ID: 1083859389

View in Genome Browser
Species Human (GRCh38)
Location 11:65411867-65411889
Sequence ATGGAGCACCAGCAGGAGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 497
Summary {0: 1, 1: 1, 2: 6, 3: 47, 4: 442}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083859389_1083859392 -9 Left 1083859389 11:65411867-65411889 CCTTCCTCCTGCTGGTGCTCCAT 0: 1
1: 1
2: 6
3: 47
4: 442
Right 1083859392 11:65411881-65411903 GTGCTCCATCCCCCAATACCAGG 0: 1
1: 0
2: 0
3: 12
4: 151
1083859389_1083859403 14 Left 1083859389 11:65411867-65411889 CCTTCCTCCTGCTGGTGCTCCAT 0: 1
1: 1
2: 6
3: 47
4: 442
Right 1083859403 11:65411904-65411926 CTGGGCCACCACTCTGAGGAGGG 0: 2
1: 0
2: 0
3: 25
4: 230
1083859389_1083859401 10 Left 1083859389 11:65411867-65411889 CCTTCCTCCTGCTGGTGCTCCAT 0: 1
1: 1
2: 6
3: 47
4: 442
Right 1083859401 11:65411900-65411922 CAGGCTGGGCCACCACTCTGAGG 0: 2
1: 0
2: 1
3: 25
4: 302
1083859389_1083859409 23 Left 1083859389 11:65411867-65411889 CCTTCCTCCTGCTGGTGCTCCAT 0: 1
1: 1
2: 6
3: 47
4: 442
Right 1083859409 11:65411913-65411935 CACTCTGAGGAGGGTAGGAGGGG 0: 1
1: 0
2: 1
3: 25
4: 339
1083859389_1083859408 22 Left 1083859389 11:65411867-65411889 CCTTCCTCCTGCTGGTGCTCCAT 0: 1
1: 1
2: 6
3: 47
4: 442
Right 1083859408 11:65411912-65411934 CCACTCTGAGGAGGGTAGGAGGG 0: 1
1: 1
2: 1
3: 20
4: 321
1083859389_1083859404 18 Left 1083859389 11:65411867-65411889 CCTTCCTCCTGCTGGTGCTCCAT 0: 1
1: 1
2: 6
3: 47
4: 442
Right 1083859404 11:65411908-65411930 GCCACCACTCTGAGGAGGGTAGG 0: 2
1: 0
2: 3
3: 15
4: 187
1083859389_1083859406 21 Left 1083859389 11:65411867-65411889 CCTTCCTCCTGCTGGTGCTCCAT 0: 1
1: 1
2: 6
3: 47
4: 442
Right 1083859406 11:65411911-65411933 ACCACTCTGAGGAGGGTAGGAGG 0: 1
1: 0
2: 2
3: 13
4: 178
1083859389_1083859395 -4 Left 1083859389 11:65411867-65411889 CCTTCCTCCTGCTGGTGCTCCAT 0: 1
1: 1
2: 6
3: 47
4: 442
Right 1083859395 11:65411886-65411908 CCATCCCCCAATACCAGGCTGGG 0: 1
1: 0
2: 1
3: 34
4: 176
1083859389_1083859402 13 Left 1083859389 11:65411867-65411889 CCTTCCTCCTGCTGGTGCTCCAT 0: 1
1: 1
2: 6
3: 47
4: 442
Right 1083859402 11:65411903-65411925 GCTGGGCCACCACTCTGAGGAGG 0: 2
1: 0
2: 2
3: 19
4: 147
1083859389_1083859393 -5 Left 1083859389 11:65411867-65411889 CCTTCCTCCTGCTGGTGCTCCAT 0: 1
1: 1
2: 6
3: 47
4: 442
Right 1083859393 11:65411885-65411907 TCCATCCCCCAATACCAGGCTGG 0: 1
1: 0
2: 1
3: 28
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083859389 Original CRISPR ATGGAGCACCAGCAGGAGGA AGG (reversed) Exonic
900467026 1:2830868-2830890 ATGAAGCAGCAGCAGGCGGCGGG - Intergenic
901213635 1:7540899-7540921 TTGCTGCACCAACAGGAGGAGGG + Intronic
