ID: 1083856794

View in Genome Browser
Species Human (GRCh38)
Location 11:65396937-65396959
Sequence CAGCAGCGACGGCGGGTGCG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 1, 2: 1, 3: 27, 4: 256}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083856789_1083856794 -5 Left 1083856789 11:65396919-65396941 CCGCCAGGTGCAGGAGGTCAGCA 0: 1
1: 1
2: 2
3: 21
4: 249
Right 1083856794 11:65396937-65396959 CAGCAGCGACGGCGGGTGCGAGG 0: 1
1: 1
2: 1
3: 27
4: 256
1083856783_1083856794 24 Left 1083856783 11:65396890-65396912 CCGGGCGAGCAGGGCCTGCTGAA 0: 1
1: 0
2: 2
3: 14
4: 165
Right 1083856794 11:65396937-65396959 CAGCAGCGACGGCGGGTGCGAGG 0: 1
1: 1
2: 1
3: 27
4: 256
1083856784_1083856794 10 Left 1083856784 11:65396904-65396926 CCTGCTGAACGCCTACCGCCAGG 0: 1
1: 1
2: 0
3: 2
4: 61
Right 1083856794 11:65396937-65396959 CAGCAGCGACGGCGGGTGCGAGG 0: 1
1: 1
2: 1
3: 27
4: 256
1083856788_1083856794 -1 Left 1083856788 11:65396915-65396937 CCTACCGCCAGGTGCAGGAGGTC 0: 1
1: 1
2: 0
3: 10
4: 198
Right 1083856794 11:65396937-65396959 CAGCAGCGACGGCGGGTGCGAGG 0: 1
1: 1
2: 1
3: 27
4: 256
1083856790_1083856794 -8 Left 1083856790 11:65396922-65396944 CCAGGTGCAGGAGGTCAGCAGCG 0: 1
1: 0
2: 0
3: 20
4: 223
Right 1083856794 11:65396937-65396959 CAGCAGCGACGGCGGGTGCGAGG 0: 1
1: 1
2: 1
3: 27
4: 256
1083856782_1083856794 29 Left 1083856782 11:65396885-65396907 CCGGGCCGGGCGAGCAGGGCCTG 0: 1
1: 0
2: 2
3: 32
4: 291
Right 1083856794 11:65396937-65396959 CAGCAGCGACGGCGGGTGCGAGG 0: 1
1: 1
2: 1
3: 27
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083856794 Original CRISPR CAGCAGCGACGGCGGGTGCG AGG Exonic
900190237 1:1350005-1350027 CAGGAGCGACGGGGGGAGTGAGG + Intergenic
900190253 1:1350045-1350067 CAGGAGCGACGGGGGGAGTGAGG + Intergenic
900190269 1:1350085-1350107 CAGGAGCGACGGGGGGAGTGAGG + Intergenic
900190285 1:1350125-1350147 CAGGAGCGACGGGGGGAGTGAGG + Intergenic
900190301 1:1350165-1350187 CAGGAGCGACGGGGGGAGTGAGG + Intergenic
900190317 1:1350205-1350227 CAGGAGCGACGGGGGGAGTGAGG + Intergenic
900190333 1:1350245-1350267 CAGGAGCGACGGGGGGAGTGAGG + Intergenic
900190349 1:1350285-1350307 CAGGAGCGACGGGGGGAGTGAGG + Intergenic
900190365 1:1350325-1350347 CAGGAGCGACGGGGGGAGTGAGG + Intergenic
900190397 1:1350405-1350427 CAGGAGCGACGGGGGGAGTGAGG + Intergenic
900190413 1:1350445-1350467 CAGGAGCGACGGGGGGAGTGAGG + Intergenic
900190429 1:1350485-1350507 CAGGAGCGACGGGGGGAGTGAGG + Intergenic
900190445 1:1350525-1350547 CAGGAGCGACGGGGGGAGTGAGG + Intergenic
900190461 1:1350565-1350587 CAGGAGCGACGGGGGGAGTGAGG + Intergenic
900190477 1:1350605-1350627 CAGGAGCGACGGGGGGAGTGAGG + Intergenic
900190493 1:1350645-1350667 CAGGAGCGACGGGGGGAGTGAGG + Intergenic
