ID: 1083854456

View in Genome Browser
Species Human (GRCh38)
Location 11:65385898-65385920
Sequence GGAAGGCTGAGGCAGGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 138778
Summary {0: 1098, 1: 63097, 2: 45452, 3: 18916, 4: 10215}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083854456_1083854465 16 Left 1083854456 11:65385898-65385920 CCATTCTCCTGCCTCAGCCTTCC 0: 1098
1: 63097
2: 45452
3: 18916
4: 10215
Right 1083854465 11:65385937-65385959 CAGGCGCCCGCCACCTCGCCCGG 0: 561
1: 13132
2: 34848
3: 55996
4: 114451
1083854456_1083854462 -3 Left 1083854456 11:65385898-65385920 CCATTCTCCTGCCTCAGCCTTCC 0: 1098
1: 63097
2: 45452
3: 18916
4: 10215
Right 1083854462 11:65385918-65385940 TCCCGCGTAGCTGGGACTACAGG 0: 392
1: 56827
2: 179806
3: 270892
4: 192530

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083854456 Original CRISPR GGAAGGCTGAGGCAGGAGAA TGG (reversed) Intergenic
Too many off-targets to display for this crispr