901226614 1:7616694-7616716 ATGGAACACTAGCAGGCAGAGGG + Intronic
901597024 1:10393361-10393383 ATGGAGCACTAGAATGATGAAGG + Intergenic
902571062 1:17347436-17347458 CTGGAGCAGCAGGAGGAGCACGG - Intronic
902613594 1:17611189-17611211 ATGGAGCACCAGAAGGCCCAGGG + Intronic
903413812 1:23168227-23168249 CTGCAGCAGCAGGAGGAGGAGGG - Intronic
903575795 1:24339019-24339041 ATGAAGCAGCAGCAGCAGTATGG - Intronic
904120322 1:28193924-28193946 AATGAGCAGCAGCAGGATGAAGG + Intronic
904358825 1:29959488-29959510 AAGGAGGACCAGCAGCAGGCAGG + Intergenic
904594580 1:31635361-31635383 ATGGACCACCAGCTGGTGGAGGG - Exonic
905602730 1:39268288-39268310 AGGGAGGGCCAGGAGGAGGAGGG - Intronic
906124442 1:43418835-43418857 AAAGAGCAGCAGCAGGAGGAGGG + Intronic
906615153 1:47228847-47228869 CTGGAGCTCCCGCAGGAGGAAGG - Intronic
906628775 1:47347111-47347133 AAGGAGGAACAGAAGGAGGAAGG - Intronic
907684840 1:56600508-56600530 CTGGAGTAGCAGCAGCAGGAAGG + Intronic
907894366 1:58671414-58671436 ATGGGGCATCTGCAGGAAGAGGG + Intronic
908662207 1:66448985-66449007 TTGGTGCACAAGCAGGAGGAGGG + Intergenic
908706775 1:66965838-66965860 ATGGAGATACAGCAGAAGGATGG - Intronic
909622274 1:77682444-77682466 GTGGAGCGCCCGCAGGGGGATGG + Intronic
911015065 1:93323368-93323390 GTAGAGCCCCAGCAGGAGCAGGG - Intergenic
911365288 1:96930466-96930488 ATGTAGCTACAGCAGGATGAGGG + Intergenic
911664538 1:100538784-100538806 AGGGAGCTCGAGGAGGAGGACGG - Intronic
912498481 1:110106568-110106590 AAGGAGCTGGAGCAGGAGGAAGG - Intergenic
913196095 1:116457476-116457498 ATGAAGCAGCAGCAGGTGGCGGG - Intergenic
914357827 1:146902967-146902989 ATAGAGGAAAAGCAGGAGGAAGG - Intergenic
914923727 1:151865375-151865397 AGGGAGTTGCAGCAGGAGGAAGG - Intergenic
914988408 1:152478724-152478746 GGGGTGCACTAGCAGGAGGAGGG + Intergenic
915222438 1:154385695-154385717 GTGGAGCTCCAGGAAGAGGATGG + Intergenic
915488727 1:156239890-156239912 CTGGGGAACCAGCAGGAGGGGGG - Intronic
915570520 1:156743027-156743049 ATGGAGCATCAACAGCAGGGTGG - Intronic
916138737 1:161675418-161675440 AGGGAGCAGCAGTGGGAGGATGG + Intronic
916282389 1:163066148-163066170 ATGGAGCCTCAGAAGGATGAGGG - Intergenic
917080338 1:171251594-171251616 ATGGGGCACCAGCTGGGGGCAGG + Intronic
918111734 1:181460618-181460640 ATGGAGTTCCCTCAGGAGGAAGG + Intronic
918203438 1:182288498-182288520 AAGGAGCACCAGCCTTAGGATGG + Intergenic
919612214 1:199759421-199759443 AGGGGGCACCAGGAAGAGGAAGG + Intergenic
920072043 1:203308976-203308998 AAGGGGCAACAGCAGGAGGGTGG - Exonic
920238931 1:204529508-204529530 ATGGACCACCAGCTGGTAGAGGG - Intronic
