGAACCCCGGGGGGCGG - Intergenic
1018033523 6:159863026-159863048 AAGGTGTGTACACCAGGGGGTGG + Intergenic
1018332704 6:162748405-162748427 ATCGCTTGAACCCCAGGAGGCGG + Intronic
1018524189 6:164689643-164689665 ATGGTGTGAAACCCGGGAGGCGG - Intergenic
1018921402 6:168178373-168178395 CTGCTGTGGCCCCCAGGGGGAGG - Intergenic
1018997127 6:168718683-168718705 ATGGTGTGACCCGAAGTGGGTGG + Intergenic
1019020103 6:168911199-168911221 ACGGTTTGAGCCCCAGGAGGTGG + Intergenic
1019210764 6:170402669-170402691 ATGGCGTGAACTCCAGGTGTAGG + Intronic
1019393015 7:800326-800348 ATGGTGTGAACCTTGGGAGGTGG - Intergenic
1019506665 7:1394913-1394935 GTGGTGTGAACCCCAGGAAGTGG + Intergenic
1019672165 7:2286602-2286624 ATGGCGTGAACCCCGGGAGGTGG - Intronic
1019686665 7:2385556-2385578 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
1019718132 7:2551152-2551174 ATCGTTTGAAACCCAGGAGGCGG + Intronic
1019771256 7:2884962-2884984 ATGGCCTGAACCCCGGGGGGCGG - Intergenic
1019988228 7:4673772-4673794 ATGGCGTGAACCCTGGGGGGCGG + Intergenic
1020052637 7:5092158-5092180 ATGGCGTGAACCCCGGGGGGCGG - Intergenic
1020126544 7:5535934-5535956 ATGGCGCGAACCCAGGGGGGTGG - Intronic
1020155700 7:5722474-5722496 ATGGCGTGAACCCCGGGGGGCGG - Intronic
1020321894 7:6944863-6944885 ATGGCATGAACCCCGGGAGGTGG + Intergenic
1020365234 7:7373783-7373805 ATGGCGTGAATCCCAGGGGACGG - Intronic
1020401586 7:7784846-7784868 ATGGCGTGAACCCCAGGGGGCGG - Intronic
1020585423 7:10059940-10059962 ATGGCGTGAACCCCAGGGGGCGG - Intergenic
1020610105 7:10385160-10385182 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
1020796014 7:12679595-12679617 ATTGCTTGAACCCCAGGAGGTGG - Intergenic
1021692486 7:23243861-23243883 ATGGCGTGAACCCTGGGGGGCGG + Intronic
1021736878 7:23648107-23648129 ATGGTGTGAACCCAGGTGGTGGG - Intergenic
1022004217 7:26252265-26252287 ATGGCGTGAACCCCAGGGGGTGG + Intergenic
1022011388 7:26310766-26310788 ATGGCGTGAACCCCAGGAGGCGG - Intronic
1022081247 7:27024046-27024068 ATGGCGTGACCCCCGGGAGGCGG + Intergenic
1022164518 7:27744209-27744231 ATGGCGTGAACCCTGGGGGGCGG - Intronic
1022731504 7:33031011-33031033 ATGGCATGAACCCCGGGGGGCGG + Intronic
1022786233 7:33640267-33640289 ATGGTGGTCACCCCTGGGGGTGG - Intergenic
1023961261 7:44928186-44928208 ATGGTGTGAACCCTGGGTGGTGG + Intergenic
1024275840 7:47676318-47676340 ATGGCATGAACCCTAGAGGGTGG - Intergenic
1024357130 7:48425825-48425847 ATGGCGTGAACCCCAGGGGGCGG - Intronic
1024480498 7:49856921-49856943 ATGGTGTGAACCTGGGGAGGTGG + Intronic
1024545023 7:50510055-50510077 ATGGCCTGAACCCCGGGAGGCGG - Intronic
1024780050 7:52837175-52837197 ATGGTGTGAACCCCGGAGGCGGG + Intergenic
1025091147 7:56065104-56065126 ATGGCGTGAACCCCGGGGGGTGG + Intronic
1025939033 7:66060315-66060337 ATGGCGTGAACCCCGGGGGGTGG + Intergenic
1025961077 7:66222297-66222319 ATGGCATGAACCCCGGGAGGTGG + Intronic
