ID: 1083855787

View in Genome Browser
Species Human (GRCh38)
Location 11:65392432-65392454
Sequence GATGTCCGTCACCGGGGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 49}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083855787_1083855797 26 Left 1083855787 11:65392432-65392454 CCTGCACCCCGGTGACGGACATC 0: 1
1: 0
2: 0
3: 1
4: 49
Right 1083855797 11:65392481-65392503 AGTGGCCTCACACCTCTCAAAGG 0: 1
1: 0
2: 2
3: 13
4: 184
1083855787_1083855795 2 Left 1083855787 11:65392432-65392454 CCTGCACCCCGGTGACGGACATC 0: 1
1: 0
2: 0
3: 1
4: 49
Right 1083855795 11:65392457-65392479 CATACATCTCTGGATGAACTTGG 0: 1
1: 0
2: 0
3: 10
4: 149
1083855787_1083855791 -8 Left 1083855787 11:65392432-65392454 CCTGCACCCCGGTGACGGACATC 0: 1
1: 0
2: 0
3: 1
4: 49
Right 1083855791 11:65392447-65392469 CGGACATCCCCATACATCTCTGG 0: 1
1: 0
2: 0
3: 4
4: 51
1083855787_1083855796 8 Left 1083855787 11:65392432-65392454 CCTGCACCCCGGTGACGGACATC 0: 1
1: 0
2: 0
3: 1
4: 49
Right 1083855796 11:65392463-65392485 TCTCTGGATGAACTTGGAAGTGG 0: 1
1: 0
2: 3
3: 19
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083855787 Original CRISPR GATGTCCGTCACCGGGGTGC AGG (reversed) Intronic
900283931 1:1890552-1890574 GAGTTTCGGCACCGGGGTGCGGG - Intronic
900436922 1:2635249-2635271 AATGTCCACCTCCGGGGTGCTGG - Intergenic
905819699 1:40979915-40979937 GACGTCCGTCACCGCGGCGGCGG - Intronic
908543931 1:65147034-65147056 GATGTCCCTCACCTGTGTTCAGG - Intergenic
1070111907 10:73495341-73495363 GACGACTGTCACCGGGGAGCAGG + Intronic
1075098277 10:119488000-119488022 GAAGTCCATGACCAGGGTGCTGG - Intergenic
1076769211 10:132654002-132654024 GATGTCTGAAACCAGGGTGCGGG + Intronic
1083288580 11:61676990-61677012 GAGGTCCTTCACGGGGGTGTGGG - Intergenic
1083855787 11:65392432-65392454 GATGTCCGTCACCGGGGTGCAGG - Intronic
1085174327 11:74473345-74473367 GCTGTGCGTCACCAGGGTCCAGG + Intergenic
1089737410 11:120559313-120559335 GATGGCTGTCACCAGGATGCTGG - Intronic
1093576043 12:20731028-20731050 GATGGCCATCTCCGGGGTGGGGG - Intronic
1096828191 12:54295134-54295156 CATGTCCATCACCGAGCTGCAGG - Exonic
1108098504 13:46929950-46929972 GAAGTCCGAGACCAGGGTGCTGG - Intergenic
1122965008 14:105119353-105119375 AATGTCCGTCACTGGGGCACCGG + Intergenic
1143759224 17:9088988-9089010 GGTGTCCGCCATCGGAGTGCTGG + Intronic
1156171743 18:34493990-34494012 GATGTCCGGCCCGGGGGCGCGGG + Intronic
1166543251 19:43619459-43619481 GACTCCCGTCACCGGGGAGCCGG - Intronic
1166959478 19:46489067-46489089 GAAGTCCATGACCGGGGTGTAGG - Intronic
1168252105 19:55147136-55147158 GATGTCGGACACCGAGGAGCAGG - Exonic
925218744 2:2120985-2121007 GATGGCGGTCACCGGGAGGCCGG + Intronic
925944269 2:8846319-8846341 GATGTCAGCCACCAAGGTGCAGG + Intergenic
934614458 2:95762649-95762671 GATGTACTTCCCTGGGGTGCTGG - Intergenic
934646447 2:96061850-96061872 GATGTACTTCCCTGGGGTGCTGG + Intergenic
939407058 2:141772193-141772215 GATGTCCAAGATCGGGGTGCAGG - Intronic
944962209 2:204888013-204888035 GATGTCCATGGCAGGGGTGCAGG + Intronic
946609690 2:221444320-221444342 GATATCTGTCACTGGGCTGCCGG - Intronic
1175417009 20:58808412-58808434 GATGTCAGGCACTGGTGTGCAGG + Intergenic
1183482447 22:38072490-38072512 GTTCTCCGTGATCGGGGTGCGGG + Exonic
1184682573 22:46080057-46080079 GCTGTCCGTCCACGGGGTGCGGG + Intronic
1184808072 22:46809139-46809161 GAAGTCCAGGACCGGGGTGCTGG + Intronic
954151636 3:48660703-48660725 GATGTCCACCACCTGGATGCTGG + Exonic
959056767 3:101574605-101574627 GATGTGCGTCTCCGGTGTGGCGG - Intronic
961645824 3:128392345-128392367 GTTGTTCCTCACCGGGGAGCAGG + Intronic
961682803 3:128610256-128610278 GGTGTCCGTAATTGGGGTGCAGG + Intergenic
981782948 4:148445784-148445806 GATCTCCGTGGCCGGGGTGGGGG - Intergenic
986962721 5:13234962-13234984 GAAGTCACTCACTGGGGTGCAGG + Intergenic
997443754 5:133926640-133926662 GCTGTCCCTCGCCGGGCTGCGGG - Intergenic
1006318548 6:33305211-33305233 GATGTCCCTTACCCAGGTGCTGG + Exonic
1007486765 6:42185846-42185868 GATGTGGGTCACTGGGGTGAAGG - Intronic
1007665211 6:43509728-43509750 GCTGTCCGGCGCCGAGGTGCGGG - Exonic
1007789869 6:44302810-44302832 GCTGGCCGTCACTGGGGAGCAGG - Exonic
1022051024 7:26672080-26672102 TATGTCTGTCACTGGGGAGCAGG - Intronic
1035126715 7:156613183-156613205 GGTGCTCGTCACCGGGCTGCAGG - Intergenic
1048450552 8:134529720-134529742 GATGTCCCTCAACGTGGAGCGGG - Intronic
1049248409 8:141575209-141575231 GCTGTCCCTCAGAGGGGTGCAGG + Intergenic
1053841555 9:42191887-42191909 ACTGGCCGGCACCGGGGTGCAGG + Intergenic
1054120017 9:61198281-61198303 ACTGGCCGGCACCGGGGTGCAGG + Intergenic
1054587739 9:66984281-66984303 ACTGGCCGGCACCGGGGTGCAGG - Intergenic
1055131853 9:72784691-72784713 GATGTCCGTCAACAGTGTACTGG + Intronic
1190971478 X:55353220-55353242 GTTGTTCATCACCGGGCTGCTGG - Intergenic