920749216 1:208658350-208658372 ACTGAGGACCAACAGGAGGAAGG + Intergenic
921009694 1:211129014-211129036 CTGGAGAACCATCAGGAGGGAGG + Intronic
922059792 1:222077400-222077422 ATGTGGCAGCAGCAGGAGGTTGG - Intergenic
923626168 1:235615735-235615757 AAGAAGCACCAGGAGGAGGGGGG + Intronic
924129330 1:240889400-240889422 ATGGGACACCAGCAGCAGGGTGG + Intronic
924705686 1:246500074-246500096 AAGGAGCAGCAGCAGCAGCAGGG - Intronic
924779489 1:247133315-247133337 CTGGAGTACCAGCAGGAGACAGG + Intronic
1062805310 10:415383-415405 AAGGAGAGGCAGCAGGAGGAGGG + Intronic
1062886502 10:1020645-1020667 ATGAAGCACCATGAGGATGAAGG - Intronic
1063958647 10:11287971-11287993 ATGTGGCAGCAGCTGGAGGAAGG - Intronic
1065204544 10:23344323-23344345 AGGGAGCACGCGCGGGAGGAGGG + Intronic
1065241346 10:23708346-23708368 ATTGAACAGCAGCAGAAGGAGGG + Intronic
1065540705 10:26763925-26763947 GTGGAGCTCCAGAAGGAGGAGGG + Exonic
1066609345 10:37222656-37222678 ATGGAGGAACAGCATGAGGAAGG - Intronic
1067096826 10:43307013-43307035 ATGGACCATCAGCAGGATGTGGG - Intergenic
1067576410 10:47411326-47411348 ATGGATCACCAGGAGCAGGGAGG + Intergenic
1067774945 10:49156682-49156704 ATGGGGCAGCAACAGCAGGAAGG + Intronic
1068385638 10:56323376-56323398 ATGGAGTACCAGTGGGAGAAAGG - Intergenic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070400531 10:76049638-76049660 ATGGAGCACAAACTCGAGGAAGG - Intronic
1070997734 10:80800743-80800765 ATGGATGACCAGCATAAGGAGGG - Intergenic
1071134412 10:82437152-82437174 TTGGAGTACCAGAAGGAGAAGGG - Intronic
1071712983 10:88067865-88067887 CTGGAGCACCATCAGGAAGGGGG + Intergenic
1072401902 10:95111261-95111283 ATGGAGGGCAAGCTGGAGGAGGG - Intergenic
1074700517 10:116088090-116088112 ATGGAGAACCAGAAGGACAAAGG + Intronic
1074997490 10:118770426-118770448 ATGGCTGGCCAGCAGGAGGATGG + Intergenic
1075812202 10:125232451-125232473 TGGGACCACCAGCAGGAGTAGGG + Intergenic
1076605559 10:131687094-131687116 ATGGAGCAGCAGCAGGGGCCTGG - Intergenic
1076890122 10:133279235-133279257 TTGGAGCAGCAGCAGGAGGAGGG + Exonic
1077198417 11:1293139-1293161 CTGGAGCACCAGCAGCACGAGGG + Intronic
1077210625 11:1369550-1369572 ATGGAGGACCAGAAGGAGGCAGG + Intergenic
1077538213 11:3134516-3134538 AGGGACCAGCAGCAGGAGGAGGG - Intronic
1078060685 11:8040703-8040725 AAGGAGCAGTAGGAGGAGGAGGG + Intronic
1081165974 11:39809810-39809832 ACGGAGCACAAGCAGAAGCAGGG + Intergenic
1082809045 11:57467621-57467643 CAGGAGCATCAGCAGGAGGCAGG - Exonic
1083859389 11:65411867-65411889 ATGGAGCACCAGCAGGAGGAAGG - Exonic
1084554433 11:69867530-69867552 ATGGAGCATCAGAATGGGGAAGG - Intergenic
1084643618 11:70441327-70441349 ATGGAAAACGAGCAGGAGAAAGG + Intergenic