900190509 1:1350685-1350707 CAGGAGCGACGGGGGGAGTGAGG + Intergenic
900190525 1:1350725-1350747 CAGGAGCGACGGGGGGAGTGAGG + Intergenic
900190541 1:1350765-1350787 CAGGAGCGACGGGGGGAGTGAGG + Intergenic
900190557 1:1350805-1350827 CAGGAGCGACGGGGGGAGTGAGG + Intergenic
900190573 1:1350845-1350867 CAGGAGCGACGGGGGGAGTGAGG + Intergenic
900190589 1:1350885-1350907 CAGGAGCGACGGGGGGAGTGAGG + Intergenic
900190605 1:1350925-1350947 CAGGAGCGACGGGGGGAGTGAGG + Intergenic
900190621 1:1350965-1350987 CAGGAGCGACGGGGGGAGTGAGG + Intergenic
900190637 1:1351005-1351027 CAGGAGCGACGGGGGGAGTGAGG + Intergenic
900190653 1:1351045-1351067 CAGGAGCGACGGGGGGAGTGAGG + Intergenic
900190669 1:1351085-1351107 CAGGAGCGACGGGGGGAGTGAGG + Intergenic
900190685 1:1351125-1351147 CAGGAGCGACGGGGGGAGTGAGG + Intergenic
900190717 1:1351205-1351227 CAGGAGCGACGGGGGGAGTGAGG + Intergenic
900190733 1:1351245-1351267 CAGGAGCGACGGGGGGAGTGAGG + Intergenic
900190749 1:1351285-1351307 CAGGAGCGACGGGGGGAGTGAGG + Intergenic
900190765 1:1351325-1351347 CAGGAGCGACGGGGGGAGTGAGG + Intergenic
900190781 1:1351365-1351387 CAGGAGCGACGGGGGGAGTGAGG + Intergenic
900190797 1:1351405-1351427 CAGGAGCGACGGGGGGAGTGAGG + Intergenic
900237572 1:1600057-1600079 CAGCGGGGACGGCGGCGGCGCGG - Exonic
901039311 1:6354648-6354670 CAGCGGCCACGGGGGGTGAGAGG - Intronic
901084455 1:6602155-6602177 CAGCAGCTGCGGCCAGTGCGCGG + Exonic
902072196 1:13749542-13749564 CAGCAGCGAGGGCGGCAGGGCGG - Intronic
902377173 1:16035275-16035297 CAGCATCGGCGGCGGCTGCCCGG - Intergenic
902382351 1:16058534-16058556 CAGCATCGGCGGCGGCTGCCCGG - Exonic
903446152 1:23424167-23424189 CGGCGGCGATGGCGGGGGCGGGG - Intronic
903606705 1:24580176-24580198 CACCAGCCACGGCGGGTACTGGG + Intronic
904652235 1:32014174-32014196 CAGCAGCGGTGGCGGCTGCGTGG - Exonic
906270435 1:44473478-44473500 CATCAGGGATGGCGGGGGCGGGG + Intronic
907428342 1:54395564-54395586 CAGCAGGGACGGGCGGTGGGGGG + Intronic
907689095 1:56645098-56645120 AAGCAGCGACAGCGGGGGCCGGG - Intronic
911807954 1:102235025-102235047 CAGCAGCTGCGGAGGGTGCTGGG - Intergenic
912381299 1:109249606-109249628 CAGCAGCCGCGGCGGGGACGCGG + Intergenic
912538749 1:110396548-110396570 CAGCAGCTGCGGAGGGTGCGCGG - Intergenic
913703433 1:121396403-121396425 AAGCCGCGGCGGCGGGTGTGTGG - Intergenic
913939041 1:125085998-125086020 AAGCCGCGGCGGCGGGTGGGTGG + Intergenic
913979735 1:143497989-143498011 AAGCTGCGGCGGCGGGTGGGTGG - Intergenic
913979825 1:143498299-143498321 AAGCCGCGGCGGCGGGTGTGTGG - Intergenic
914074168 1:144323759-144323781 AAGCCGCGGCGGCGGGTGTGTGG - Intergenic
914105008 1:144642687-144642709 AAGCCGCGGCGGCGGGTGTGTGG + Intergenic
