ID: 1083858602

View in Genome Browser
Species Human (GRCh38)
Location 11:65406634-65406656
Sequence GGGTATTCCTTTTTAAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 304}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083858602_1083858606 -7 Left 1083858602 11:65406634-65406656 CCTGTTTTTAAAAAGGAATACCC 0: 1
1: 0
2: 0
3: 23
4: 304
Right 1083858606 11:65406650-65406672 AATACCCTGGCCGGGCGCAGTGG 0: 3
1: 10
2: 140
3: 1129
4: 6156
1083858602_1083858611 21 Left 1083858602 11:65406634-65406656 CCTGTTTTTAAAAAGGAATACCC 0: 1
1: 0
2: 0
3: 23
4: 304
Right 1083858611 11:65406678-65406700 GCCTGTAATCCTAGCACATTGGG 0: 108
1: 17310
2: 245236
3: 277731
4: 220720
1083858602_1083858614 30 Left 1083858602 11:65406634-65406656 CCTGTTTTTAAAAAGGAATACCC 0: 1
1: 0
2: 0
3: 23
4: 304
Right 1083858614 11:65406687-65406709 CCTAGCACATTGGGAGACCAAGG 0: 3
1: 357
2: 11069
3: 106381
4: 225848
1083858602_1083858610 20 Left 1083858602 11:65406634-65406656 CCTGTTTTTAAAAAGGAATACCC 0: 1
1: 0
2: 0
3: 23
4: 304
Right 1083858610 11:65406677-65406699 CGCCTGTAATCCTAGCACATTGG 0: 39
1: 8374
2: 147782
3: 287970
4: 243853

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083858602 Original CRISPR GGGTATTCCTTTTTAAAAAC AGG (reversed) Intronic
904648354 1:31985634-31985656 GGGCCGTCCTCTTTAAAAACGGG - Intergenic
904693378 1:32312014-32312036 TGGTTTGCCTTTTTAGAAACAGG + Intronic
906889964 1:49700245-49700267 GGGTATTTCATTTTGAAAAAGGG + Intronic
909613146 1:77574637-77574659 GGATTTTCCTTGTTAAAAATGGG + Intronic
909628160 1:77742653-77742675 GGTTGTACCTTTTTAATAACAGG + Intronic
910516078 1:88061464-88061486 GTGTTTTTCTTTTGAAAAACAGG - Intergenic
912339884 1:108902940-108902962 GGGTATTCTTTTTTTTAATCTGG + Intronic
912662183 1:111542027-111542049 AGGTATTCCTCTTTAAAGAAAGG - Intronic
914776161 1:150737476-150737498 AGGACTTTCTTTTTAAAAACAGG - Intronic
917756285 1:178102186-178102208 GGGTATTAATTTTTAATGACAGG - Intronic
918152791 1:181812759-181812781 GGATTTTCCATTTTAAAACCAGG - Intergenic
920448376 1:206037846-206037868 GCCTCTTCCTTTTTCAAAACTGG + Intronic
921630743 1:217430762-217430784 GTCTATTCCATTTTAGAAACTGG + Exonic
921774723 1:219083614-219083636 TGAAATTCATTTTTAAAAACTGG - Intergenic
922127464 1:222742363-222742385 TGGTATTACTTTTTAAAAGGCGG - Intronic
922582662 1:226710260-226710282 AGTTATTTCTTTTTAGAAACGGG + Intronic
923845765 1:237729982-237730004 GTTTATTCCTTTATAAAACCAGG - Intronic
923882015 1:238114093-238114115 GTGTCTCACTTTTTAAAAACTGG + Intergenic
924075670 1:240333253-240333275 GGATATTTCTATTTAAAAAAAGG - Intronic
1063273036 10:4533431-4533453 GAGTATAACTTTTTAAAAATTGG - Intergenic
1063337657 10:5232073-5232095 GGGTATCCCTTTTTGATAAATGG + Intergenic
1065812109 10:29451782-29451804 GGCCATTCATTATTAAAAACAGG - Intergenic
1065845756 10:29741666-29741688 GTGTATTTCTTTTTAAAAGTAGG - Intergenic
1066194596 10:33086696-33086718 TATTATTCCTTTTTAAAATCTGG + Intergenic
1068665790 10:59674507-59674529 GGATTTTCCTTTTAAAATACTGG - Intronic
