ID: 1083854457

View in Genome Browser
Species Human (GRCh38)
Location 11:65385905-65385927
Sequence CTACGCGGGAAGGCTGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083854457_1083854465 9 Left 1083854457 11:65385905-65385927 CCTGCCTCAGCCTTCCCGCGTAG No data
Right 1083854465 11:65385937-65385959 CAGGCGCCCGCCACCTCGCCCGG 0: 561
1: 13132
2: 34848
3: 55996
4: 114451
1083854457_1083854462 -10 Left 1083854457 11:65385905-65385927 CCTGCCTCAGCCTTCCCGCGTAG No data
Right 1083854462 11:65385918-65385940 TCCCGCGTAGCTGGGACTACAGG 0: 392
1: 56827
2: 179806
3: 270892
4: 192530

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083854457 Original CRISPR CTACGCGGGAAGGCTGAGGC AGG (reversed) Intergenic
No off target data available for this crispr