ID: 1083856158

View in Genome Browser
Species Human (GRCh38)
Location 11:65394079-65394101
Sequence ACCTGGAGCTCCCGCCGCTT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 273}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083856158_1083856164 6 Left 1083856158 11:65394079-65394101 CCAAAGCGGCGGGAGCTCCAGGT 0: 1
1: 0
2: 1
3: 11
4: 273
Right 1083856164 11:65394108-65394130 GGAGCCCTGGTGGCCCCACCAGG 0: 1
1: 0
2: 3
3: 40
4: 334
1083856158_1083856161 -7 Left 1083856158 11:65394079-65394101 CCAAAGCGGCGGGAGCTCCAGGT 0: 1
1: 0
2: 1
3: 11
4: 273
Right 1083856161 11:65394095-65394117 TCCAGGTGAGGCAGGAGCCCTGG 0: 1
1: 0
2: 4
3: 68
4: 585
1083856158_1083856167 11 Left 1083856158 11:65394079-65394101 CCAAAGCGGCGGGAGCTCCAGGT 0: 1
1: 0
2: 1
3: 11
4: 273
Right 1083856167 11:65394113-65394135 CCTGGTGGCCCCACCAGGCCTGG 0: 1
1: 0
2: 6
3: 43
4: 482
1083856158_1083856163 -4 Left 1083856158 11:65394079-65394101 CCAAAGCGGCGGGAGCTCCAGGT 0: 1
1: 0
2: 1
3: 11
4: 273
Right 1083856163 11:65394098-65394120 AGGTGAGGCAGGAGCCCTGGTGG 0: 1
1: 0
2: 7
3: 77
4: 638

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083856158 Original CRISPR ACCTGGAGCTCCCGCCGCTT TGG (reversed) Exonic
900394745 1:2448666-2448688 CCCTGGAGCTCACGCTGCTGAGG + Intronic
901304271 1:8221326-8221348 ACCTGTAGCTCCAGCCACTTAGG - Intergenic
903480809 1:23652099-23652121 ACCTGTAGCTCCAGCTACTTGGG - Intergenic
903542905 1:24106977-24106999 CCCTGGATGTCCCGCCTCTTGGG + Intronic
903633653 1:24797447-24797469 GCCTGTAGCTCCAGCTGCTTGGG + Intronic
903786885 1:25867146-25867168 ACCTGTAGCCCCAGCCACTTGGG - Intronic
904543886 1:31253322-31253344 ACCTGTAGCCCCAGCTGCTTGGG - Intergenic
905008760 1:34732413-34732435 ACCTGGAGCACCCGCCTATATGG - Intronic
905122311 1:35691421-35691443 ACCTGGGGCTCCAGAGGCTTAGG - Intergenic
905209451 1:36363571-36363593 ACCTGGTGATCCGCCCGCTTCGG - Intronic
905782190 1:40721684-40721706 ACCTGTAGCTCCCGCTACTCAGG - Intronic
906221264 1:44081538-44081560 ACCTGTAGTTCCAGCTGCTTGGG - Intergenic
907822905 1:57988487-57988509 ACCTTGAGTTCCCTCCCCTTGGG + Intronic
907940567 1:59083355-59083377 ACCTGTAGCTCCAGCTACTTGGG - Intergenic
908711083 1:67015512-67015534 ACCTGTAGTTCCAGCTGCTTGGG - Intronic
909023040 1:70453024-70453046 AGGTGGAGCTCCCACCTCTTTGG + Intergenic
911723783 1:101220132-101220154 GCCTGGAGCTCCCGCCGCACTGG + Intergenic
911843202 1:102711435-102711457 ACCTGTAGTTCCAGCCACTTGGG + Intergenic
911904604 1:103550514-103550536 ACCTGGAGCCCCAGCTACTTGGG + Intronic
914257675 1:145974005-145974027 ACCTGTAGCTCCAGCTACTTGGG + Intronic
914798106 1:150938866-150938888 ACCTGTAGTCCCAGCCGCTTTGG + Intronic