1084741205 11:71140601-71140623 GGGTAGCACCAGCAGGAGGGTGG + Intronic
1085230358 11:74962692-74962714 ATGGAGAACCATCTGGAAGAAGG - Intronic
1085258920 11:75193254-75193276 CAGGACCACCAGCAGGAAGATGG - Exonic
1087800587 11:102499024-102499046 ATCTTGCACCAGCAGGAAGAAGG - Intergenic
1088996148 11:114999042-114999064 ATGCAGAGCCAGGAGGAGGAAGG + Intergenic
1089281884 11:117380536-117380558 CTTGAGAGCCAGCAGGAGGATGG + Intronic
1089538294 11:119173953-119173975 ATGGAGCACAAAGAGGAGGTGGG - Exonic
1089629101 11:119772733-119772755 ATGGGGTGGCAGCAGGAGGAGGG + Intergenic
1089788082 11:120922394-120922416 AGGGAGCAAAAGCAGCAGGATGG - Intronic
1090307406 11:125703286-125703308 ATGGAGCGCAAGCAGAAGCAGGG + Intergenic
1090402571 11:126458493-126458515 CTTGGGCACCAGCAGGAAGAGGG - Intronic
1091028396 11:132161745-132161767 ATGGCGCAGCTGCGGGAGGAGGG - Intronic
1091180433 11:133599575-133599597 ATGGAGCAAAAGCAGGAGAATGG - Intergenic
1092503795 12:9074272-9074294 GTGGAGCACCAGCAGAATGAAGG - Intronic
1092703170 12:11256187-11256209 ATGGAGGACAAGCAGAAGCAAGG + Intergenic
1093513625 12:19958649-19958671 ATTGACCATCAGCAGGAGAATGG - Intergenic
1096818495 12:54216461-54216483 CTGAAGCTGCAGCAGGAGGAAGG - Intergenic
1096846536 12:54410228-54410250 GTGGAGCAGGGGCAGGAGGATGG + Intronic
1097086637 12:56473538-56473560 ATTGGGTACCACCAGGAGGATGG + Exonic
1097098755 12:56571252-56571274 ATGGAGGAAGAGCAGGAGGAGGG - Intronic
1097619424 12:61922443-61922465 ATGGAGGGCGAGCAGGAGCAGGG + Intronic
1098358611 12:69633909-69633931 CTGGAGAAGCAGCAGGATGAGGG - Intergenic
1098414970 12:70223072-70223094 AAGAAGCAGAAGCAGGAGGAAGG - Intergenic
1098442005 12:70528865-70528887 AAGGTGCAAAAGCAGGAGGAAGG + Intronic
1098461429 12:70736965-70736987 ATGGGGCACCAGCTGGAGAAAGG - Intronic
1099533166 12:83812483-83812505 AAGGAGCAAAAGCAGAAGGAAGG - Intergenic
1100206373 12:92354412-92354434 ATGGGGAGCCAGCAGGGGGATGG - Intergenic
1100449926 12:94696063-94696085 GAGGAGCAGCAGCAGGGGGAAGG + Intergenic
1101570821 12:105952040-105952062 ATGTTCCCCCAGCAGGAGGAAGG - Intergenic
1101800929 12:108021499-108021521 ATGAAGGAGCAGGAGGAGGAAGG - Intergenic
1102415396 12:112758027-112758049 ATACAGCACCAGCATGAGGGTGG - Intronic
1102455884 12:113070514-113070536 CTGAGGGACCAGCAGGAGGAAGG + Intronic
1102649799 12:114431987-114432009 ATGCAGCACATCCAGGAGGAAGG - Intergenic
1103525150 12:121562646-121562668 ATGGAGGAGGAGGAGGAGGAAGG + Intronic
1104005590 12:124890044-124890066 ATGGTGGAGCAGCAGGAGGTGGG - Intergenic
1104250738 12:127091057-127091079 ATGGAGCAGCACCACTAGGATGG + Intergenic
1104294100 12:127496047-127496069 CTGGAGAACCATCAGGATGATGG - Intergenic