1025993349 7:66512494-66512516 AGGATGTGCACCCCAGGAGGTGG - Intergenic
1025993441 7:66513053-66513075 AGGATGTGTACCCCAGGAGGTGG - Intergenic
1026035813 7:66829926-66829948 AGGATGTGTACCCCAGGAGGTGG + Intergenic
1026037251 7:66838516-66838538 AGGATGTGAACTCCAGGAGGTGG + Intergenic
1026208204 7:68278063-68278085 ATGGTGTAAAACCCGGGAGGCGG - Intergenic
1026329491 7:69339246-69339268 ATGGCATGAACCCCGGGGGGCGG + Intergenic
1026470354 7:70689688-70689710 ATGGTGTGAACCCGGGAGGCGGG + Intronic
1026570990 7:71530651-71530673 ATGGTGTGAACCCAGGAGGCAGG - Intronic
1026983596 7:74540602-74540624 AGGATGTGCACCCCAGGAGGTGG - Intronic
1027247157 7:76375000-76375022 AAGGTGTGAGCCCCAGCGGCTGG + Intergenic
1027256362 7:76433238-76433260 ATCGTTTGAACCCCAGGAGGTGG - Intronic
1027450923 7:78330529-78330551 ATGGCGTGAACCCCAGGGGGCGG + Intronic
1027780510 7:82514366-82514388 ATGGCGTGAACCCAGCGGGGCGG + Intergenic
1027925317 7:84453320-84453342 ATGGCGTGAACCCCAGGGGGCGG - Intronic
1028026166 7:85843367-85843389 ATGGCGTGAACCCCGGGGGGCGG + Intergenic
1028054985 7:86230129-86230151 ATGGCGTGAACCCCAGGGGGCGG - Intergenic
1028511644 7:91631751-91631773 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
1028701228 7:93783157-93783179 ATGGCGTGAACCCCGGGGGGTGG - Intronic
1028713423 7:93936861-93936883 ATGGCGTGAACCCCAGGGGGTGG + Intergenic
1029129230 7:98317626-98317648 ATGGTGTGAACTGCAGGGTGAGG - Intronic
1029129275 7:98317867-98317889 ATGGTGTGAACTGCAGAGTGAGG - Intronic
1029320993 7:99759919-99759941 ATGGCATGAACCCCAGGGAGCGG - Intronic
1029514988 7:101018488-101018510 GAGGAGGGAACCCCAGGGGGAGG - Intronic
1029807803 7:103014835-103014857 ATGGCATGAACCCCGGGGGGCGG + Intronic
1029842925 7:103385246-103385268 ATGGTGTGAACCCGGGGAGGCGG - Intronic
1030103762 7:105969311-105969333 ATGGCGTGAACCCCAGGGGGCGG + Intronic
1030443056 7:109613163-109613185 ATGGCCTGAACCCAGGGGGGCGG - Intergenic
1030941109 7:115650791-115650813 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
1031151203 7:118056239-118056261 ATGACGTGAACCCCGGGGGGCGG + Intergenic
1031240107 7:119227253-119227275 ATTGCTTGAACCCCAGGAGGAGG - Intergenic
1031456063 7:121981054-121981076 ATGGCGTGAACCCTGGGGGGCGG + Intronic
1031523834 7:122799515-122799537 ATGGCGTGAACCCCGGGAGGTGG + Intronic
1032225772 7:130030752-130030774 ATGGTGTGAACCCCAGGAGGCGG - Intronic
1032254318 7:130284856-130284878 ATGGCGTGAACCCCGGGGGGTGG + Intronic
1032346543 7:131121550-131121572 ATAGCATGAACCCCTGGGGGCGG + Intronic
1032604211 7:133331549-133331571 ATGGCATGAACCCCAGGGGGCGG - Intronic
1032672676 7:134099614-134099636 ATGGCATGAACCCCGGGGGGCGG - Intergenic
1032966208 7:137101661-137101683 ATGGCGTGAACCCCGGGGGGCGG - Intergenic
1033018238 7:137694233-137694255 ATGGCATGAACCCCAGGGGGCGG + Intronic
1033051764 7:138010893-138010915 ATGGTGTGAACCCTGGGGGGCGG + Intronic