915235935 1:154482136-154482158 ACCTGTAGTTCCAGCTGCTTGGG - Exonic
916893682 1:169138592-169138614 ACCTGTAGTCCCAGCCGCTTGGG + Intronic
917532921 1:175853149-175853171 CCCTGGAGCTGCCTCCTCTTGGG - Intergenic
918607816 1:186450461-186450483 ACCTGTAGTCCCCGCCGCTCAGG - Intronic
922741841 1:228018515-228018537 ACCTGTAGTCCCCGCTGCTTGGG - Intronic
923222193 1:231905495-231905517 ACCTGTAGTTCCTGCTGCTTGGG + Intronic
923768722 1:236918032-236918054 ACCTTGAGATCCGCCCGCTTCGG + Intergenic
924507052 1:244695896-244695918 ACCTGTAGCTCCAGCTACTTGGG - Intronic
1063933404 10:11052028-11052050 ACCTGTAGCCCCAGCCACTTGGG - Intronic
1065092117 10:22245554-22245576 ACCTGGAGCTCCCGGAGTCTAGG + Intergenic
1066350279 10:34630937-34630959 ACCTGTAGCCCCAGCCACTTGGG - Intronic
1066569056 10:36751860-36751882 ACCTGGTGATCCGCCCGCTTTGG - Intergenic
1067024513 10:42832298-42832320 ACCTGTAGTTCCAGCTGCTTGGG + Exonic
1068426100 10:56866342-56866364 ACCTGTAGCCCCAGCCACTTGGG + Intergenic
1069035310 10:63640625-63640647 ACCTGGAGTCCCAGCCACTTGGG - Intergenic
1069592767 10:69652284-69652306 GCCTGGAGCCTCCGCCGCTCTGG + Intergenic
1070322787 10:75366875-75366897 ACCTGGAGCTCTCTCCCATTGGG - Intergenic
1070498620 10:77048995-77049017 ACCTGGAGATCCACCCGCCTCGG + Intronic
1070947386 10:80404273-80404295 ACCTCGTGATCCCACCGCTTTGG + Intergenic
1071558806 10:86629141-86629163 ACCTGTAGTTCCAGCTGCTTGGG + Intergenic
1072592734 10:96842268-96842290 ACCTGTAGCCCCAGCTGCTTGGG + Intronic
1076867090 10:133172876-133172898 ACCTGTAGCCCCAGCCGCTCAGG + Intronic
1077057380 11:601302-601324 ACCTGTAGTTCCAGCTGCTTGGG + Intronic
1080405666 11:31976598-31976620 ACCTGAAGCTCCAGCTACTTGGG + Intronic
1083583409 11:63839395-63839417 AGCAGGAGCACCCGCCGCATGGG - Exonic
1083630784 11:64094197-64094219 ACCTTGTGCTCCACCCGCTTTGG - Intronic
1083856158 11:65394079-65394101 ACCTGGAGCTCCCGCCGCTTTGG - Exonic
1084055971 11:66633340-66633362 ACCTGTAGTTCCAGCCACTTGGG - Intronic
1084540515 11:69783385-69783407 ACCTGCAGCCCCAGCTGCTTGGG - Intergenic
1087375951 11:97340455-97340477 ACCTGGTGATCCCCCCGCCTCGG + Intergenic
1091240943 11:134051965-134051987 ACCTGGTGATCCGCCCGCTTCGG - Intergenic
1091411776 12:245553-245575 ACCTGTAGCTCCAGCTACTTGGG + Intronic
1092802702 12:12186501-12186523 ACCTGTAGTCCCAGCCGCTTGGG - Intronic
1092809558 12:12260143-12260165 ACCTGGTGATCCAGCCGCCTCGG - Intronic
1093547899 12:20369430-20369452 ACCTGGTGCTGCAGCCGCTCCGG + Exonic
1094689806 12:32757465-32757487 ACCTGTAGCTCCAGCTACTTGGG - Intergenic
1095256408 12:40041760-40041782 AACTGGGGCTCTCGCCTCTTGGG - Intronic
1096052691 12:48624929-48624951 ACCTGCAGTTCCAGCTGCTTGGG + Intergenic
