ID: 1083854453

View in Genome Browser
Species Human (GRCh38)
Location 11:65385883-65385905
Sequence GAGAATGGTGTGAACCCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 107533
Summary {0: 44, 1: 679, 2: 10061, 3: 45622, 4: 51127}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083854453_1083854462 12 Left 1083854453 11:65385883-65385905 CCCCTGGGGTTCACACCATTCTC 0: 44
1: 679
2: 10061
3: 45622
4: 51127
Right 1083854462 11:65385918-65385940 TCCCGCGTAGCTGGGACTACAGG 0: 392
1: 56827
2: 179806
3: 270892
4: 192530
1083854453_1083854459 3 Left 1083854453 11:65385883-65385905 CCCCTGGGGTTCACACCATTCTC 0: 44
1: 679
2: 10061
3: 45622
4: 51127
Right 1083854459 11:65385909-65385931 CCTCAGCCTTCCCGCGTAGCTGG No data
1083854453_1083854460 4 Left 1083854453 11:65385883-65385905 CCCCTGGGGTTCACACCATTCTC 0: 44
1: 679
2: 10061
3: 45622
4: 51127
Right 1083854460 11:65385910-65385932 CTCAGCCTTCCCGCGTAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083854453 Original CRISPR GAGAATGGTGTGAACCCCAG GGG (reversed) Intergenic
Too many off-targets to display for this crispr