1033333630 7:140434828-140434850 ATGGCGTGAACCCCGGGGGGCGG + Intergenic
1033398631 7:141000286-141000308 ATGGCGTGAACCCCAGGGGGCGG - Intergenic
1033473587 7:141669894-141669916 ATGGCGTGAACCCCAGGGGGCGG - Intronic
1033920117 7:146380882-146380904 ATGGCGTGAACCCCAGGGGGCGG - Intronic
1034001173 7:147414853-147414875 ATGGCGTGAACCTTGGGGGGTGG + Intronic
1034147635 7:148886162-148886184 ATGGTGTGAACCCGGGAGGCGGG - Intergenic
1034628486 7:152512427-152512449 ATGGCGTGAAACCCGGGAGGCGG + Intergenic
1034896496 7:154879502-154879524 ATGGCGTGAACCCCAGGGGGCGG + Intronic
1035046366 7:155970006-155970028 ATCGCTTGAACCCCAGGAGGTGG - Intergenic
1035214497 7:157355244-157355266 ACGGCGTGAACCCCGGGAGGCGG - Intronic
1035385461 7:158469353-158469375 ATCGTTTGAACCCCAGGAGGGGG + Intronic
1035450120 7:158972611-158972633 ATGGTGTGAACCCCGGGGGGTGG - Intergenic
1035548362 8:501117-501139 ATGGCGTGAACCCGAGGAGGTGG + Intronic
1035833503 8:2724235-2724257 ATGGTGTGAACCCCGGGGGACGG + Intergenic
1036140709 8:6205554-6205576 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
1036169813 8:6472550-6472572 ATGGCTTGAAACCCAGGAGGCGG - Intronic
1036197245 8:6730414-6730436 ATGGCGTGAACCCCAGGGGGCGG - Intronic
1036567097 8:9946982-9947004 AGGGTGTGAATACCAGGAGGCGG + Intergenic
1036601996 8:10269735-10269757 ATGGCGTGAACCCCGGGAGGTGG - Intronic
1036973552 8:13382419-13382441 ATGGCGTGAACCCCAGGGGGCGG + Intronic
1036985451 8:13523875-13523897 ATGGTATGTTCCCAAGGGGGAGG + Intergenic
1037276514 8:17185582-17185604 ATTGCTTGAGCCCCAGGGGGCGG + Intronic
1037301635 8:17457518-17457540 ATGGTGTGAACCCAGGTAGGAGG + Intergenic
1037653610 8:20863699-20863721 AAGGTGTGAATACCAGGAGGTGG + Intergenic
1037771854 8:21805931-21805953 AAGGTTTGAGCCCCAGAGGGTGG + Intronic
1037796021 8:21995899-21995921 ATGGCGTGAACCCAGGGGGATGG - Intronic
1037953311 8:23033499-23033521 ATGGCGTGAAACCCAGGGGCCGG + Intronic
1038417958 8:27411375-27411397 ATGGTGTGAATTCAGGGGGGTGG - Intronic
1038548476 8:28444561-28444583 ATGGCGTGAACCCAGGGCGGAGG - Intronic
1038563479 8:28600253-28600275 ATCGCTTGAACCCCAGGAGGCGG + Intergenic
1038617066 8:29104828-29104850 ATGGCGTGAACCACGGGGGGCGG - Intronic
1038617405 8:29107644-29107666 ATGGTGTGAACCCCGGGGGGCGG - Intronic
1038803523 8:30770394-30770416 ATGGCATGAACCCCGGGAGGCGG + Intergenic
1038864457 8:31424411-31424433 ATCGCTTGAACCCCAGGAGGTGG + Intergenic
1039226415 8:35393217-35393239 ATGGCATGAACCCCAGGGGGCGG - Intronic
1039699037 8:39943649-39943671 ATGGCGTGAACCCCGGGGGGCGG + Intronic
1039746262 8:40430895-40430917 ATGGCGTGAACCCCGGGGGGTGG - Intergenic
1039856798 8:41422019-41422041 ATGGCGTGAAGCCCAGGGGGCGG + Intergenic
1040354886 8:46608011-46608033 ATGGCGTGAACCCTGGGGGGCGG + Intergenic
1040870996 8:52100350-52100372 GTGGTGTGCACCCCAGGCAGGGG + Intergenic
1041365301 8:57096540-57096562 ATGGCATGAACCCGGGGGGGCGG - Intergenic