1106500482 13:30323630-30323652 TTGCAGCAGCAGTAGGAGGAGGG + Intergenic
1107053756 13:36080542-36080564 ATGGAGCACTACCTGGAGCAAGG - Intronic
1108809287 13:54201503-54201525 AAGGAACAGCAGCAAGAGGATGG - Intergenic
1109050188 13:57470574-57470596 ATTGAACATCAGTAGGAGGAAGG - Intergenic
1109377922 13:61522833-61522855 ATGGAGAGCCAGAAGGTGGAGGG + Intergenic
1111339890 13:86870544-86870566 ATGTAACACCAGCAGGTGGCAGG + Intergenic
1111798434 13:92953587-92953609 ATGGTGCAGCAGCAGACGGAAGG + Intergenic
1113188572 13:107717985-107718007 CTGGAACAACAGCAGGTGGAGGG - Intronic
1113817587 13:113184967-113184989 ATGCAGCACCGGCAGGAAGGTGG + Intronic
1114776087 14:25483192-25483214 TTGCATAACCAGCAGGAGGAAGG + Intergenic
1115573168 14:34686236-34686258 GTGGAGAACAAGCAGGAGGTGGG + Intergenic
1115896190 14:38090360-38090382 TTGGAGAAACAGCAGGAAGAAGG + Intergenic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1116231680 14:42226444-42226466 ATGGACCACCAGTGGCAGGAGGG - Intergenic
1116802679 14:49459582-49459604 AAGGATCTCCAGCAGGATGAGGG + Intergenic
1117963814 14:61187589-61187611 TTGGAGCAGCAGCAGGAGGCAGG - Intronic
1118973736 14:70659524-70659546 AAGCAGCCGCAGCAGGAGGAGGG + Intronic
1119181015 14:72605283-72605305 AGGGAGCAGGAGCAGGAGGAGGG + Intergenic
1119193768 14:72702247-72702269 AGGAGGCACCAGCAGGAGAACGG + Intronic
1119387405 14:74266227-74266249 CTGGAGGGCCAGCAGGAGGCTGG - Intergenic
1120034517 14:79681235-79681257 ATGAAGGCTCAGCAGGAGGAGGG - Intronic
1120971713 14:90213473-90213495 AAGGAGCCCCAGCAGGGAGAGGG - Intergenic
1121111731 14:91317460-91317482 CTTCAGCACCAGCAGGAGGCAGG - Intronic
1121117965 14:91356886-91356908 GGGGAGCACCAGCAGGAAGGTGG + Intronic
1121833250 14:97069795-97069817 ATGGAGCTCCAGTGGGAGGCGGG + Intergenic
1122688204 14:103519901-103519923 ATGGAGCAGCGGCTGGAGCAGGG - Exonic
1124047253 15:26161710-26161732 CAGCAGTACCAGCAGGAGGAAGG - Intergenic
1124636459 15:31367813-31367835 ATGGACCCCCCGCATGAGGACGG + Intronic
1126431314 15:48588004-48588026 CTGGAGAAGCAGCAGAAGGAAGG + Intronic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1126552838 15:49952311-49952333 TTGGAGGACCAGAAGGAGAAGGG - Intronic
1126860698 15:52879958-52879980 AAGAGGGACCAGCAGGAGGATGG - Intergenic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128498230 15:68210326-68210348 CTGGAGCCCCAGCAGGAAGGGGG - Intronic
1128809274 15:70558535-70558557 GTGGAGCAGCAGTAGGAGGGAGG - Intergenic
1128979370 15:72175367-72175389 AAGGAGCATCAGCAGGAGAGTGG - Intronic
1129672635 15:77615811-77615833 GCCCAGCACCAGCAGGAGGATGG + Exonic