1069132373 10:64722464-64722486 GGATTTACTTTTTTAAAAACTGG + Intergenic
1069503178 10:68972633-68972655 GGGACTTCCTTTTTAAGAATTGG - Intronic
1070044716 10:72821402-72821424 GTGTATTCCTTCTAGAAAACTGG + Intronic
1072238744 10:93475742-93475764 GGGTTTTCCTTTCTAATCACGGG - Intronic
1072822580 10:98572716-98572738 GGGATTTTCTTTTTAAAAAGAGG - Intronic
1073726114 10:106232920-106232942 TGTTATTTATTTTTAAAAACAGG + Intergenic
1074974422 10:118568562-118568584 CGGTTTTCCTTTTTAATATCTGG + Intergenic
1076309094 10:129490508-129490530 GATTATTCTTTTTTAAAAACTGG + Intronic
1076617612 10:131766503-131766525 AGGTATGCCCTTTTAAAAAAAGG - Intergenic
1077748923 11:4941725-4941747 GGTTATTCATTTTTATAAAAAGG + Intronic
1077998581 11:7474937-7474959 GGGTTTTCATTTTTAATAAATGG + Intergenic
1078733691 11:14000317-14000339 GGGTATTGCTTTATAAAATATGG - Intronic
1078976969 11:16488558-16488580 AGGCATTCCTCTTTAAAAAGTGG - Intronic
1080274017 11:30483278-30483300 GGCTATTTCTTCTGAAAAACAGG + Intronic
1081058524 11:38442360-38442382 GGGGATTCTATTTTATAAACTGG - Intergenic
1081287020 11:41282902-41282924 TGGTATTCTTTTATCAAAACAGG + Intronic
1081410615 11:42753462-42753484 AAGTATTCCCTTTGAAAAACCGG - Intergenic
1082603163 11:55186843-55186865 GGTAATTCCTTTTTCAAAATAGG + Intergenic
1082605063 11:55217113-55217135 GATAATTCCTTTTTAAAAATAGG + Intergenic
1082606778 11:55245705-55245727 GGATATTCCTTTTCCAAAATAGG - Intergenic
1083858602 11:65406634-65406656 GGGTATTCCTTTTTAAAAACAGG - Intronic
1085239204 11:75037912-75037934 TGTCATTCCTTTTTAAAAAACGG + Intergenic
1086014869 11:82155225-82155247 GAGTTTTCATTTTTAAAAAATGG - Intergenic
1086538434 11:87878596-87878618 GGAAATTGCTTTTTTAAAACTGG - Intergenic
1086607459 11:88713007-88713029 AGTTATTCCTTTTTGTAAACTGG - Intronic
1087712610 11:101571047-101571069 GCGTATTCAATTTTGAAAACAGG + Intronic
1088389745 11:109300861-109300883 GGGTCTTCATTTTTAAAGATGGG + Intergenic
1089400792 11:118163455-118163477 AGCTTTTCCTTTTTATAAACTGG + Exonic
1091179283 11:133588963-133588985 GAGAATTTTTTTTTAAAAACTGG + Intergenic
1093536462 12:20229521-20229543 AAGCATTCCTTTTTAAAAAAAGG - Intergenic
1095868500 12:47000078-47000100 GTATATAACTTTTTAAAAACTGG + Intergenic
1096116670 12:49059401-49059423 GGGTGTGCCTCTTTAAAGACTGG - Intronic
1096632613 12:52938474-52938496 TGTTTTTCCTTTTTAATAACAGG + Intronic
1098710344 12:73750434-73750456 GGTTGTTCCTTTTTAGAAACAGG + Intergenic
1098932207 12:76432280-76432302 GTGTATTCCTTTTTAAATGTAGG - Intronic
1099064858 12:77963233-77963255 GGGAAATCCATATTAAAAACAGG + Intronic
1099504894 12:83461632-83461654 GGTTAGTCCTTTTGAAGAACAGG + Intergenic
1100185456 12:92134188-92134210 TGGGATTCCTTTTTAAAATGAGG + Intronic
1100344445 12:93713862-93713884 GGCTTTTCCTTTTTAAAACGTGG + Intronic
1104461596 12:128960812-128960834 GGACATTCCTTCTTAAAAAATGG - Intronic
1105329864 13:19405560-19405582 AGGTATTGCTTTTTAAAAAATGG - Intergenic
1105824166 13:24107417-24107439 GGGTATTTCTTTTTAACATTTGG - Intronic
1105861953 13:24423630-24423652 AGGTATTGCTTTTTAAAAAATGG + Intronic