1096257379 12:50071768-50071790 ACCTGTAGTTCCAGCTGCTTGGG - Intronic
1097140740 12:56900715-56900737 ACCTGGAGCTCCCCACCCTGTGG + Intergenic
1097278593 12:57830150-57830172 ACCTCGTGCTCCACCCGCTTTGG - Intronic
1101382780 12:104228950-104228972 ACCTGGTGATCCCCCCGCCTCGG + Intronic
1102018550 12:109664985-109665007 GCCTGGAGCTCCCACTACTTGGG - Intergenic
1102407167 12:112683603-112683625 AACTGGAGCTCCATCCTCTTGGG + Intronic
1102491869 12:113294208-113294230 ACCTGTAGTTCCAGCTGCTTGGG - Intronic
1102724641 12:115050329-115050351 ACTTGTAGCTCCAGCTGCTTGGG - Intergenic
1102823953 12:115931064-115931086 ACCTGTAGCCCCAGCTGCTTGGG + Intergenic
1103877620 12:124140889-124140911 ACCTGGAGCACCCTACGCATTGG - Intronic
1106359884 13:29021140-29021162 ACCTGGAGTGCCAGCTGCTTGGG + Intronic
1107078865 13:36352833-36352855 ACCTGTAGCTCCAGCTACTTGGG + Intronic
1108364648 13:49697662-49697684 ACCTGTAGCTCCAGCTACTTGGG - Intergenic
1111591714 13:90355794-90355816 ACCTGTAGCTCCAGCTACTTAGG + Intergenic
1115440905 14:33434400-33434422 ACCTGTAGGTCCAGCTGCTTGGG + Intronic
1115784832 14:36813482-36813504 ACCTGTAGTTCCAGCTGCTTGGG - Intronic
1115866394 14:37751946-37751968 ACCTGTAGCCCCAGCTGCTTGGG - Intronic
1116033660 14:39602610-39602632 ACCTCGAGATCCGGCCGCCTCGG + Intergenic
1116287391 14:42989855-42989877 GCCTGTAGTTCCCGCTGCTTGGG + Intergenic
1116457840 14:45139858-45139880 ACCTGTAGCCCCAGCTGCTTGGG + Intronic
1118986216 14:70757334-70757356 GCCTGTAGCTCCAGCCACTTAGG + Intronic
1119689353 14:76658952-76658974 ACCTGTAGCTCCTGCTACTTGGG - Intergenic
1121578172 14:95005921-95005943 TCCTGCAGCTCCTGCCCCTTGGG + Intergenic
1121610401 14:95274745-95274767 ACCTGGTGATCCGCCCGCTTTGG - Intronic
1121626220 14:95387246-95387268 ACCTGAAGCTCCTGCAGCTGTGG - Intergenic
1122083551 14:99283948-99283970 ACCTGTAGCTCCAGCTACTTGGG - Intergenic
1122967117 14:105136549-105136571 ACCTGGAGCGCCAGCCGCGAGGG - Intergenic
1123003542 14:105310015-105310037 ACCTGGAGATCCACCCGCCTCGG + Exonic
1123034068 14:105464694-105464716 ACTTGGGGCTCCCGCTGCTCCGG - Exonic
1124246151 15:28072132-28072154 ACCTGGTGATCCACCCGCTTCGG - Intronic
1125513917 15:40307550-40307572 ACCTGGTGCTCCAGCAGCTGAGG + Intronic
1127499306 15:59541814-59541836 ACCTGGGGATCCAGCCGCCTTGG + Intergenic
1129203111 15:74017522-74017544 ACCTGTAGTTCCGGCTGCTTGGG + Intronic
1130664002 15:85854006-85854028 ACCTCGTGATCCGGCCGCTTCGG - Intergenic
1131234753 15:90685868-90685890 ACCTGTAGTTCCAGCCGCTTGGG + Intergenic
1133003577 16:2864625-2864647 ACCTGTAGTTCCAGCCACTTGGG + Intergenic
1134168334 16:11948194-11948216 ACCTGGAACTTCCCCCGTTTTGG - Intronic