917962337 1:180154930-180154952 CAGCAGCGACGGCGGCGGCCCGG - Exonic
920912623 1:210232872-210232894 CGGCGGTGACTGCGGGTGCGCGG - Exonic
921217736 1:212951476-212951498 CGGCAGCGGCGGCGGCGGCGGGG - Exonic
922648637 1:227318191-227318213 CAGCAGCTGCGGCGGCGGCGCGG + Exonic
923369425 1:233295576-233295598 CGGCGGCGACGGCGGGGGCGCGG - Exonic
924581838 1:245330400-245330422 CAGCAGGGACAACGGGTGGGTGG + Intronic
1062982534 10:1737212-1737234 CAGCGGCGGCGGCGGCTGCCGGG - Exonic
1063637503 10:7797644-7797666 CTGCAGCGGGGGCGGGTGAGGGG + Intronic
1066429338 10:35336877-35336899 CAGCAGCGGCGGCGGCGGCGGGG - Exonic
1069424686 10:68279045-68279067 CAGCAGCGGCGGCGGGGGAGGGG + Intergenic
1070328333 10:75401880-75401902 CAGCGGCGGCGGCGGCGGCGCGG - Exonic
1071086739 10:81874975-81874997 CAGCAGCAGCAGCGGGCGCGGGG + Intergenic
1071966574 10:90858048-90858070 CGGCGGCGGCGGCGGGCGCGAGG - Intergenic
1072388780 10:94960332-94960354 CAGCAGCGAGGCTGGGTGAGGGG - Intronic
1076642364 10:131927387-131927409 CTTCAGAGAGGGCGGGTGCGCGG + Intronic
1077043664 11:535282-535304 CGGCGGCGGCGGCGGGTGGGTGG - Intronic
1077664456 11:4095106-4095128 AAGCAGCGAAGGCGGGCGGGCGG - Intronic
1080551346 11:33376235-33376257 CTGCAGCGGCGGCGGGAGGGAGG + Intergenic
1080551537 11:33376815-33376837 CAGCAGCGTCGGTGGCCGCGGGG - Intergenic
1082787507 11:57324889-57324911 TAGCAGCGGCGGCGGCGGCGGGG - Intronic
1083639369 11:64136917-64136939 CAGCGGGGAGGGCTGGTGCGGGG + Intronic
1083753701 11:64778090-64778112 CGGCTGCGGCGGCGGGTACGAGG + Exonic
1083856794 11:65396937-65396959 CAGCAGCGACGGCGGGTGCGAGG + Exonic
1083970301 11:66070400-66070422 CGGCGGCGGCGGCGGGGGCGCGG - Intronic
1084185593 11:67469236-67469258 CAGCGGCGACGCTGGGTGTGTGG - Intronic
1084599674 11:70137419-70137441 CAGCGGTGATGGCGGGTGGGGGG - Intronic
1084891815 11:72240412-72240434 CAGCAGAGTCAGCGGGTGAGTGG - Intronic
1085516578 11:77115448-77115470 CATCAGTGACGGCGTATGCGTGG - Exonic
1086888260 11:92226829-92226851 CAGCAGCCGCGGCGGGAGGGAGG + Intergenic
1092564205 12:9647962-9647984 CAGAAGCGCCGGCGGCTGCGGGG + Intergenic
1093465022 12:19440029-19440051 CAGCAGCAGCGGCGGGGGTGAGG + Exonic
1096533823 12:52258382-52258404 CGGCAGCCACAGCGTGTGCGGGG - Intronic
1097830670 12:64221809-64221831 CAGCAGCGCAGGCCGGTGGGCGG + Intronic
1097929631 12:65169838-65169860 CAGCGGCGGCGGCGGCCGCGGGG + Exonic
1104289712 12:127456063-127456085 CGGCAGGGACCGCGGGTGAGCGG + Intergenic
1112899969 13:104346066-104346088 CAGCAGCGAGGCTGGGGGCGGGG - Intergenic
1113377897 13:109782132-109782154 CAGCACCGGCGGCGGGTGCGGGG - Exonic
1113379060 13:109786486-109786508 CAGCAGCCCCGGCGGCGGCGCGG - Exonic
1114057406 14:18984240-18984262 CAGCAGCAAGAGCGGGAGCGAGG - Intronic