1106274070 13:28187025-28187047 GGCTTTTTCTTTTTAAAGACGGG - Intronic
1106543811 13:30713621-30713643 GGGTCCTCCTCTTCAAAAACGGG - Intronic
1107340792 13:39403232-39403254 GGATGTTCCCTTTTATAAACAGG - Intronic
1107919311 13:45186918-45186940 GAAAATTCCTTTTTAAAAACAGG - Intronic
1108829809 13:54463678-54463700 GTGTTTTCATTTTTAAAAACTGG - Intergenic
1109132643 13:58607869-58607891 GGGTATTCTTATTTTAATACGGG + Intergenic
1109407150 13:61917207-61917229 GAGAATCACTTTTTAAAAACAGG + Intergenic
1109566508 13:64122512-64122534 GGGTCATCTTTTTTAAATACTGG + Intergenic
1110587754 13:77214545-77214567 GGCTATTACCTTTAAAAAACGGG + Intronic
1110831518 13:80037060-80037082 GGAGATGCCTTTTTAAAAAGAGG - Intergenic
1110969461 13:81742734-81742756 GATTATTACTTTTTAAAAAAAGG - Intergenic
1111412888 13:87899322-87899344 GAATATTACTTTTTAAAAAGTGG - Intergenic
1112748769 13:102558504-102558526 TAGTATGCCTCTTTAAAAACAGG - Intergenic
1115030711 14:28790244-28790266 GAGTTTTCTTTTTTAAAAACAGG - Intronic
1116378252 14:44231486-44231508 GGGTAATTTTTTTAAAAAACAGG + Intergenic
1117977473 14:61312552-61312574 GGGTAATTTTTTTTAAAAAGAGG + Intronic
1119002942 14:70899450-70899472 GGTTATTACTTTTTAAAAATTGG + Intergenic
1119686534 14:76637157-76637179 CTGGATTCCTTTTTAAAAAGAGG - Intergenic
1120241442 14:81954063-81954085 TGGTATACCTTTATGAAAACTGG - Intergenic
1121368833 14:93338410-93338432 GGGTAATCTATTTTAAAAAGAGG - Intronic
1122573493 14:102725371-102725393 TGGGAGTCCTTTTTAAAAAATGG + Intronic
1125982154 15:44012532-44012554 TGGTATGCCTCTTTCAAAACCGG + Intronic
1126136882 15:45401517-45401539 GGGAATTCCTTTTTATCAGCTGG - Intronic
1129497410 15:75998336-75998358 GGGTTTTACTTTTTAAAAAGTGG + Intronic
1131480046 15:92773030-92773052 GGTTATTCCATTTCTAAAACAGG - Intronic
1131889116 15:96952815-96952837 GGGTATGTCGCTTTAAAAACTGG + Intergenic
1133286118 16:4691687-4691709 GGGGAGTCAGTTTTAAAAACAGG + Intergenic
1135080833 16:19433618-19433640 GTGTAGTCCTCTTGAAAAACTGG + Intronic
1135413059 16:22249609-22249631 AGGTATTCTTTTTTAGAGACAGG + Intronic
1137655712 16:50156110-50156132 AGGGATTACTGTTTAAAAACTGG + Intronic
1138169555 16:54836096-54836118 GAGTTTTCCATTTTAAAACCAGG - Intergenic
1138809786 16:60135692-60135714 AAGCATTCCTTTTTAAGAACTGG - Intergenic
1139391300 16:66607640-66607662 GGGTGTTACTTTTTGGAAACTGG + Intronic
1140971365 16:80016186-80016208 GAGTTTTTCTTTTTAAAAAAAGG - Intergenic
1141198496 16:81879334-81879356 AGGTATTTCTTTTTAAAAAGGGG - Intronic
1143245543 17:5482323-5482345 GGGTTTTCCTTTCAACAAACCGG + Intronic
1143929507 17:10407185-10407207 AGGTATTCCTTTGTAACACCAGG + Intronic
1144102581 17:11955481-11955503 AGGTCTTGCTTTTTAAAAATTGG - Intronic
1146382779 17:32343381-32343403 CACTATTCCTTTTTAAAAATAGG - Intronic
1149812590 17:59692006-59692028 AGGGATGACTTTTTAAAAACTGG + Intronic
1150062001 17:62076473-62076495 AGTTATTCCTTTTCAAAAAGGGG + Intergenic
1152871855 17:82758565-82758587 TGGAATTCCTTTTTAGAAAAAGG + Intronic
1203166935 17_GL000205v2_random:106111-106133 GGTTGTTCATTTTTAAAAATAGG + Intergenic