1042069866 8:64920184-64920206 ATGGCATGAACCCCGGGGGGCGG - Intergenic
1042503750 8:69538045-69538067 ATGGCGTGAACCCCGGGGGGCGG - Intronic
1042673785 8:71294371-71294393 ATGGCGTGAACCCCGGGGGGCGG + Intronic
1042728760 8:71908031-71908053 ATGGCATGAACCCCAGGGGGCGG - Intronic
1042865159 8:73350496-73350518 ATGGCGTGAACCCCGGGGGGCGG - Intergenic
1042891977 8:73622210-73622232 ATGGCGTGAACCCCAGGGGGCGG - Intronic
1042908774 8:73802935-73802957 ATGGTGTGAACCCTGGGAGGTGG + Intronic
1042975929 8:74469580-74469602 ATGGCGTGAACCCCGGGGAGCGG + Intronic
1043197582 8:77317517-77317539 ATGGCGTGAACCCGGGAGGGAGG - Intergenic
1043295075 8:78652368-78652390 ATGGTTAGACCCCCAGGTGGAGG + Intergenic
1043317304 8:78938544-78938566 ATGGTGTGAACCCTGGGAGGTGG - Intergenic
1043338424 8:79206770-79206792 ATGGTGTGAACCCCAGGGGGCGG - Intergenic
1043461478 8:80464563-80464585 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
1043568878 8:81578912-81578934 ATGGCGTGAACCCGGGAGGGAGG - Intergenic
1044366890 8:91358413-91358435 ATGGCATGAACCCAAGGAGGTGG - Intronic
1044789989 8:95837495-95837517 ATGGCGTGAACCCGCGGGGGCGG - Intergenic
1044992296 8:97806869-97806891 ATTGCTTGAACCCCAGGTGGCGG + Intronic
1045127024 8:99103583-99103605 ATGGTGTGAACCCGGGGAGGTGG - Intronic
1045148254 8:99372163-99372185 ATGGCGTGAACCCCAGGGGGCGG + Intronic
1045501655 8:102748391-102748413 ATGGCATGAACCCGAGGGGGCGG + Intergenic
1045765152 8:105658500-105658522 ATGGCGTGAACCCCAGGGGGCGG + Intronic
1045792923 8:106007066-106007088 ATGGCGTGAAGCCCGAGGGGCGG - Intergenic
1046233548 8:111391015-111391037 ATGGTGTGAACCCAGGAGGTGGG + Intergenic
1046793744 8:118348455-118348477 ATGGCACGAACCCCGGGGGGCGG - Intronic
1046835975 8:118801548-118801570 ATGGCGTGACCCCCGGGAGGCGG + Intergenic
1046957246 8:120074400-120074422 ATTGCTTGAACCCCAGGGGATGG - Intronic
1047001533 8:120578117-120578139 ATGGCGTGAACCCCAGGAGGCGG - Intronic
1047082743 8:121481893-121481915 AATGGGTGAACCCCGGGGGGCGG - Intergenic
1047166127 8:122440381-122440403 ATGGTGTGAACCCAGGGGGGCGG + Intergenic
1047215708 8:122874417-122874439 ATTGCTTGAACCCCAGGAGGCGG - Intronic
1047294141 8:123556420-123556442 ATGGCTTGAACCCCGGGAGGCGG - Intergenic
1047376301 8:124300710-124300732 ATGGCGTGAACCCCAGGGGGCGG - Intergenic
1047416267 8:124667099-124667121 ATGGGGGGAAACCCAGGGCGTGG - Intronic
1047591853 8:126335457-126335479 ATGGTGTGAACCCAGGGGGCAGG + Intergenic
1047704808 8:127487493-127487515 ATGGCGTGAACCCCAGGGGGCGG - Intergenic
1048208766 8:132437191-132437213 ATGGCGTGAACCCCAGGGGGCGG + Intronic
1048560403 8:135529963-135529985 ATGGTGTGAAACCCGGGAGGTGG + Intronic
1049019799 8:139948331-139948353 AGGGTGTGAACACCAGGGCAGGG - Intronic
1049534592 8:143172533-143172555 ATGGTGTGAACCCAGGAGGTTGG + Intergenic
1049626713 8:143626578-143626600 ATGGCGTGAACCCCGGGGGGCGG - Intergenic