1114105140 14:19417507-19417529 CAGCAGCAAGAGCGGGAGCGAGG + Intronic
1115028391 14:28767464-28767486 CGGCGGCGGCGGCGGTTGCGGGG - Exonic
1115135868 14:30107361-30107383 CAGCAGCGAGGGTGGGGGAGGGG + Intronic
1116018241 14:39432044-39432066 CAGCAGCTGCGACGGCTGCGGGG - Exonic
1116186578 14:41606860-41606882 CGGCGGCGGCGGCGGGCGCGCGG - Intergenic
1118772671 14:68952594-68952616 CAGCAGGGATGGGGGGTGGGCGG - Intronic
1121767800 14:96502536-96502558 CGGCAGCGGCGGCGGTTGCGGGG + Exonic
1122263523 14:100536311-100536333 CAGCAACCACGGAGGGTGTGGGG + Intergenic
1123034568 14:105466643-105466665 CAGCACGCACGGCGGGTGCCCGG - Intronic
1125508789 15:40282031-40282053 CCGCAGCGGCGGCGGCGGCGCGG + Exonic
1125539581 15:40462217-40462239 CGGCGGCGACGGCGGCGGCGAGG - Exonic
1125606473 15:40942268-40942290 CTGCTGCGACGGCGGGGGCAGGG - Intergenic
1130564426 15:84981697-84981719 CGGCGGCGGCGGCGGGAGCGGGG + Intronic
1131466054 15:92655615-92655637 CAGCAGCAGCGGCAGGAGCGGGG + Exonic
1132855974 16:2044706-2044728 ATGCAGCGACTGCGGGCGCGGGG - Exonic
1136229071 16:28876500-28876522 CAGCGGAGACGGTGGGTGCTGGG + Intergenic
1136768564 16:32811920-32811942 AAGCCGCGGCGGCGGGTGGGTGG + Intergenic
1138105710 16:54286212-54286234 CGGCGGCGACGGCGGCGGCGAGG + Exonic
1138688782 16:58749000-58749022 CAGCAGCTGCGGAGGGTGCGCGG + Intergenic
1139469449 16:67170487-67170509 CAGCAGCTGCGGCGGGGGCGGGG - Intronic
1139546627 16:67652855-67652877 CAGCGGCGGCGGCGGGGGAGGGG + Intronic
1141661420 16:85443687-85443709 CAGCAGGGAAGGCAGGTGGGTGG - Intergenic
1142136284 16:88453363-88453385 CGGCGGCGGCGGCGAGTGCGCGG + Exonic
1203070990 16_KI270728v1_random:1074055-1074077 AAGCCGCGGCGGCGGGTGGGTGG + Intergenic
1144836171 17:18157831-18157853 CAGCGGCCACGGCGGCTGCTCGG - Exonic
1146797928 17:35795686-35795708 CAGCAGCGGCGCGGGGTGGGTGG - Intronic
1147807862 17:43144928-43144950 CAGCAGGGAAGGTGGGTGCCAGG - Intergenic
1147968607 17:44207465-44207487 CAGCAGCGAGGACGAGAGCGAGG - Exonic
1148178083 17:45584885-45584907 CGGCAGCGGCGGCGGGGCCGGGG + Intergenic
1149408619 17:56380715-56380737 CAGCAGCGAGGCCGGGGGAGGGG + Intronic
1149454968 17:56780420-56780442 CCGGAGCGAGGGCGGGCGCGGGG - Intergenic
1149753979 17:59172668-59172690 CAGCAGCTGCAGGGGGTGCGCGG + Intronic
1150423090 17:65056245-65056267 CTGGGGCGGCGGCGGGTGCGGGG - Intronic
1151306796 17:73267768-73267790 CAGCAGCAGCGGCGGGTGAGGGG - Intergenic
1151497350 17:74466773-74466795 CGGCAGGGAGGGAGGGTGCGAGG + Intronic
1151928119 17:77213577-77213599 CAGCAGTGGCGGCGGGTGTCAGG + Intronic
1151957927 17:77389684-77389706 CACCAGGGACGGAGGGTGGGCGG + Intronic
1152711206 17:81871216-81871238 CGGCGGCGCCGGCGGGGGCGGGG - Intronic