1135130448 16:19849635-19849657 ACCTGTAGCCCCAGCCACTTGGG + Intronic
1135291256 16:21240913-21240935 ACCTGTAGTTCCAGCTGCTTGGG - Intronic
1135929880 16:26727579-26727601 ACCTGTAGCTCCAGCTACTTGGG + Intergenic
1136859160 16:33686109-33686131 ACCTGTAGTTCCAGCTGCTTGGG - Intergenic
1139028189 16:62845614-62845636 ACCTCGAGATCCACCCGCTTCGG + Intergenic
1139894812 16:70280006-70280028 ACCTGTAGTTCCAGCCTCTTGGG - Intronic
1139952856 16:70680388-70680410 ACCTGGGGCTCCCGCTCCTTCGG - Intronic
1140398119 16:74646837-74646859 ACCTGGTGATCCGCCCGCTTCGG - Intronic
1142037953 16:87873745-87873767 ACCTCGAGATCCCCCCGCCTCGG - Intergenic
1203120671 16_KI270728v1_random:1534295-1534317 ACCTGTAGTTCCAGCTGCTTGGG - Intergenic
1142516432 17:433071-433093 ACCTGCAGTTCCAGCTGCTTGGG + Intergenic
1142605130 17:1077324-1077346 ACCTGGAGTTCACGTTGCTTCGG - Intronic
1142620083 17:1159971-1159993 ACGTGACGCTGCCGCCGCTTGGG + Intronic
1143439595 17:6959201-6959223 ACCTGGAGTTCCCTCTGTTTAGG + Intronic
1143638451 17:8180709-8180731 ACCTGTAGTTCCAGCTGCTTGGG + Intergenic
1144657741 17:17048292-17048314 ACCTGAGGCCCCCGCAGCTTTGG - Intronic
1145281404 17:21469733-21469755 ACCTGTAGTTCCGGCCACTTGGG + Intergenic
1146062839 17:29616024-29616046 ACCCGGAGCTCGCGGTGCTTGGG + Exonic
1146186207 17:30726002-30726024 ACCTGTAGCCCCGGCCACTTGGG + Intergenic
1148346583 17:46907575-46907597 ACCTGTAGCTCCAGCAGATTGGG + Intergenic
1148833952 17:50455549-50455571 ACTTGGAGCTCCAGCCCCATGGG + Intronic
1150121311 17:62605495-62605517 CCCTGTAGCTCCAGCTGCTTGGG - Intronic
1150318068 17:64186690-64186712 ACCTGTAGCTCCAGCTACTTGGG + Intronic
1150514801 17:65796927-65796949 ACCTGTAGTTCCAGCTGCTTGGG + Intronic
1150911602 17:69393689-69393711 ACCTGTAGTTCCAGCCGCTCTGG + Intergenic
1151176591 17:72293772-72293794 ACCTGTAGTTCCAGCTGCTTGGG - Intergenic
1151531421 17:74708021-74708043 ACCTGTAGCCCCAGCCACTTGGG + Intronic
1152361444 17:79834976-79834998 GCCTGGAGCACCCGCCGCACCGG + Exonic
1153279173 18:3398203-3398225 AACTGGAGCTCCAGCCTCCTGGG - Intergenic
1154941948 18:21122761-21122783 ACCTGTAGCCCCCGCCACTTGGG + Intergenic
1155192597 18:23443898-23443920 ACCTGGAGATCCGCCCGCCTCGG + Intergenic
1160288698 18:77570667-77570689 ACCTGGAGTTCCAGCTACTTGGG - Intergenic
1160917688 19:1505241-1505263 ACCTGGAGTTCCAGCTGCTGTGG + Exonic
1161471999 19:4462466-4462488 ACCTGCAGCTTCAGCTGCTTGGG + Intergenic
1161876969 19:6919155-6919177 ACCTGTAGCTCCAGCTACTTGGG - Intronic
1162747416 19:12806531-12806553 CCCTGGCGCTCCCGCCGCCGTGG - Intronic
1163752882 19:19088729-19088751 ACCTTGTGATCCCCCCGCTTTGG + Intronic
1163886473 19:19970161-19970183 ACCTGTAGTTCCAGCTGCTTGGG + Intergenic
