ID: 1083854462

View in Genome Browser
Species Human (GRCh38)
Location 11:65385918-65385940
Sequence TCCCGCGTAGCTGGGACTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 700447
Summary {0: 392, 1: 56827, 2: 179806, 3: 270892, 4: 192530}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083854455_1083854462 10 Left 1083854455 11:65385885-65385907 CCTGGGGTTCACACCATTCTCCT 0: 61
1: 827
2: 1004
3: 1367
4: 3276
Right 1083854462 11:65385918-65385940 TCCCGCGTAGCTGGGACTACAGG 0: 392
1: 56827
2: 179806
3: 270892
4: 192530
1083854452_1083854462 13 Left 1083854452 11:65385882-65385904 CCCCCTGGGGTTCACACCATTCT 0: 18
1: 377
2: 450
3: 646
4: 1212
Right 1083854462 11:65385918-65385940 TCCCGCGTAGCTGGGACTACAGG 0: 392
1: 56827
2: 179806
3: 270892
4: 192530
1083854456_1083854462 -3 Left 1083854456 11:65385898-65385920 CCATTCTCCTGCCTCAGCCTTCC 0: 1098
1: 63097
2: 45452
3: 18916
4: 10215
Right 1083854462 11:65385918-65385940 TCCCGCGTAGCTGGGACTACAGG 0: 392
1: 56827
2: 179806
3: 270892
4: 192530
1083854457_1083854462 -10 Left 1083854457 11:65385905-65385927 CCTGCCTCAGCCTTCCCGCGTAG No data
Right 1083854462 11:65385918-65385940 TCCCGCGTAGCTGGGACTACAGG 0: 392
1: 56827
2: 179806
3: 270892
4: 192530
1083854451_1083854462 16 Left 1083854451 11:65385879-65385901 CCGCCCCCTGGGGTTCACACCAT 0: 14
1: 307
2: 305
3: 324
4: 655
Right 1083854462 11:65385918-65385940 TCCCGCGTAGCTGGGACTACAGG 0: 392
1: 56827
2: 179806
3: 270892
4: 192530
1083854453_1083854462 12 Left 1083854453 11:65385883-65385905 CCCCTGGGGTTCACACCATTCTC 0: 44
1: 679
2: 10061
3: 45622
4: 51127
Right 1083854462 11:65385918-65385940 TCCCGCGTAGCTGGGACTACAGG 0: 392
1: 56827
2: 179806
3: 270892
4: 192530
1083854454_1083854462 11 Left 1083854454 11:65385884-65385906 CCCTGGGGTTCACACCATTCTCC 0: 13
1: 341
2: 584
3: 1091
4: 1727
Right 1083854462 11:65385918-65385940 TCCCGCGTAGCTGGGACTACAGG 0: 392
1: 56827
2: 179806
3: 270892
4: 192530

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083854462 Original CRISPR TCCCGCGTAGCTGGGACTAC AGG Intergenic
Too many off-targets to display for this crispr