1153935199 18:9914533-9914555 CCGCAGCGAGGGCGGGCGGGAGG - Intronic
1155392757 18:25352413-25352435 CGGCGGCGACGGCGGCGGCGCGG - Intergenic
1155611704 18:27674077-27674099 CAGCAGCTGCGGAGGGTGCGCGG - Intergenic
1155660273 18:28240859-28240881 CAGCAGCGAGGGTGGGGGAGGGG + Intergenic
1156099660 18:33578451-33578473 CGGCGGCGGCGGCGGGTGGGAGG - Intergenic
1156243036 18:35271861-35271883 CAGCAGCTGCGGAGGGGGCGCGG - Intronic
1157279032 18:46333949-46333971 CAGCGGGGACCGCGGGCGCGCGG - Intronic
1157383818 18:47246661-47246683 CAGGGGCGGCGGCGGGGGCGGGG + Intronic
1157383959 18:47247156-47247178 AAGCGGCGACGGCGGCTGCGGGG + Intronic
1158613343 18:58962979-58963001 CAGCAGCAAGGGCAGGTGTGCGG - Intronic
1159040576 18:63320037-63320059 CAGCGGCGGCGGCGGCAGCGCGG + Exonic
1159289323 18:66395968-66395990 CAGCAGCTGTGGAGGGTGCGCGG + Intergenic
1160738813 19:676612-676634 CGGCGGCGGCGGCGGGGGCGAGG + Intronic
1160861281 19:1238103-1238125 CGGCCGCCGCGGCGGGTGCGGGG - Intergenic
1160891993 19:1383950-1383972 CGGCACCGGCGGCGGGTGTGGGG + Intronic
1161397981 19:4054692-4054714 CAGCGGCGGCGGCGGCCGCGGGG + Exonic
1162572144 19:11480030-11480052 CAGCAGCGGCGGCGGGCCCGCGG + Intronic
1163364576 19:16868862-16868884 CAGCAGCGGAGGCGGGGGCTTGG + Intronic
1163664141 19:18595189-18595211 CAGCAGGGGCGGCGGGGGCCGGG - Intronic
1163696071 19:18764187-18764209 CAGATGAGACGGCGGGTGCGTGG - Intronic
1165405608 19:35629146-35629168 CGGCAGCGATGGCTGGGGCGGGG + Exonic
1167466019 19:49651519-49651541 CAGCAGGGGCGGCGGGAGGGCGG - Exonic
1168401549 19:56088383-56088405 CGGCAGCCATGGCGGGCGCGGGG - Exonic
1202680437 1_KI270712v1_random:3627-3649 AAGCCGCGGCGGCGGGTGTGTGG + Intergenic
1202680656 1_KI270712v1_random:4404-4426 AAGCCGCGGCGGCGGGTGTGTGG + Intergenic
1202680841 1_KI270712v1_random:5083-5105 AAGCCGCGGCGGCGGGTGTGTGG + Intergenic
1202680977 1_KI270712v1_random:5546-5568 AAGCCGCGGCGGCGGGTGGGTGG + Intergenic
1202681099 1_KI270712v1_random:5984-6006 AAGCCGCGGCGGCGGGTGTGTGG + Intergenic
1202681175 1_KI270712v1_random:6262-6284 AAGCCGCGGCGGCGGGTGGGTGG + Intergenic
1202683498 1_KI270712v1_random:30083-30105 CCGCGGCGGCGGCGGGTGGGGGG - Intergenic
925056710 2:862235-862257 CAGCCGAGACAGCGGGTGCACGG + Intergenic
925609792 2:5693150-5693172 CGGCGGCGGCGGCGGGAGCGCGG + Exonic
926217105 2:10912366-10912388 CAGCGGCGGCGGCGGCTGCAGGG + Exonic
927743985 2:25599118-25599140 CAGCAGTGACAGTGTGTGCGGGG + Intronic
927957388 2:27217357-27217379 CAGCAGAGACTGCGGCGGCGCGG - Intergenic
931762499 2:65430907-65430929 CAGCAGCGGCGGCCGCCGCGCGG + Intronic
932562767 2:72887503-72887525 CAGCAGCGAGGCCAGGAGCGGGG - Exonic
934467094 2:94273030-94273052 CGGCAGCGGGGGCGGGGGCGGGG + Intergenic