1164570715 19:29372430-29372452 ACCAGGAGCTCTAGCCACTTGGG - Intergenic
1165078501 19:33294152-33294174 ACCTGCGGCTCCTGCAGCTTGGG + Intergenic
1165916209 19:39262383-39262405 GCCTGCAGCTCCAGCTGCTTAGG + Intergenic
1165939319 19:39407416-39407438 AACTGGAGATCCCGACGCGTGGG + Intronic
1166097961 19:40553355-40553377 ACCTGTAGTCCCAGCCGCTTGGG + Intronic
1167140673 19:47648424-47648446 ACCTGGAGCTCACCACTCTTGGG + Intronic
1168482276 19:56730928-56730950 ACCTGTAGCTCCAGCTACTTGGG + Intergenic
925989916 2:9246409-9246431 ACCTGTAGCTCCAGCTACTTGGG - Intronic
926930144 2:18029488-18029510 ACCTGTAGCCCCAGCTGCTTGGG - Intronic
927037052 2:19188874-19188896 ACCTGGAGCTCCACCCACATGGG - Intergenic
927109919 2:19857366-19857388 ACCTGGAGCTCCCCACGCAGCGG - Intergenic
927534849 2:23847378-23847400 ACCTGTAGCTCCAGCTACTTGGG + Intronic
929013109 2:37467388-37467410 ACCTGTAGCTCCAGCTACTTGGG - Intergenic
929087567 2:38183522-38183544 ACCTGGAGCCCCAGCTACTTGGG - Intergenic
929133462 2:38601977-38601999 ACCGGGAGCTCTCTCCGCCTCGG - Intronic
930791794 2:55339954-55339976 ACCTGCAGTCCCGGCCGCTTGGG - Intronic
930946854 2:57085109-57085131 ACCAGGAGCCTCTGCCGCTTTGG - Intergenic
931264207 2:60646124-60646146 ACCTGTAGCCCCAGCTGCTTGGG + Intergenic
931720279 2:65062406-65062428 ACCTGGAGTCCCAGCTGCTTTGG + Intronic
932156877 2:69426095-69426117 ACCTGTAGTTCCAGCCACTTGGG - Intronic
932356323 2:71071287-71071309 AGCTGGAGCTACCGCAACTTGGG - Intronic
932562758 2:72887469-72887491 ACCGGGGCCTCCCGCGGCTTCGG + Exonic
933715192 2:85354788-85354810 ACTTGGGGGTCCCGCCGCCTCGG - Exonic
933903887 2:86870186-86870208 ACCTGGTGATCCGCCCGCTTCGG + Intergenic
934083290 2:88487876-88487898 ACCTGGAGTTCCAGCTACTTGGG - Intergenic
934923821 2:98367425-98367447 ACCTTGTGATCCAGCCGCTTCGG + Intronic
935020940 2:99230829-99230851 GCCTGGAGCCCCCGCTACTTGGG + Intronic
935776622 2:106478787-106478809 ACCTGGTGATCCGCCCGCTTCGG - Intergenic
939777125 2:146402308-146402330 ACCTGGTGATCCGCCCGCTTCGG + Intergenic
942012523 2:171777054-171777076 ACCTGTAGCTCCAGACACTTGGG + Intergenic
944537980 2:200730057-200730079 ACCTGTAGTTCCAGCTGCTTGGG + Intergenic
945573645 2:211503284-211503306 AGCAGGAGCTGCAGCCGCTTAGG - Intronic
947493789 2:230618245-230618267 ACCTGTAGCTCCAGCTACTTGGG - Intergenic
947768029 2:232649868-232649890 GCCTGGAGTTCCAGCCACTTAGG + Intronic
1172537094 20:35682662-35682684 ACCTGTAGCCCCAGCCACTTCGG + Intronic
1174057459 20:47808038-47808060 ACCTGTAGCTCCAGCTACTTAGG + Intergenic
1174115240 20:48222450-48222472 ACCTGGAGCTCCTCCCACCTTGG + Intergenic
1175503563 20:59466894-59466916 CCCTGCAGCCCCAGCCGCTTGGG - Intergenic