1153208123 18:2726674-2726696 ATGTTTTCCTTTTTAAAAACTGG - Intronic
1156021996 18:32610083-32610105 GTTTATTTCTTTTTAAATACTGG - Intergenic
1156195579 18:34770744-34770766 GAGTATGCATTTTTAAAAATTGG - Intronic
1156525363 18:37762539-37762561 TGGTATTTCTCTTTAAAATCAGG + Intergenic
1156584590 18:38417841-38417863 GGTTATTGCATTTTAAAAATAGG - Intergenic
1156706418 18:39888555-39888577 GGGTATTTTTTTGTAGAAACAGG - Intergenic
1159209776 18:65302912-65302934 GTGTATTCCTTACAAAAAACTGG - Intergenic
1159328503 18:66955701-66955723 GGGTCATCTTTTTTAAATACTGG - Intergenic
1162508441 19:11102272-11102294 GGGTTTTCCTTTGCAAAGACAGG + Intronic
1164045885 19:21541223-21541245 GGGCATTCCATTTTATTAACTGG + Intronic
1164331513 19:24263058-24263080 GAATATTCCTTGATAAAAACTGG - Intergenic
1164335625 19:24316901-24316923 GAATATTCCAGTTTAAAAACTGG + Intergenic
1164519260 19:28965545-28965567 GGGTATAACTTTTTAAAATCAGG + Intergenic
1165672780 19:37693594-37693616 ATTTATTACTTTTTAAAAACAGG + Intronic
927099710 2:19778743-19778765 GGGAATTGCTGTTTGAAAACAGG + Intergenic
928249183 2:29659996-29660018 GGGTATCACTTTTTAAAAGATGG - Intronic
929118090 2:38461825-38461847 GTATATTACTTTTTAAAAATTGG + Intergenic
929641561 2:43585205-43585227 GGGTAGTCATGTTTAATAACGGG - Intronic
930388902 2:50735615-50735637 GGATATTTATTTTTAAAGACAGG - Intronic
931036545 2:58250717-58250739 TGCTATTCCTTTTTCAAAATAGG + Intergenic
931544294 2:63364043-63364065 GAGTATTTTTTTTTAAAGACAGG - Intronic
931654207 2:64495996-64496018 GTGTATATTTTTTTAAAAACGGG + Intergenic
931900192 2:66779915-66779937 GGGTATTCCATTATAGCAACAGG - Intergenic
932765989 2:74470412-74470434 ACCCATTCCTTTTTAAAAACAGG - Intergenic
933256710 2:80089210-80089232 GAAGATTCCATTTTAAAAACTGG - Intronic
933631207 2:84661267-84661289 GATATTTCCTTTTTAAAAACTGG - Intronic
935302511 2:101705096-101705118 GGACATCCCGTTTTAAAAACTGG + Intronic
935833117 2:107021272-107021294 GGGTAATTCATTTTAAAAAGAGG - Intergenic
937637373 2:124171110-124171132 GGTTATTGCTTTTTCAAAACAGG + Intronic
937719941 2:125082293-125082315 TGGTATTCCTTTATAACACCAGG + Intergenic
937721417 2:125101066-125101088 GTGACTTCCTTTTGAAAAACAGG - Intergenic
938213225 2:129485985-129486007 GAGTATTCCTTCATAACAACCGG + Intergenic
939256228 2:139747593-139747615 GGGTATTCAATTCCAAAAACAGG - Intergenic
939423615 2:142005503-142005525 AGGCATTTCATTTTAAAAACAGG - Intronic
943308104 2:186292158-186292180 GTGTATTCCTTTTTTAACCCTGG - Intergenic
944279327 2:197876847-197876869 TGGTATTAATTTTTAAAAATAGG + Intronic
944386827 2:199174895-199174917 GGGTATGACCTTTGAAAAACTGG + Intergenic
944659227 2:201907011-201907033 GGTGATTCATTTTTAAAAAGAGG - Intergenic
945531351 2:210957633-210957655 AAGTTCTCCTTTTTAAAAACAGG + Intergenic
946665563 2:222046266-222046288 GGCAATTCATTTTTAAAAAGAGG - Intergenic
946765737 2:223038412-223038434 GGGTGTTTATTTTTAAAAAAAGG + Intergenic
947065661 2:226221950-226221972 GGGTTGTACTTTTTAAAAACTGG + Intergenic
1168820598 20:770823-770845 GGGTATTCCTTCTGGCAAACAGG + Intergenic