1129698479 15:77754178-77754200 AGGGAGCAGGAGCAAGAGGATGG + Intronic
1129809183 15:78493205-78493227 ATAGAGCACAAGCAGGAGGAAGG + Intronic
1131215410 15:90531028-90531050 TTGGAGGACCATCGGGAGGATGG + Intronic
1131514479 15:93067930-93067952 AGGCAGGACCAGGAGGAGGAAGG + Intronic
1132028049 15:98419586-98419608 ATGGAGGAGGAGGAGGAGGAGGG + Intergenic
1132761138 16:1509162-1509184 CTGAAGCACCAGGAGGAGCAGGG + Intronic
1133398010 16:5464031-5464053 GTGATGGACCAGCAGGAGGAGGG + Intergenic
1133802041 16:9092045-9092067 ATGGAGGAGCGGAAGGAGGAGGG + Exonic
1133994739 16:10739911-10739933 TTGCAGGACCAGGAGGAGGAGGG + Intergenic
1134870804 16:17650772-17650794 ATGGAACACCAGCATGAGAAAGG + Intergenic
1136019340 16:27430094-27430116 CTGGAGCAGCAGCAGGAGCAAGG - Exonic
1136394824 16:29987172-29987194 AAGCAGCAGCAGCAGCAGGAGGG - Exonic
1136507317 16:30713060-30713082 ATGGAGCGACAGAAAGAGGAGGG - Intronic
1136550446 16:30979846-30979868 CTGCAGCAGCAGCGGGAGGAGGG + Exonic
1137386497 16:48047474-48047496 AAGGAGGAGAAGCAGGAGGAGGG + Intergenic
1138969574 16:62128685-62128707 GAGGAGCAGCAGGAGGAGGAGGG - Intergenic
1139923381 16:70473098-70473120 ATGCTGGACCACCAGGAGGATGG + Exonic
1139976356 16:70814325-70814347 ATAGAGGAAAAGCAGGAGGAAGG + Intronic
1140818033 16:78638629-78638651 ATGGTGCCCCAGCAGCAGGCTGG + Intronic
1141031919 16:80596599-80596621 ATGGAGGAACAGAAGGATGATGG + Intergenic
1142141823 16:88476013-88476035 ATGGGGCACCAGCATTGGGAGGG - Intronic
1142338963 16:89508422-89508444 ACGGAGCAGCAGCAGCAGCACGG - Exonic
1142496620 17:309592-309614 CTGGACCCCCAGCAGGAGGCTGG - Intronic
1142496660 17:309705-309727 CTGGACCCCCAGCAGGAGGCTGG - Intronic
1143205056 17:5135546-5135568 TTGGAGCAGCCCCAGGAGGAGGG - Intronic
1144000861 17:11053608-11053630 ATGGACCACCCCCAGGGGGAGGG - Intergenic
1144048110 17:11471353-11471375 AGGGAGGACCAGCAGGAGGCTGG - Intronic
1144101888 17:11948866-11948888 ATGGAGCCCCTCCAGGAGGGAGG + Intronic
1144154801 17:12488954-12488976 ATGGATCACCTACAGGAGGAAGG + Intergenic
1144214466 17:13043154-13043176 ATGGAGCAAGAGAAAGAGGAGGG + Intergenic
1144677884 17:17173469-17173491 CTGGTTCACCTGCAGGAGGACGG + Intronic
1144792331 17:17867357-17867379 GGTGGGCACCAGCAGGAGGAAGG + Intronic
1144872866 17:18381397-18381419 CTGCAGCACCAGCAGGAGACGGG + Exonic
1145193197 17:20866283-20866305 CTCAGGCACCAGCAGGAGGAGGG + Intronic
1145298819 17:21614804-21614826 CTCAGGCACCAGCAGGAGGAGGG - Intergenic
1145351462 17:22088489-22088511 CTCTGGCACCAGCAGGAGGAGGG + Intergenic
1145403620 17:22568288-22568310 CTCGGGCACCAGCAGGAGGAGGG + Intergenic
1145723300 17:27091542-27091564 CTCAGGCACCAGCAGGAGGAGGG - Intergenic