1175940147 20:62533995-62534017 GCCTGGGGCTCCCGCCCCTGTGG - Intergenic
1175994223 20:62805132-62805154 TCCTGGAGCTCCCGCAGCCCCGG + Intronic
1179557475 21:42189291-42189313 ACCTGCAGTTCCAGCCACTTGGG + Intergenic
1179719110 21:43305477-43305499 ACCTGGAGCTCCCACCGCAGTGG + Intergenic
1179915835 21:44477648-44477670 ACCTGGAGCTCCTGCACCATGGG + Intergenic
1180638914 22:17282506-17282528 ACCTCGTGATCCCCCCGCTTCGG + Intergenic
1180644142 22:17324299-17324321 ACCTGTAGTCCCCGCTGCTTGGG - Intergenic
1182436154 22:30331431-30331453 ACCTGTAGTTCCAGCTGCTTGGG - Intergenic
1182724171 22:32429329-32429351 GCCTGTAGCTCCAGCTGCTTGGG - Intronic
1183119227 22:35717277-35717299 ACCTGTAGTCCCCGCCACTTGGG + Intergenic
1184066159 22:42122868-42122890 ACCTGTAGTTCCAGCTGCTTGGG - Intergenic
1184715138 22:46277720-46277742 ACCTGGAGCTCCCACAGGCTGGG - Intronic
950323975 3:12087625-12087647 ACCTGTAGCCCCGGCTGCTTGGG + Intronic
951282256 3:20766122-20766144 ACCTGTAGTTCCAGCTGCTTAGG - Intergenic
952373493 3:32745864-32745886 ACCTGTAGCTCCAGCTGCTCGGG + Intronic
953737883 3:45511898-45511920 ACCTGTAGTCCCCGCTGCTTGGG - Intronic
954477730 3:50764682-50764704 ACCTGTAGTTCCAGCTGCTTGGG + Intronic
956625425 3:71262032-71262054 ACCTCGTGATCCCGCCGCCTCGG - Intronic
958811957 3:98870506-98870528 ACCTGTAGTTCCAGCTGCTTGGG + Intronic
960786643 3:121379957-121379979 ACCTGTACCTCCAGCTGCTTGGG - Intronic
961472605 3:127125550-127125572 ACCTGTAGCTCCAGCTACTTGGG + Intergenic
962722397 3:138187802-138187824 TCCGGGAGCTCCCGCCGGTGCGG + Intronic
963873700 3:150448351-150448373 ACCTGTAGTTCCAGCTGCTTGGG + Intronic
965521194 3:169669307-169669329 CTCTGGTGCTCACGCCGCTTAGG + Intergenic
966523549 3:180898100-180898122 ACCTGTAGTCCCCGCCACTTGGG + Intronic
966883468 3:184362222-184362244 ACCTGGAGCTCCCTTCCCTCCGG - Intronic
967207985 3:187141111-187141133 ACCTGGTGATCCACCCGCTTCGG - Intronic
968196982 3:196714584-196714606 ACCTGTAGTTCCCGCTACTTGGG - Intronic
968328759 3:197845284-197845306 ACCTGTAGTTCCAGCTGCTTGGG + Intronic
968613764 4:1568393-1568415 TCCTGGAGCTCACGCCGCCACGG + Intergenic
968707141 4:2084612-2084634 GCCTGGAGCTCTCGGGGCTTGGG + Intronic
968839514 4:2992136-2992158 ACCTGTAGTTCCAGCCACTTGGG - Intronic
969004965 4:4011728-4011750 ACCTGAAGCTCCTGCTGCCTTGG + Intergenic
970844155 4:20516046-20516068 ACCTGGTGATCCGGCCGCCTGGG + Intronic
971898890 4:32632985-32633007 ACCTGGTGATCCGCCCGCTTCGG + Intergenic
972293373 4:37713156-37713178 ACCTGGTGATCCCCCCGCCTCGG - Intergenic
972458867 4:39280528-39280550 ACCTGTAGTCCCCGCTGCTTGGG + Intronic
972652371 4:41030522-41030544 ACCTGTAGCTCCAGCTACTTGGG - Intronic
