ID: 1083854455

View in Genome Browser
Species Human (GRCh38)
Location 11:65385885-65385907
Sequence AGGAGAATGGTGTGAACCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 6535
Summary {0: 61, 1: 827, 2: 1004, 3: 1367, 4: 3276}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083854455_1083854462 10 Left 1083854455 11:65385885-65385907 CCTGGGGTTCACACCATTCTCCT 0: 61
1: 827
2: 1004
3: 1367
4: 3276
Right 1083854462 11:65385918-65385940 TCCCGCGTAGCTGGGACTACAGG 0: 392
1: 56827
2: 179806
3: 270892
4: 192530
1083854455_1083854459 1 Left 1083854455 11:65385885-65385907 CCTGGGGTTCACACCATTCTCCT 0: 61
1: 827
2: 1004
3: 1367
4: 3276
Right 1083854459 11:65385909-65385931 CCTCAGCCTTCCCGCGTAGCTGG No data
1083854455_1083854465 29 Left 1083854455 11:65385885-65385907 CCTGGGGTTCACACCATTCTCCT 0: 61
1: 827
2: 1004
3: 1367
4: 3276
Right 1083854465 11:65385937-65385959 CAGGCGCCCGCCACCTCGCCCGG 0: 561
1: 13132
2: 34848
3: 55996
4: 114451
1083854455_1083854460 2 Left 1083854455 11:65385885-65385907 CCTGGGGTTCACACCATTCTCCT 0: 61
1: 827
2: 1004
3: 1367
4: 3276
Right 1083854460 11:65385910-65385932 CTCAGCCTTCCCGCGTAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083854455 Original CRISPR AGGAGAATGGTGTGAACCCC AGG (reversed) Intergenic
Too many off-targets to display for this crispr