1146679956 17:34799919-34799941 TTAGAGAACAAGCAGGAGGAAGG - Intergenic
1147267587 17:39244268-39244290 GAGGAGCAGCAGGAGGAGGAGGG - Intergenic
1147656754 17:42095490-42095512 ATGGGGCCGCAGCAGCAGGAGGG - Intergenic
1147906343 17:43825573-43825595 ATGGGGTGGCAGCAGGAGGAGGG - Intronic
1148455138 17:47807456-47807478 GTGGACCCCCAGCAGGGGGAAGG + Exonic
1148794949 17:50192501-50192523 CTGGAGGACCAGCAGGACCAGGG + Exonic
1149657729 17:58319122-58319144 ATGGAGCAGCAGCAGGGGGGTGG + Exonic
1149680385 17:58503015-58503037 ATGGGTTCCCAGCAGGAGGATGG - Intronic
1150069620 17:62139916-62139938 GTGGACCACCAGCAGGTGGTGGG + Intergenic
1150285533 17:63951742-63951764 ATGCAGCAGCCCCAGGAGGAAGG + Exonic
1150905391 17:69330708-69330730 ATTGTTCACCAGCAGGAGGAGGG - Intergenic
1151215568 17:72574570-72574592 ATGGACAACCTGCAGGAGGAAGG - Intergenic
1151518853 17:74614356-74614378 GTGGAGTTCCAGGAGGAGGAGGG + Intronic
1151562532 17:74878259-74878281 CTGGACCAGCAGCAGCAGGAGGG + Exonic
1151748382 17:76023602-76023624 CTGCAGCACCAGCAGGAGACGGG - Exonic
1152029808 17:77834963-77834985 ATGCAGCCCCTGTAGGAGGAAGG - Intergenic
1152096209 17:78273145-78273167 ATGGGGGAACAGCAGGAGGTAGG + Intergenic
1152162765 17:78679309-78679331 ATGAAGCACCAGGAGGGAGAGGG + Intronic
1152266282 17:79296846-79296868 AGGGAGGAGAAGCAGGAGGAGGG - Intronic
1152340306 17:79720744-79720766 ATGGAGCAGGAGCAGGAGCAGGG - Intergenic
1152854953 17:82659436-82659458 ATGGCGCTCCAGCAGGAAGGAGG - Intronic
1153414021 18:4825461-4825483 AAGCAGCAGCAGCAGGAAGAGGG - Intergenic
1154107443 18:11534562-11534584 CTGAAGCGCCAGCAGGAGGAGGG - Intergenic
1154145205 18:11861247-11861269 AAGGAGAGCCAGCAGGAGGGAGG - Intronic
1154964957 18:21347397-21347419 AAGGAGCAGCAGAAGCAGGAAGG - Intronic
1155066517 18:22273718-22273740 ATGGAGGAGGAGGAGGAGGAGGG - Intergenic
1156504747 18:37582698-37582720 ATGGTGCAGAAGCAGGATGAAGG - Intergenic
1156882917 18:42102320-42102342 CTGGAGCAGCAGCTGAAGGAAGG - Intergenic
1156961092 18:43031944-43031966 ATGTAGCAGAAGCAGGTGGAAGG + Intronic
1157441777 18:47717158-47717180 ATGGATCAGCTGCAGGGGGAAGG + Intergenic
1157740963 18:50092431-50092453 ACGCAGCAGCAGCAGCAGGATGG - Intronic
1157762696 18:50275898-50275920 ATGGGGCAGCTGCAGGAGGCAGG + Exonic
1157775159 18:50388772-50388794 CTTGAGCATCAGCAAGAGGAAGG - Intronic
1160361873 18:78290202-78290224 ATGGAACACCAGCAGCAGGAGGG + Intergenic
1160384511 18:78486658-78486680 ATGGATGACCAACAGGAGCAAGG + Intergenic
1161438646 19:4278777-4278799 TTGGAGCAGCAGAAGGAAGAGGG - Exonic
1161504683 19:4637497-4637519 ATGGAACCCCAGAGGGAGGAAGG - Intergenic
1161795054 19:6381562-6381584 AAGGCGCCGCAGCAGGAGGAGGG - Exonic