975523601 4:75326256-75326278 ACCTGCAGCCCCAGCCACTTGGG + Intergenic
976034905 4:80805747-80805769 ACCTGTAGCTCCAGCAGCTCAGG + Intronic
976627159 4:87198193-87198215 ACCTGTAACTCCAGCTGCTTGGG + Intronic
981827769 4:148963428-148963450 ACCTGTAGTTCCAGCTGCTTGGG - Intergenic
983192701 4:164771682-164771704 ACCTGTAGCTCCAGCCACTCAGG + Intergenic
984877159 4:184379643-184379665 CCCTGGAGCTGCCACTGCTTGGG + Intergenic
985721593 5:1492405-1492427 ACCTGGAGCACCCTCTGATTCGG - Intronic
987633285 5:20504998-20505020 ACCTCGTGATCCAGCCGCTTCGG + Intronic
992291795 5:75287125-75287147 ACCTGTAGTTCCAGCCACTTGGG - Intergenic
992849271 5:80788683-80788705 ACCTGTAGTTCCAGCTGCTTGGG + Intronic
994042136 5:95270803-95270825 ACCTGTAGTTCCAGCCACTTGGG + Intronic
994747937 5:103702336-103702358 ACCTGGTGCTCCGCCCGCCTCGG + Intergenic
997118937 5:131154658-131154680 ACCTGTAGTTCCAGCTGCTTGGG - Intergenic
997301285 5:132807499-132807521 CCCTGGAGCTCCTGCCTCCTGGG + Intergenic
997777548 5:136624636-136624658 ACCTGTAGCTCCAGCTACTTGGG - Intergenic
997791668 5:136767618-136767640 ACCTGTAGTTCCAGCTGCTTGGG + Intergenic
998451820 5:142240531-142240553 ACCTGGTGATCCGGCCGCCTTGG + Intergenic
999737170 5:154521521-154521543 ACCTCGAGATCCGCCCGCTTTGG - Intergenic
1000004526 5:157170709-157170731 ACCTGTAGTTCCAGCCACTTGGG - Intronic
1002277704 5:178114220-178114242 TCCGGGACCTCCCGCAGCTTTGG + Intronic
1002315793 5:178342224-178342246 ACCTGGAGCTCCAGCAGGTCTGG + Intronic
1003264002 6:4550320-4550342 ACCTGGGGCTCCACCCACTTGGG + Intergenic
1003264031 6:4550398-4550420 ACCTGGAGCTCCACCCACCTGGG + Intergenic
1003488155 6:6597304-6597326 ACCTGGAGCTCCTGCCTCATGGG - Intronic
1004869776 6:19893143-19893165 ACCTGTAGTTCCGGCTGCTTGGG + Intergenic
1004976082 6:20968281-20968303 ACCTGTAGCCCCAGCTGCTTGGG - Intronic
1007218434 6:40259656-40259678 ACCTGTAGTTCCAGCCACTTGGG + Intergenic
1008607172 6:53151643-53151665 ACCTGGAGTCCCAGCTGCTTGGG - Intergenic
1009491283 6:64295139-64295161 ACCTCGTGATCCCCCCGCTTCGG - Intronic
1010880538 6:81163963-81163985 ACCTGGAGCCCCAGCTACTTGGG + Intergenic
1011166598 6:84454685-84454707 ACCTGTAGTTCCAGCTGCTTAGG - Intergenic
1011195300 6:84774255-84774277 GCCTTGGGCGCCCGCCGCTTTGG + Intergenic
1012867369 6:104634202-104634224 ACCTGTAGTTCCAGCTGCTTGGG - Intergenic
1013220747 6:108074960-108074982 ACCACGAGCACCCACCGCTTTGG + Intronic
1015415013 6:132938580-132938602 ACCTGTAGCCCCTGCCACTTGGG - Intergenic
1017040581 6:150305367-150305389 ACCTGTAGTTCCAGCCACTTGGG + Intergenic
1017524879 6:155233836-155233858 GCCTGGAGTTCCAGCTGCTTAGG + Intronic
1019278755 7:189371-189393 AACTGGAGCTCCAGCCCCTTTGG + Intergenic