1049705086 8:144038039-144038061 ATGGCGTGAACCCCGGGGGGCGG + Intronic
1049761677 8:144334487-144334509 GTGGGGAGAACCCGAGGGGGAGG - Intronic
1049947325 9:609541-609563 ATCATTTGAACCCCAGGAGGTGG + Intronic
1050516645 9:6451561-6451583 ATGGTGTGAACCCCGGGGGGCGG - Intronic
1050760097 9:9058533-9058555 ATGGCGTGAACCCCAGGGGGCGG - Intronic
1050826289 9:9950636-9950658 ATGGCGTGAACCCCAGGGGGCGG + Intronic
1051203470 9:14658555-14658577 ATGGCGTGAACCCCAGGGGGCGG - Intronic
1051497979 9:17746159-17746181 ATGGTGTGAACACAGCGGGGCGG - Intronic
1051720724 9:20034550-20034572 ATGGAGTGAACCCGGGGTGGGGG - Intergenic
1051979784 9:22999698-22999720 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
1052085705 9:24263260-24263282 ATGGCGTGAACCCCAGGGGGCGG - Intergenic
1052309746 9:27052947-27052969 ATGGCGTGAACCCCTGGGGGCGG - Intronic
1052426666 9:28314018-28314040 ATGGCGGGAACCCCGCGGGGTGG - Intronic
1052509586 9:29398645-29398667 ATGGCGTGAACCCGAGAGGCTGG - Intergenic
1052762165 9:32603638-32603660 ATGGCGTGAACCCCGGGGGGCGG + Intergenic
1052785971 9:32828654-32828676 ATGGCGTGAACCCCTGGGGGCGG + Intergenic
1052851105 9:33378933-33378955 ATGGCGTGAACCCCAGGGGGCGG - Intergenic
1053177434 9:35937985-35938007 ATGGCATGAACCCAAGGAGGCGG + Intergenic
1053229185 9:36391697-36391719 ATGGCGTGAACCCCAGTGGGTGG - Intronic
1053370938 9:37561054-37561076 ATGGTGTGAACCCAGGAGGCGGG + Intronic
1053506802 9:38650158-38650180 AGGGAGTGAATGCCAGGGGGTGG + Intergenic
1053522823 9:38798143-38798165 ATGGCGTGAACCCTGGGAGGTGG + Intergenic
1053571242 9:39310216-39310238 ATGGCGTGAACCCCGGGGGGCGG - Intergenic
1053592595 9:39529116-39529138 ATGGCGTGAACCCCGGGGGGCGG + Intergenic
1053613126 9:39735182-39735204 ATGGTGTGAACCCCGGGAGGCGG + Intergenic
1053673022 9:40388940-40388962 ATGGCGTGAACCCAGGGGGGCGG - Intergenic
1053871169 9:42493126-42493148 ATGGTGTGAACCCCGGGAGGCGG + Intergenic
1053922832 9:43015308-43015330 ATGGCGTGAACCCAGGGGGGCGG - Intergenic
1054092808 9:60868908-60868930 ATTGCGTGAACCCCGGGGGGCGG - Intergenic
1054114280 9:61144820-61144842 ATGGCGTGAACCCCGGGGGGCGG - Intergenic
1054125903 9:61308796-61308818 ATGGCGTGAACCCCGGGGGGCGG + Intergenic
1054195047 9:62022563-62022585 ATGGCGTGAACCCTGGGAGGTGG + Intergenic
1054240390 9:62607220-62607242 ATGGTGTGAACCCCGGGAGGCGG - Intergenic
1054511603 9:65987343-65987365 ATGGCATGAACCCAGGGGGGCGG + Intergenic
1054554523 9:66641742-66641764 ATGGTGTGAACCCCGGGAGGCGG - Intergenic
1054573707 9:66836164-66836186 ATGGCGTGAACCCCGGGGGGCGG - Intergenic
1054593473 9:67037702-67037724 ATGGCGTGAACCCCGGGGGGCGG + Intergenic
1054643361 9:67566127-67566149 ATGGCGTGAACCCTGGGAGGTGG - Intergenic
1054823513 9:69547837-69547859 TTGGTAGGAACCCCAGGTGGTGG - Intronic
1055060895 9:72067544-72067566 ATGGCGTGAAACTCAGGAGGCGG + Intronic
1055310383 9:74973411-74973433 ATCGCTTGAACCCCAGGAGGTGG + Intergenic
