ID: 1083854465

View in Genome Browser
Species Human (GRCh38)
Location 11:65385937-65385959
Sequence CAGGCGCCCGCCACCTCGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 218988
Summary {0: 561, 1: 13132, 2: 34848, 3: 55996, 4: 114451}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083854458_1083854465 5 Left 1083854458 11:65385909-65385931 CCTCAGCCTTCCCGCGTAGCTGG No data
Right 1083854465 11:65385937-65385959 CAGGCGCCCGCCACCTCGCCCGG 0: 561
1: 13132
2: 34848
3: 55996
4: 114451
1083854457_1083854465 9 Left 1083854457 11:65385905-65385927 CCTGCCTCAGCCTTCCCGCGTAG No data
Right 1083854465 11:65385937-65385959 CAGGCGCCCGCCACCTCGCCCGG 0: 561
1: 13132
2: 34848
3: 55996
4: 114451
1083854456_1083854465 16 Left 1083854456 11:65385898-65385920 CCATTCTCCTGCCTCAGCCTTCC 0: 1098
1: 63097
2: 45452
3: 18916
4: 10215
Right 1083854465 11:65385937-65385959 CAGGCGCCCGCCACCTCGCCCGG 0: 561
1: 13132
2: 34848
3: 55996
4: 114451
1083854455_1083854465 29 Left 1083854455 11:65385885-65385907 CCTGGGGTTCACACCATTCTCCT 0: 61
1: 827
2: 1004
3: 1367
4: 3276
Right 1083854465 11:65385937-65385959 CAGGCGCCCGCCACCTCGCCCGG 0: 561
1: 13132
2: 34848
3: 55996
4: 114451
1083854461_1083854465 -1 Left 1083854461 11:65385915-65385937 CCTTCCCGCGTAGCTGGGACTAC No data
Right 1083854465 11:65385937-65385959 CAGGCGCCCGCCACCTCGCCCGG 0: 561
1: 13132
2: 34848
3: 55996
4: 114451
1083854463_1083854465 -5 Left 1083854463 11:65385919-65385941 CCCGCGTAGCTGGGACTACAGGC 0: 506
1: 74777
2: 195986
3: 241615
4: 178434
Right 1083854465 11:65385937-65385959 CAGGCGCCCGCCACCTCGCCCGG 0: 561
1: 13132
2: 34848
3: 55996
4: 114451
1083854454_1083854465 30 Left 1083854454 11:65385884-65385906 CCCTGGGGTTCACACCATTCTCC 0: 13
1: 341
2: 584
3: 1091
4: 1727
Right 1083854465 11:65385937-65385959 CAGGCGCCCGCCACCTCGCCCGG 0: 561
1: 13132
2: 34848
3: 55996
4: 114451
1083854464_1083854465 -6 Left 1083854464 11:65385920-65385942 CCGCGTAGCTGGGACTACAGGCG 0: 356
1: 44594
2: 110663
3: 178920
4: 132001
Right 1083854465 11:65385937-65385959 CAGGCGCCCGCCACCTCGCCCGG 0: 561
1: 13132
2: 34848
3: 55996
4: 114451

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083854465 Original CRISPR CAGGCGCCCGCCACCTCGCC CGG Intergenic
Too many off-targets to display for this crispr