1169653094 20:7891686-7891708 GGTTATTGTTTTTTAAAAAACGG + Intronic
1170291509 20:14775305-14775327 GGGTAATTTATTTTAAAAACAGG + Intronic
1176334624 21:5584446-5584468 GGTTGTTCATTTTTAAAAATGGG - Intergenic
1176393133 21:6236502-6236524 GGTTGTTCATTTTTAAAAATGGG + Intergenic
1176404820 21:6352986-6353008 GGTTGTTCATTTTTAAAAATAGG - Intergenic
1176432337 21:6636118-6636140 GGTTGTTCATTTTTAAAAATAGG + Intergenic
1176468286 21:7079672-7079694 GGTTGTTCATTTTTAAAAATGGG - Intronic
1176491847 21:7461450-7461472 GGTTGTTCATTTTTAAAAATGGG - Intergenic
1176508795 21:7676933-7676955 GGTTGTTCATTTTTAAAAATGGG + Intergenic
1176998772 21:15586272-15586294 TGGAATTGCTTTTTAAAAGCAGG + Intergenic
1177475233 21:21611683-21611705 GGGTAATCCATTTTAAAAATAGG - Intergenic
1177697361 21:24590840-24590862 GGGTTTTCTTTTTTATAAAAAGG + Intergenic
1178380295 21:32102129-32102151 GGGTATTAGTTTTTAAAGTCAGG - Intergenic
1180565030 22:16656265-16656287 AGGTATTGCTTTTCAAAAAATGG + Intergenic
1180720037 22:17901250-17901272 AGGGATTCCTCTTTAAAAAAGGG + Intronic
1180885274 22:19239085-19239107 GGGCATTCCTTTCTACGAACAGG + Intronic
1183331200 22:37222568-37222590 AGGTCTTCCTGTTTCAAAACAGG + Intergenic
1184707802 22:46226943-46226965 TGGAATTCCTCTTTCAAAACTGG - Intronic
949261657 3:2108438-2108460 GGATATTCATTTTTAAAACCAGG + Intronic
949913670 3:8938724-8938746 GGGTTGTTCTTTTTAAAAATAGG - Intronic
950987981 3:17396538-17396560 GAGTATTTCTTTTTCAAAATAGG + Intronic
951362179 3:21738366-21738388 TGGTCTTCCCATTTAAAAACAGG + Intronic
951470467 3:23051057-23051079 GGGTATTCCTTATTTAATATAGG - Intergenic
952217174 3:31289094-31289116 AGGTTTTTATTTTTAAAAACGGG - Intergenic
955013467 3:55044317-55044339 AGGTATAACGTTTTAAAAACTGG - Intronic
956758602 3:72416162-72416184 AGTTATTCCTTTTTGAGAACGGG - Intronic
957199457 3:77113352-77113374 AGGTAGTCCTTCTTAACAACAGG - Intronic
957864436 3:86003910-86003932 ACGAATTCCTTTTTAAAATCTGG - Intronic
958700314 3:97580797-97580819 GGCTATTCCTTTTTGTAAGCTGG - Intronic
959941811 3:112087956-112087978 GGGAATGCCTTGTTGAAAACAGG + Intronic
960180816 3:114574943-114574965 GGGTATTTCTATATAAAGACAGG + Intronic
961095682 3:124154288-124154310 GGGTATTCAATTACAAAAACAGG + Intronic
961678273 3:128581628-128581650 GGCTTTTCCTTTTTAAATATTGG - Intergenic
963969906 3:151418250-151418272 AGATATTCTTTTATAAAAACTGG + Intronic
963988001 3:151619565-151619587 GCATATTCATTATTAAAAACTGG - Intergenic
964005416 3:151821075-151821097 GGGCACTCATTTTTAAAGACTGG - Intronic
967693306 3:192502516-192502538 GGTTATTTCATTTTAAACACTGG - Intronic
968247313 3:197165159-197165181 GTGTATTCCTTGTCAACAACTGG - Intronic
969476137 4:7423420-7423442 GGTTTTTGCTTTTTAGAAACAGG + Intronic
970127390 4:12830333-12830355 GTGTAATCCGTTTTAAAAATCGG - Intergenic
970145618 4:13032543-13032565 GGGTCTTGCTCTTTGAAAACTGG - Intergenic
970534382 4:17014371-17014393 AGGTACTCTTTTTTAAAAATCGG + Intergenic
973131898 4:46658241-46658263 GGGTATTCTTTCTTTAAAAGGGG - Intergenic
973192556 4:47402107-47402129 TTGTTTTCCTTTTTAAAAGCGGG + Intronic