938284886 2:130103801-130103823 CAGCAGCAAGAGCGGGAGCGAGG + Intronic
938334390 2:130477850-130477872 CAGCAGCAAGAGCGGGAGCGAGG + Intronic
938335530 2:130492353-130492375 CAGCAGCAAGAGCGGGAGCGAGG + Intronic
938354294 2:130628315-130628337 CAGCAGCAAGAGCGGGAGCGAGG - Intronic
938355436 2:130642818-130642840 CAGCAGCAAGAGCGGGAGCGAGG - Intronic
938422687 2:131156893-131156915 CAGCAGGGACGGCAGGAGCGGGG + Intronic
938430718 2:131235089-131235111 CAGCAGCAAGAGCGGGAGCGAGG - Intronic
939612934 2:144332295-144332317 CAGCAGCGGCGGCTGCGGCGCGG - Intronic
942329506 2:174807151-174807173 CAGCAGCTAAGGTGGGTGTGGGG + Intronic
945649018 2:212537551-212537573 CGGCAGCGGCGATGGGTGCGCGG - Intronic
946659568 2:221984980-221985002 CAGCAGCGAGGCCGGGGGAGGGG + Intergenic
947506657 2:230713050-230713072 CCGCGGCGGCGGCGGCTGCGCGG - Exonic
947626394 2:231621732-231621754 TTGCAGCGGCGGTGGGTGCGGGG + Intergenic
948645373 2:239400864-239400886 CGGCGGCGCGGGCGGGTGCGCGG + Exonic
1172326816 20:34042227-34042249 CAGCTGCCTCGGCGGGAGCGGGG - Intronic
1172698078 20:36835851-36835873 GAGCAGCGGCGGCGGCGGCGGGG - Intronic
1172702693 20:36862903-36862925 GAGCAGCGACGCCGAGTCCGCGG - Exonic
1174049615 20:47758600-47758622 CACCAGCGAAGGTGGGTGCGGGG + Intronic
1174357823 20:50010104-50010126 CAGCGGCGGCGGCGGCGGCGAGG + Intergenic
1175149862 20:56925246-56925268 CCGGAGCGGCGGCGGGCGCGGGG + Intergenic
1175944136 20:62550976-62550998 CGGCAGCGGCGGCGGGCGCAGGG - Exonic
1176029798 20:63006476-63006498 GAGCAGCGGCGGCGGCGGCGCGG - Exonic
1176062255 20:63177611-63177633 CGGCGGCGGCGGCGGGCGCGGGG + Intergenic
1176068951 20:63216134-63216156 CAGCGGCGACGGCGGCGGCAGGG + Exonic
1178487050 21:33025861-33025883 CGGCAGCGGTGGCGGGGGCGGGG - Intronic
1179217493 21:39380304-39380326 CAGCGGCGACCGCGCCTGCGCGG - Exonic
1179516625 21:41912998-41913020 CAGCACTGACGGAGGGGGCGAGG - Intronic
1180475895 22:15706849-15706871 CAGCAGCAAGAGCGGGAGCGAGG - Intronic
1180559045 22:16601351-16601373 CAGCGGCGGCGGCGCGTCCGCGG + Intergenic
1180965139 22:19784309-19784331 CAGCAGCGGCGGCGGGTCCTGGG + Exonic
1182475519 22:30574588-30574610 CGGCAGCGGCGGCGGGGGCGGGG - Intergenic
1183702322 22:39457502-39457524 CAGCGGCGGCGGCGGCTCCGCGG - Exonic
1184250194 22:43255766-43255788 AGGCAGCGAGGGCGGGGGCGGGG + Intronic
950197095 3:11016966-11016988 CAGGAGCAAGGGCGGGTGAGAGG + Intronic
950509901 3:13419955-13419977 CGGCAGAGCCGGCAGGTGCGCGG - Intronic
953399564 3:42600930-42600952 CAGGGGCGAGGGCGGGGGCGAGG - Intronic
954437357 3:50503283-50503305 CAGCAGCCACAGCGGGCGCGGGG + Exonic
954660461 3:52224274-52224296 CAGGAGAGACAGCGGGTGCAGGG + Exonic
955291121 3:57693082-57693104 CAGCAGCGTCTGCGCCTGCGCGG - Exonic