1055455293 9:76466386-76466408 ATGGCATGAGCCCCAGAGGGTGG - Intronic
1055536678 9:77254027-77254049 ATGGTGTGAACCCTGGGGGGCGG - Intronic
1055959682 9:81808577-81808599 ATGGCGTGAACCCCGGAGGCGGG - Intergenic
1056080372 9:83086957-83086979 AAGGTGTGAATCCCAGGAGTTGG + Intergenic
1056107713 9:83363638-83363660 ATGGCGTGAACCCCGGGGGGCGG - Intronic
1056306987 9:85300171-85300193 ATGGTGTGAACATCAGGAGAAGG + Intergenic
1056330930 9:85520446-85520468 ATGGCGTGAACCCCGGGAGGTGG + Intergenic
1056387200 9:86106866-86106888 ATGGTGTGAACCCAGGAGGGCGG + Intergenic
1056405361 9:86268879-86268901 ATCGCTTGAACCCCAGGAGGCGG - Intronic
1056498410 9:87184273-87184295 ATGGCGTGAACCCCAGGGGGCGG - Intergenic
1056741071 9:89255679-89255701 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
1056745252 9:89295996-89296018 ATGGCGTGAACCCCGGGAGGCGG + Intergenic
1056811583 9:89769265-89769287 ATGGCCTGAACCCCCGGGGGCGG - Intergenic
1056847500 9:90053637-90053659 ATGGTGGGAAGGCCAGGGGCAGG - Intergenic
1056960786 9:91121183-91121205 ATGGCGTGAACCCCAGGGGGCGG - Intergenic
1057032978 9:91792392-91792414 ATGGTGTGAACCCGGGAGGCGGG - Intronic
1057203005 9:93153354-93153376 ATGGTGTGAACCTGGGGAGGCGG - Intergenic
1057352642 9:94312542-94312564 ATGGTGTGAACCCGGGAGGTAGG + Intergenic
1057401254 9:94725787-94725809 ATGGCGGGAACCCCGGGGGGCGG - Intergenic
1057501693 9:95601481-95601503 ATGGCGTGAACCCCCGGGGGCGG + Intergenic
1057778051 9:98026949-98026971 ATGGCGTGAACTCCAGGGGGCGG - Intergenic
1057874023 9:98739839-98739861 ATGGCGTGAACCCCAGGGGGCGG - Intronic
1058328077 9:103723602-103723624 ATGGCGTGAACCCCAGGGGGCGG - Intergenic
1058337409 9:103848374-103848396 AAAGTGTGAACACCAGGAGGTGG - Intergenic
1058562695 9:106246683-106246705 ATGGCATGAACTCCAGCGGGCGG - Intergenic
1058782593 9:108353082-108353104 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
1058843154 9:108930602-108930624 ATGGTGTGAACCCGGGGAGGCGG + Intronic
1058895090 9:109393470-109393492 ATCGCTTGAACCCCAGGGGATGG - Intronic
1059043423 9:110839218-110839240 ATGGTGTGAACCCGGGAGGTGGG + Intergenic
1059125722 9:111682994-111683016 ATGGCGTGAACCCGGGGAGGCGG - Intergenic
1059187418 9:112287424-112287446 ATTGCTTGAACCCCCGGGGGCGG - Intronic
1060079961 9:120634539-120634561 ATGGCGTGAACCCCAGGGGGCGG - Intronic
1060084528 9:120684918-120684940 ATGGCGTGAACCCTGGGAGGTGG - Intronic
1060559819 9:124533734-124533756 ATGGCGTGAACCCAGGGAGGTGG - Intronic
1060988313 9:127833433-127833455 ATCGCTTGAACCCCAGGAGGCGG + Intronic
1061131223 9:128709197-128709219 ATGGCGGGAACCCCGGGGGGCGG + Intronic
1061315291 9:129791994-129792016 ATGGCGTGAACCCCAGGAGGTGG - Intergenic
1061351932 9:130072303-130072325 ATGGCGTGAACCCCAGGGGGCGG - Intronic
1061389700 9:130310629-130310651 TGGGTGTGAACACCAGGAGGCGG + Intronic