973959787 4:56098557-56098579 CATTATTCATTTTTAAAAACTGG + Intergenic
975988057 4:80223894-80223916 AGGTATTACTTTTTTAATACAGG - Intergenic
976078475 4:81326419-81326441 GGTTATTGTTTTTGAAAAACTGG + Intergenic
976390486 4:84499704-84499726 GGGTATTACTTTTTAAAGAGAGG + Intergenic
978396701 4:108288264-108288286 GTGTATTTTTTTTTAAATACAGG + Intergenic
978469025 4:109041364-109041386 GGGGATTTTTTTTTAAAAAAGGG - Intronic
978557519 4:109996932-109996954 GTGAAATGCTTTTTAAAAACAGG + Intronic
978649137 4:110979486-110979508 GTGTGTTCCTTTTGAACAACTGG + Intergenic
978837452 4:113169462-113169484 AGTCATTCCTTTGTAAAAACAGG - Intronic
978985183 4:115003557-115003579 CTGTATTCTTTTTTAAAAAAAGG + Intronic
980336878 4:131486856-131486878 GGGTATGCTTTTTGAAGAACTGG + Intergenic
980682550 4:136183374-136183396 GGATATGTCTTTTTAAAAATAGG - Intergenic
984145088 4:176050681-176050703 AGATATTGGTTTTTAAAAACAGG + Intergenic
984180765 4:176479948-176479970 GGGCTTTCCATTTTAAAACCAGG - Intergenic
984301680 4:177927690-177927712 ATTTATTCCATTTTAAAAACTGG + Intronic
986161804 5:5236952-5236974 GTGTATTTCTTTTTAAGATCAGG + Exonic
986525991 5:8676171-8676193 TGAAATTCCTTTTTAAAAAGCGG - Intergenic
988079056 5:26392771-26392793 GGTTATTTGTTTTTAAAAAGAGG + Intergenic
988769543 5:34418011-34418033 GGGTGTTCTTTTTAAAAAAAAGG + Intergenic
988920126 5:35933539-35933561 GGGCACTCATTTATAAAAACTGG + Intronic
989431131 5:41356596-41356618 CCGTTTTCATTTTTAAAAACAGG - Intronic
989836817 5:46003993-46004015 AGGTAGTCAATTTTAAAAACTGG + Intergenic
992902038 5:81306569-81306591 GGATATTGTTTTTTAAAAAGGGG + Intronic
993191996 5:84695344-84695366 AGGTATTCCTAGTTAAAAATAGG - Intergenic
993575590 5:89595861-89595883 TTGTATTGCTGTTTAAAAACTGG + Intergenic
994380346 5:99063362-99063384 ACATATTCCTTTTTAAAAATAGG - Intergenic
995073443 5:107951906-107951928 GAGTTTTGCTTTTTTAAAACTGG - Intronic
996300463 5:121977359-121977381 TTGTAATGCTTTTTAAAAACTGG + Intronic
998653345 5:144146033-144146055 GGATATTACCTTTTAAAAAATGG - Intergenic
998706818 5:144771712-144771734 TGATGTTCATTTTTAAAAACTGG - Intergenic
998845041 5:146300317-146300339 GGGTTTTTTTTTTTAAAAAAAGG - Intronic
999819375 5:155210300-155210322 TGGTATTCATGTTTAAAAAGAGG - Intergenic
999864815 5:155689254-155689276 GTGTATTCTTTTTTAAAATTAGG - Intergenic
1000381558 5:160634305-160634327 GGGTATTTCCTTTTAGAAAGAGG + Intronic
1000673397 5:164090333-164090355 GGGCATTCCCTTTGAAATACTGG - Intergenic
1000982936 5:167836032-167836054 GAATATACCTTTTTTAAAACTGG + Intronic
1003991864 6:11494216-11494238 GGGTAGTACTTTTTTCAAACGGG - Intergenic
1004059863 6:12183199-12183221 TTGTAATCCTTTTGAAAAACAGG + Intergenic
1004108989 6:12696015-12696037 GGGAATTTAGTTTTAAAAACTGG + Intergenic
1004144952 6:13057273-13057295 GTGTATTAATTTTTAAAAAAAGG + Intronic
1004363041 6:14987832-14987854 GTGTATGTCTTTTTAAAAATTGG + Intergenic
1005131571 6:22514527-22514549 AGCTATTGCTTTTTAACAACTGG - Intergenic
1007118066 6:39357945-39357967 ATGTATTCCTTTTTAAAGATAGG + Intronic
1007199633 6:40096032-40096054 GGGTTTTTCTTTTTAAACATGGG - Intergenic
