ID: 1083854452

View in Genome Browser
Species Human (GRCh38)
Location 11:65385882-65385904
Sequence AGAATGGTGTGAACCCCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2703
Summary {0: 18, 1: 377, 2: 450, 3: 646, 4: 1212}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083854452_1083854462 13 Left 1083854452 11:65385882-65385904 CCCCCTGGGGTTCACACCATTCT 0: 18
1: 377
2: 450
3: 646
4: 1212
Right 1083854462 11:65385918-65385940 TCCCGCGTAGCTGGGACTACAGG 0: 392
1: 56827
2: 179806
3: 270892
4: 192530
1083854452_1083854460 5 Left 1083854452 11:65385882-65385904 CCCCCTGGGGTTCACACCATTCT 0: 18
1: 377
2: 450
3: 646
4: 1212
Right 1083854460 11:65385910-65385932 CTCAGCCTTCCCGCGTAGCTGGG No data
1083854452_1083854459 4 Left 1083854452 11:65385882-65385904 CCCCCTGGGGTTCACACCATTCT 0: 18
1: 377
2: 450
3: 646
4: 1212
Right 1083854459 11:65385909-65385931 CCTCAGCCTTCCCGCGTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083854452 Original CRISPR AGAATGGTGTGAACCCCAGG GGG (reversed) Intergenic
Too many off-targets to display for this crispr