955818776 3:62874801-62874823 GAGCAGCGGCGGCGGGGCCGGGG - Exonic
958175947 3:89996394-89996416 CAGCAGCGAGGGTGGGGGAGAGG + Intergenic
960281322 3:115784283-115784305 CAGCAGCGCGAGCGGGTGGGCGG + Intergenic
960669206 3:120140395-120140417 CAGCAGCTGCGGAGGGTGCGCGG + Intergenic
961502819 3:127349974-127349996 CAGCAGCCTCGGGGGATGCGGGG - Intergenic
961816996 3:129556186-129556208 GAGCAGAGACGGCTGGGGCGGGG - Exonic
961827164 3:129605277-129605299 CGGCGGCGGCGGCGGGGGCGGGG - Intronic
962301863 3:134250565-134250587 CAGCAGCGGCGGCGGCGGCGGGG + Exonic
963870192 3:150408301-150408323 CGGCAGCGGCGGCGGCAGCGGGG + Intergenic
967867731 3:194204138-194204160 CAGCAGCGAAGGCAGCCGCGGGG + Intergenic
968582964 4:1403469-1403491 CAGCGGCGCCGGGGGGCGCGGGG - Exonic
970333016 4:15003729-15003751 CGGCGGCGGCGGCGGGGGCGGGG + Exonic
972817204 4:42657205-42657227 CAGCAAGGAAGGCGGGTGAGGGG + Intergenic
981615458 4:146639371-146639393 CAGCAGCGGCGGCGGGGGCTCGG + Exonic
983137296 4:164101168-164101190 CAGCAGCGAGGCCGGGGGAGGGG + Intronic
987099180 5:14577396-14577418 CAGCAGCTGCGGAGGGTGCACGG + Intergenic
989812680 5:45696275-45696297 CAGCGGCGGCGGCGGGAGCCAGG - Intergenic
990955035 5:61332353-61332375 CAGCGGCGGCGGCGGCGGCGCGG + Exonic
994287846 5:97991734-97991756 CAGCAGCGAGGCTGGGTGTGGGG + Intergenic
996298570 5:121954208-121954230 CAGCGGCGCCGGCGCGGGCGCGG + Intergenic
996405620 5:123099753-123099775 CGGCAGCTCCGGCGGGGGCGCGG - Exonic
996477881 5:123941799-123941821 CAGCAGCGACGCTGGGGGAGGGG + Intergenic
996862823 5:128084262-128084284 CAGCGGCGGCGGCTGGTGCTGGG + Exonic
996948193 5:129094802-129094824 CAACAGCGGCGCCGGGGGCGCGG + Exonic
997201314 5:132011640-132011662 CGGCAGCGGCGGCGGCGGCGCGG - Exonic
997402401 5:133612642-133612664 CGGCGGCCACGGCAGGTGCGCGG + Intergenic
1001361339 5:171089545-171089567 CAGCAGCGAGGCCGGGGGAGGGG - Intronic
1002612787 5:180432313-180432335 CAGCAGCTGTGGAGGGTGCGTGG + Intergenic
1002681629 5:180969684-180969706 CAGCAGCTGTGGAGGGTGCGTGG - Intergenic
1003033118 6:2619854-2619876 CAGCAGCGAGGGCGGCTCCCAGG + Intergenic
1003123239 6:3335266-3335288 CAGCAGCGGCGGAGGCTCCGAGG + Intronic
1004732208 6:18368677-18368699 CAGCAGCAGCAGCGGCTGCGCGG - Intergenic
1005267359 6:24126158-24126180 CGGCGGCGGCGGCGGCTGCGCGG + Intronic
1007557818 6:42782018-42782040 CGGCGGCGGCGGCGGGCGCGGGG - Exonic
1007977872 6:46119868-46119890 CAGCAGCGAGGGTGGGGGAGGGG + Intergenic
1010428230 6:75749396-75749418 CGGGAGCGAAGGCAGGTGCGCGG - Exonic
1012137540 6:95577681-95577703 CAGCAGCGGCGGCAGGCACGAGG + Intronic
1013322618 6:109009543-109009565 CAGCACGGACGGCGGGGGGGCGG + Intronic
1014246896 6:119078799-119078821 CGGCGGCGGCGGCGGCTGCGCGG - Intronic