1008309629 6:49950749-49950771 GGGTATTCTTTTTTAAGACCTGG - Intergenic
1008350755 6:50487231-50487253 GGGTATTCATTTAGGAAAACAGG + Intergenic
1009318221 6:62250804-62250826 GGTTATTTCTATTTAAAAAGGGG + Intronic
1009768488 6:68114023-68114045 GGGAATTCGTTTTTTAAAATGGG - Intergenic
1010161856 6:72866057-72866079 TAGTATTCCTGTTTAAAAAATGG - Intronic
1010396621 6:75400271-75400293 GGGTTTTCTTTTTTAAATAAAGG - Intronic
1010813996 6:80333452-80333474 ACATATTCCTTTTTTAAAACAGG + Intronic
1010828882 6:80506950-80506972 TGGTATTCCTTTTAAAAGACAGG - Intergenic
1011756613 6:90505624-90505646 GTTTCTTCCTTTTTAAAAGCAGG - Intergenic
1012322783 6:97871795-97871817 TGGTTTTCCTTTTTGAGAACTGG + Intergenic
1012788032 6:103657422-103657444 GGGTAATTTTTTTTAAAAAGGGG + Intergenic
1013290377 6:108714284-108714306 GTGTTCTCCCTTTTAAAAACTGG - Intergenic
1013719714 6:113009786-113009808 GGGTATACATTTTTATATACTGG - Intergenic
1014251128 6:119116512-119116534 AAGTTTTCTTTTTTAAAAACAGG - Intronic
1014376800 6:120685864-120685886 GGATATTCTTTTTGAAAAAAGGG + Intergenic
1014451768 6:121589960-121589982 GTATATTCCTTTTTAAGGACTGG + Intergenic
1015748780 6:136539245-136539267 GTGTCTTCCTTTTTAAAATAGGG - Intronic
1016407648 6:143747241-143747263 GTGTATTCCTTTTTAAATCCTGG - Intronic
1016462678 6:144294525-144294547 AAGTATTCCCTTTTAAAAAATGG - Intronic
1018527240 6:164726307-164726329 AGGTTTTCCTTTGTGAAAACTGG - Intergenic
1019662928 7:2235275-2235297 GGACATTCCTTTGTAAAACCTGG - Exonic
1020038951 7:4986743-4986765 GGTTATTCTTGTTTAGAAACAGG + Intronic
1020156346 7:5727721-5727743 GGTTATTCTTGTTTAGAAACAGG - Intronic
1021209990 7:17837482-17837504 GGATTTTACTTATTAAAAACAGG + Intronic
1022560190 7:31339695-31339717 AGATAGTCCATTTTAAAAACTGG - Intronic
1023316548 7:38943618-38943640 GAGGTTTACTTTTTAAAAACAGG + Intergenic
1023329104 7:39094859-39094881 GTGTATACATTTTTAAATACAGG - Intronic
1023727409 7:43158552-43158574 GGGTACCGCTTTTTAAAAACTGG + Intronic
1025580565 7:62710160-62710182 GGTATTTCCTTTTTAAAAATAGG + Intergenic
1025950967 7:66145186-66145208 GCATATGCCATTTTAAAAACAGG - Intronic
1027226155 7:76244813-76244835 GGATTTTCCTTTTGAAAAAATGG - Intronic
1031043911 7:116865879-116865901 TGGTATTACTTTTTAAAAAAGGG - Intronic
1031410262 7:121433198-121433220 GTAGATACCTTTTTAAAAACAGG - Intergenic
1031488082 7:122353901-122353923 GGCTGTTCCTTTTTCCAAACAGG + Intronic
1034107162 7:148500318-148500340 GGGTATTTCTTTTTCATGACAGG - Intergenic
1035909467 8:3549599-3549621 GAGTGTGGCTTTTTAAAAACAGG + Intronic
1036042537 8:5101945-5101967 GGTTCTTGCTTTTTAAAATCAGG + Intergenic
1036793780 8:11741039-11741061 TGGGATACCATTTTAAAAACAGG - Intronic
1039142689 8:34410748-34410770 TAGTATTACTTTTTAAAAAAAGG + Intergenic
1040039615 8:42902945-42902967 GGGTTTTCTTTTTTGAAAATGGG + Intronic
1040596484 8:48842331-48842353 AAGTATTCATTTTTAAAAGCAGG + Intergenic
1045336746 8:101211508-101211530 GGGTAATCATTTTCAAATACTGG - Intergenic
1046080364 8:109363122-109363144 GGGTATTACTTTGAAAACACAGG - Intronic