1061511595 9:131064575-131064597 ATGGCGTGAACCCCGGGGGGCGG + Intronic
1061581895 9:131542955-131542977 ATGGCGTGATCCCCTGGGGGTGG - Intergenic
1061991683 9:134162909-134162931 ATGGGGTGACCCCGAGGGGAGGG + Intergenic
1062156813 9:135053803-135053825 ATGGTATAAACCCCAGGCCGAGG - Intergenic
1062207890 9:135347251-135347273 ATGGGCTGACCCCCTGGGGGAGG - Intergenic
1062244347 9:135556808-135556830 ATGGCGTGAACCCCGGAAGGCGG - Intergenic
1062376295 9:136263318-136263340 ATGGCATGAACCCCGGGGGGCGG - Intergenic
1062420783 9:136481219-136481241 ATGGCGTGAACCCCGGGGGGCGG - Intronic
1062505629 9:136874066-136874088 ATGGTGTGAACCCTGGGGGGCGG + Intronic
1186041775 X:5487092-5487114 ATCGCTTGAACCCAAGGGGGAGG - Intergenic
1186094299 X:6083042-6083064 ATGGCGTGAACCCCAGGGGGCGG - Intronic
1186692306 X:11991228-11991250 CTTGTGTGAACACCAGGAGGTGG + Intergenic
1186845076 X:13522577-13522599 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
1187008619 X:15256689-15256711 ATGGCGTGAACCCCAGGGGGCGG + Intronic
1187137542 X:16562635-16562657 ATGGCATGAACCCCGGGGGGCGG - Intergenic
1187234913 X:17458312-17458334 ATCACTTGAACCCCAGGGGGCGG - Intronic
1187258678 X:17665411-17665433 ATGGCGTGAACCCCAGGGGGCGG - Intronic
1187305535 X:18092018-18092040 ATTAGGTGAACCCCAGGGGATGG - Intergenic
1187549090 X:20283388-20283410 ATGGTGTGAACCCGGGAGGCGGG - Intergenic
1187798414 X:23030920-23030942 AGGCTGTGAACACCAGGAGGCGG - Intergenic
1187860878 X:23681144-23681166 ATGGCGTGAACCCTGGGGGGCGG + Intronic
1188030720 X:25260479-25260501 AGGGTGTGAACAACAGGAGGTGG + Intergenic
1188314523 X:28656938-28656960 ATGGCATGAACCCCGGGAGGCGG + Intronic
1188499518 X:30810252-30810274 ATGGCGTGAACCCCAGGGGGCGG - Intergenic
1188917103 X:35925286-35925308 ATGGCGTGAACCCCAGGGGGCGG + Intronic
1188948451 X:36337953-36337975 ATGGCGTGAACCCCAGGAGGCGG - Intronic
1189591676 X:42518852-42518874 AAGGTATGAACTCCAGGGGTTGG + Intergenic
1189913778 X:45836997-45837019 ATCGCTTGAACCCCGGGGGGCGG + Intergenic
1190451147 X:50581988-50582010 GGGGTGTGAACACCAGGAGGTGG - Intergenic
1190499316 X:51059558-51059580 ATGGCGGGAACCCCAGGGGGCGG - Intergenic
1190725559 X:53188308-53188330 AAGGTGTGAATACCAGGAGGCGG - Intergenic
1190788010 X:53671705-53671727 ATGGCGTGAACCCCGGGGGGCGG + Intronic
1190844021 X:54174335-54174357 AGGGTGTGAATACCAGGAGGTGG + Intronic
1191887925 X:65908404-65908426 ATGGTGTGAACCCTGGGGGACGG - Intergenic
1192224772 X:69220728-69220750 ATGGTGTGAACCCCGGGAAGTGG + Intergenic
1192581505 X:72286534-72286556 ATGGCGTGAACCCCGGGGGGCGG - Intronic
1192636138 X:72820602-72820624 ATGGCGTGAACCCCAGGGGGCGG - Intronic
1192645576 X:72900212-72900234 ATGGCGTGAACCCCAGGGGGCGG + Intronic
1192975195 X:76275870-76275892 ATGGCATGAACCCCAGGGGGCGG + Intergenic
1193418768 X:81257773-81257795 AGGGAGTGAACACCAGGAGGTGG + Intronic
1193517457 X:82486020-82486042 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