1020221055 7:6237474-6237496 ACCTGGAGATCCGCCCGCCTCGG - Intronic
1021692057 7:23240207-23240229 ACCTGTAGTCCCAGCCGCTTGGG + Intronic
1021759070 7:23885636-23885658 ACCTGGAACTCCCAACACTTTGG - Intergenic
1021871905 7:25015337-25015359 ACCTGTAGTTCCAGCCACTTGGG + Intergenic
1024860168 7:53829904-53829926 ACCTGTAGTTCCAGCCGCTCGGG + Intergenic
1024929786 7:54657924-54657946 ACCTCGAGCTCCAGCCTCTATGG + Intergenic
1026525386 7:71149037-71149059 ACCTGGAGTTCCAGCCACTTGGG - Intronic
1027567672 7:79817220-79817242 ACCTGTAGCTCCAGCTACTTGGG - Intergenic
1028510893 7:91625137-91625159 ACCTGGAGATCCGCCCGCCTCGG - Intergenic
1029190088 7:98765627-98765649 GCCTGGAGTTCCCGCCACTTGGG - Intergenic
1029631951 7:101757842-101757864 ACCTGTAGCCCCAGCCACTTGGG + Intergenic
1032840780 7:135711880-135711902 ACCTGTAGCTCCAGCTACTTGGG - Intronic
1037897684 8:22669011-22669033 TCCAGCAGCTCCCGCCGCCTGGG + Intronic
1044415106 8:91929571-91929593 GCCTGTAGCTCCAGCTGCTTGGG - Intergenic
1044819553 8:96146166-96146188 ACCTGGAGCACACGCCGGTCAGG + Intronic
1048790446 8:138098689-138098711 ACCTGGTGATCCGCCCGCTTCGG - Intergenic
1049552704 8:143267793-143267815 GCCCGGAGGTCCCGCCGCTCCGG + Intronic
1050423106 9:5487481-5487503 ACCTGGAGTGCCAGCCACTTGGG - Intergenic
1053397455 9:37787308-37787330 GCCTAGGGCTCCCGCCGCCTAGG - Intronic
1053516972 9:38738864-38738886 ACCTGTAGTTCCAGCCACTTGGG + Intergenic
1054194248 9:62014689-62014711 ACCTGGTGATCCGCCCGCTTCGG - Intergenic
1054644159 9:67574001-67574023 ACCTGGTGATCCGCCCGCTTCGG + Intergenic
1055195134 9:73581665-73581687 ACCTGGTGATCCGCCCGCTTCGG - Intergenic
1055478778 9:76689478-76689500 ACCTGTAGTTCCAGCTGCTTGGG - Intronic
1057524964 9:95790686-95790708 ACCTGTAGTTCCAGCCACTTGGG - Intergenic
1058692584 9:107532053-107532075 ACCTGTAGTTCCAGCTGCTTGGG + Intergenic
1059655601 9:116354841-116354863 ACCAGGAGCCCCCGTCCCTTAGG + Intronic
1060355860 9:122906297-122906319 ACCTGGCGGTCCACCCGCTTCGG - Intergenic
1060362220 9:122970307-122970329 ACCTGTAGTTCCAGCTGCTTAGG + Intronic
1060518559 9:124280915-124280937 ACCTGTAGCACCAGCTGCTTGGG - Intronic
1060867595 9:127012453-127012475 ACCTGGAGCACCCAGGGCTTGGG + Intronic
1061764415 9:132872588-132872610 ACCTGTAGCTCCAGCTACTTGGG - Intronic
1190332217 X:49242972-49242994 ACCTGGAGGTGCTGCAGCTTGGG - Exonic
1191846637 X:65551877-65551899 ATCTGGAGCTCCCGCCCCTTTGG + Intergenic
1194422760 X:93696685-93696707 ACCTCGAGATCCCCCCGCCTCGG - Intronic
1197949855 X:131882656-131882678 ACCTGTAGTTCCAGCCACTTAGG - Intergenic
1198505583 X:137297871-137297893 ACCTGGAGGTCCCGCCCTTTGGG - Intergenic
1201931849 Y:19359206-19359228 ACCTGGAGTTCCAGCTACTTGGG + Intergenic