1046809758 8:118519742-118519764 TGGTTCTCCTTTTTAAAAAATGG - Intronic
1047676647 8:127209857-127209879 GGTTATTCCTTTCTAAGTACAGG - Intergenic
1048815652 8:138331417-138331439 ATTAATTCCTTTTTAAAAACAGG + Intronic
1049131024 8:140841532-140841554 TGGAATGCCTTTTTAAAAATCGG + Intronic
1049487066 8:142871343-142871365 AGGTAGTCCTTGTTATAAACTGG + Intronic
1049922301 9:376617-376639 CGGAATTTCTTTTTAAAAGCTGG - Intronic
1050039468 9:1474063-1474085 TGTTTTTCCTTTTTAAAATCTGG - Intergenic
1050437238 9:5624106-5624128 AGGGAATGCTTTTTAAAAACTGG + Intergenic
1051841820 9:21406380-21406402 GGGTTTTCCTTTTGTAAAAAAGG + Intergenic
1051945138 9:22559968-22559990 GGGTAATGCATTTTAAAAAGAGG - Intergenic
1052215462 9:25961620-25961642 GGGTTTTCTTTTCTCAAAACAGG + Intergenic
1052601062 9:30631742-30631764 AGGGATTATTTTTTAAAAACAGG - Intergenic
1053296424 9:36917451-36917473 GGGGATTCCCTTACAAAAACTGG - Intronic
1054864308 9:69984225-69984247 AGGTATTCCTGAGTAAAAACAGG - Intergenic
1055018493 9:71644757-71644779 TAGGATTCCTTGTTAAAAACAGG - Intergenic
1056113666 9:83421273-83421295 AGGTATTCCTTTATAGCAACAGG + Intronic
1056334337 9:85551236-85551258 AGGTATTCCTTTATAGCAACTGG - Intronic
1057325544 9:94060506-94060528 TGGTATTCCTTTATAGCAACGGG - Intronic
1057489809 9:95511818-95511840 GGAAATTGCTTTTTAAAAACTGG + Intronic
1057535697 9:95902618-95902640 GGGGATTACTTTTTGATAACTGG + Intronic
1059890322 9:118794868-118794890 GGATCTTCCTTTCTAAAAAGTGG + Intergenic
1060941053 9:127543031-127543053 GGTTTTTCCTTGTTAATAACTGG - Intronic
1203427008 Un_GL000195v1:50475-50497 GGTTGTTCATTTTTAAAAATGGG + Intergenic
1203439201 Un_GL000195v1:172594-172616 GGTTGTTCATTTTTAAAAATAGG - Intergenic
1186032334 X:5381805-5381827 AAGGATTCATTTTTAAAAACCGG + Intergenic
1186106690 X:6215215-6215237 GGGTATTCCTTTTTCATTGCAGG + Intronic
1187317727 X:18212485-18212507 CTGTATTTCTTTTTAAAAAATGG - Intronic
1189212890 X:39299698-39299720 GAGTTTTCTTTTTTAAAAAATGG - Intergenic
1189506879 X:41620190-41620212 CACTATTCCCTTTTAAAAACAGG - Intronic
1191574701 X:62686786-62686808 AGTTATTCCTTTTTCACAACAGG - Intergenic
1192820920 X:74644423-74644445 AGGTAATCCAATTTAAAAACAGG - Intergenic
1193756158 X:85411032-85411054 GGGTATATATTTTTAAAAAATGG - Intergenic
1193819583 X:86146282-86146304 GGATTTCTCTTTTTAAAAACTGG + Intergenic
1194473476 X:94328448-94328470 GGCCATACATTTTTAAAAACAGG - Intergenic
1195636736 X:107125493-107125515 AGGTATTACACTTTAAAAACTGG - Intronic
1197060797 X:122178193-122178215 GGGTAATCATTTTCTAAAACAGG + Intergenic
1197329296 X:125133809-125133831 GGAAATTGTTTTTTAAAAACGGG + Intergenic
1198088266 X:133301979-133302001 GGGTGTTTTTTTTTAAAACCAGG - Exonic
1198167023 X:134067999-134068021 AGGAGTTCCTTTTTAAAAAATGG - Intergenic
1198174114 X:134138058-134138080 TCTTATTCCTTATTAAAAACTGG - Intergenic
1198200252 X:134409227-134409249 AGGTATCCATTTTTAAAAAATGG + Intronic
1199405308 X:147451383-147451405 GGGTAGTCTTTTCAAAAAACTGG + Intergenic
1199483145 X:148320400-148320422 GGGTACTCATTTTTAAAATGAGG - Intergenic