1193519098 X:82507283-82507305 ATGGCGTGAACCCCGGGAGGTGG - Intergenic
1193597223 X:83461460-83461482 ATGGCGTGAACCCGGGGAGGCGG + Intergenic
1193683187 X:84546825-84546847 ATAGTGTGAACCCTGGGGGGCGG + Intergenic
1194380551 X:93185741-93185763 ATGGTATGAACACTAGGAGGTGG + Intergenic
1194525384 X:94970761-94970783 ATGGCGTGAACCCCGGGAGATGG - Intergenic
1195253725 X:103073845-103073867 ATTGCTTGAACCCCAGGAGGTGG - Intergenic
1195265288 X:103173723-103173745 ATGGCGTGAACCCAAGGGGGCGG - Intergenic
1195445781 X:104950791-104950813 ATGACGTGAACCCCAGGGGGCGG - Intronic
1195671077 X:107470666-107470688 AGGGTGTGAACATCAGGAGGTGG + Intergenic
1195941523 X:110171812-110171834 TTGTTGTGGACCCCATGGGGAGG + Intronic
1196782594 X:119397159-119397181 ATGGCGTGAACCCTGGAGGGCGG - Intergenic
1196911955 X:120492865-120492887 ATGGCATGAACCCCGGGGGGCGG - Intergenic
1196926639 X:120640045-120640067 ATGGCATGAACCCCGGGGGGCGG + Intergenic
1197039164 X:121914574-121914596 AAGATGTGAAACCCAGGGTGTGG - Intergenic
1197718412 X:129727241-129727263 ATGGTGTCAAGGCAAGGGGGAGG + Intergenic
1198069212 X:133131382-133131404 AGGGTGTGAACACCAGGAGTAGG - Intergenic
1198219312 X:134585258-134585280 ATCGCTTGAACCCCAGGAGGTGG + Intronic
1198692852 X:139302944-139302966 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
1198913113 X:141635960-141635982 ATTGCTTGAACCCCAGGCGGAGG - Intronic
1199050988 X:143236516-143236538 ATGGCGTGAACCCCGGGGGGCGG + Intergenic
1199110555 X:143928849-143928871 ATGGTGTGGAACCCGGGAGGCGG + Intergenic
1199779157 X:151042404-151042426 ATGGCGTGAACCCCGGGGGGCGG + Intergenic
1200130936 X:153845372-153845394 ACAGTGTGAACCCCTGGGGAGGG + Intergenic
1200268611 X:154660410-154660432 ACGGTGTCAGCCCCAGGGGTAGG - Intergenic
1200274679 X:154720538-154720560 ATGGCGTGAACCCCGGGGGGCGG + Intronic
1200319015 X:155165500-155165522 ATTGCTTGAACCCCAGGAGGTGG - Intergenic
1200806117 Y:7435372-7435394 ATGGTGTAAACCCAGGGGGACGG + Intergenic
1200887639 Y:8285666-8285688 ATGGCGTGAACCCCGGGAGGCGG - Intergenic
1200909815 Y:8521618-8521640 ATGGCGTGAACCCCAGGGGGCGG - Intergenic
1201015844 Y:9600587-9600609 ATGGCGTGAACCCCGGGGGACGG - Intergenic
1201513964 Y:14796506-14796528 ATGGCGTGAACCCCAGAGGGCGG + Intronic
1201614569 Y:15882885-15882907 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
1201615799 Y:15896890-15896912 ATGGCGTGAACCCCAGGGGGCGG - Intergenic
1201688073 Y:16729310-16729332 ATGGTGTGAACCCGGGAGGTGGG + Intergenic
1201864423 Y:18633936-18633958 ATGGTGTGAACCCAGGAGGCGGG + Intergenic
1201868899 Y:18686442-18686464 ATGGTGTGAACCCAGGAGGCGGG - Intergenic
1202053855 Y:20808310-20808332 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
1202134276 Y:21645606-21645628 ATGGCGTGAACCCCAGGGGGCGG + Intergenic
1202584265 Y:26407759-26407781 ATGGCGTGAACCCCAGGGGGCGG + Intergenic