1019164621 6:170089805-170089827 CAGGGGCGAAGGCGGGAGCGTGG - Intergenic
1022106288 7:27199922-27199944 CTGCAGCGGCGGCGGCTGCCGGG - Exonic
1023418121 7:39950739-39950761 CAGCAGCGGCGGCTGCTGAGGGG - Exonic
1027244653 7:76358921-76358943 CAGCTGAGGCGGCGGCTGCGCGG + Exonic
1028392673 7:90334568-90334590 CAGCAGCTGCGGAGGGTGCGCGG + Intergenic
1029362931 7:100100499-100100521 CGGAAGCGATGGCGGGAGCGGGG - Intronic
1029414815 7:100436133-100436155 CGGCAGCGGCGGCAGGTGAGCGG - Exonic
1033099979 7:138461132-138461154 CAGCGGCGGCGGCGGCGGCGCGG - Intronic
1034483543 7:151341739-151341761 CGACAGCGGCGGCGGGGGCGGGG + Exonic
1034618274 7:152436656-152436678 CAGCGGCGGCGGCGCGTCCGCGG - Intergenic
1036561679 8:9904383-9904405 CAGCAGGGAGGGCGGGAGCGAGG + Intergenic
1037917626 8:22781995-22782017 CAGCAGCCATGGTGGGTGAGAGG + Intronic
1042785093 8:72537379-72537401 CAGCGGCGGCGGCGGCCGCGGGG - Exonic
1044037761 8:87327390-87327412 CAGCAGCGAGGGTGGGGGAGGGG - Intronic
1045547363 8:103140763-103140785 CTGCAGCGCGGGCGGGAGCGGGG + Exonic
1048981713 8:139705995-139706017 CCGCAGCGAGGCCGGCTGCGCGG - Intergenic
1049434229 8:142579140-142579162 CAGCAGCAAGGGCGGGAGCATGG - Intergenic
1049460912 8:142727325-142727347 TAGCGGCGGCGGCGGGCGCGGGG - Exonic
1049645441 8:143733818-143733840 CAGGAGCGACGGGCGGGGCGGGG - Intergenic
1052192789 9:25678177-25678199 CAGCGGCGGCGGCGGCGGCGTGG - Exonic
1057488632 9:95506092-95506114 CGGCAGCGGCGGCGGGCCCGGGG + Intronic
1061196659 9:129110566-129110588 CAGCCGCGGCGGCGGCGGCGCGG - Exonic
1061602277 9:131679053-131679075 CAGCAGTGACTGGGGGTGGGGGG + Intronic
1061765341 9:132878099-132878121 CCACTGCGACGTCGGGTGCGCGG - Intronic
1061790254 9:133055375-133055397 CAGCAGAGACGGGTGATGCGAGG + Intronic
1062314794 9:135961335-135961357 CTGCTGCGGCGGCGGGAGCGAGG - Exonic
1062558713 9:137129598-137129620 AAGCAGCGGCGGCGGATGCGTGG + Intergenic
1062564245 9:137156909-137156931 CATCAGCGACGCCGTGGGCGTGG + Exonic
1062659130 9:137619172-137619194 CAGCGGCGGCGGCGGCGGCGGGG - Intronic
1189324595 X:40105100-40105122 CAGCAGCGGCGGCGGCGGCGAGG + Intronic
1191251906 X:58263838-58263860 CAGCAGCGAGGCCGAGTGCTAGG + Intergenic
1191846559 X:65551551-65551573 CAGCAGCGACGGCGGGTGTGAGG - Intergenic
1192529583 X:71873133-71873155 CAGCAGCAAGGGCGAGGGCGAGG - Intergenic
1196791592 X:119469129-119469151 CGGCAGCGGCCGCGGCTGCGCGG - Intronic
1196808031 X:119605919-119605941 CAGCGGCGGCGGCGGGAGGGGGG + Intergenic
1198275585 X:135095380-135095402 CAGAAGCCACGGGGGGTGGGCGG + Intergenic
1198767126 X:140091427-140091449 CGGCGGCGCCGGCGGCTGCGGGG + Intergenic
1201232642 Y:11879764-11879786 CAGCAGCTGCGGAGGCTGCGTGG - Intergenic