1162768308 19:12933581-12933603 ATGGAGCACCAGGCGGTGGTGGG - Exonic
1163244755 19:16086558-16086580 ATGGCGCAGCAGCAGGAAGTGGG + Intronic
1163423463 19:17227916-17227938 TTGGAGCTCCAGCACGAGGTGGG + Exonic
1163690896 19:18737723-18737745 GAGGAGCAGCAGCAGGAGGGCGG - Intronic
1165004767 19:32795838-32795860 CTGGAGCAGGAGCAGGAGCAGGG + Intronic
1165384605 19:35502942-35502964 ATAGGGCAGTAGCAGGAGGAGGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1167360529 19:49028135-49028157 CAGGAGCCACAGCAGGAGGATGG - Intronic
1167363119 19:49040665-49040687 CAGGAGCCACAGCAGGAGGATGG + Intergenic
1167365448 19:49052921-49052943 CAGGAGCCACAGCAGGAGGATGG - Intergenic
1167854311 19:52225825-52225847 ACGGAGCCCTAGCAGGAGGGTGG + Intronic
1168316382 19:55486529-55486551 CAGGAACACCGGCAGGAGGAGGG - Exonic
1168561680 19:57389864-57389886 AACGACCACCACCAGGAGGACGG - Intronic
925148612 2:1599801-1599823 AGGGAGCAGCAGGAAGAGGAGGG - Intergenic
925553684 2:5104990-5105012 CAGGAGCACCAGCTGGAGGGAGG + Intergenic
926234401 2:11028474-11028496 GTGGAGCCCCTCCAGGAGGAAGG - Intergenic
926886338 2:17602174-17602196 ATGGAGCACCTGCGGGAAGAAGG + Intronic
927474511 2:23402140-23402162 ATCGAGGACCGGCAGGAGGAGGG + Intronic
928332627 2:30369287-30369309 ATGGGGCACCGGCTGGAAGAGGG + Intergenic
929508772 2:42550496-42550518 ATGGAGCAGCAGAAGGAAGGAGG + Intronic
929590563 2:43143064-43143086 AGGCAGCAGCAGCAGCAGGAGGG - Intergenic
929828943 2:45332073-45332095 CTGTAACACCAGGAGGAGGAAGG + Intergenic
930893665 2:56421204-56421226 ATGGAGCACGAGCTGAAGCAGGG + Intergenic
930898914 2:56480455-56480477 ATGGAGCACCAGCTGGGGTGGGG + Intergenic
931252327 2:60544292-60544314 ATGAAGCAAGAGCAGGCGGAAGG - Intronic
931420513 2:62122922-62122944 ATGGAACCACAGCAGTAGGAGGG + Intronic
932170001 2:69545959-69545981 ACTGAGCACCAGAAAGAGGAAGG + Intronic
932476354 2:72008771-72008793 CGGGAGCACCAGGAGGAGAAGGG + Intergenic
933141438 2:78795743-78795765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
934039565 2:88116683-88116705 AAGAAGCACCAGCAGGAGACTGG + Intergenic
934738493 2:96702534-96702556 ATGGGGCTCCAGCTGGGGGATGG + Intergenic
935489497 2:103698857-103698879 ATAGAGAACCAGCAGCAGGGTGG - Intergenic
935944545 2:108273563-108273585 AAGGAGCAGCAGCACGAAGAGGG - Intergenic
936040271 2:109144715-109144737 ATGCATCACCAGCTGGAGGTGGG - Intronic
936111924 2:109671570-109671592 TTCAGGCACCAGCAGGAGGAGGG - Intergenic
937364192 2:121249023-121249045 ACGGAGCACCAGCAGCTGGAGGG - Exonic
937743712 2:125386501-125386523 ATGGGGAACCAGAAGGGGGAAGG + Intergenic
937904976 2:127048725-127048747 AGGCACCAACAGCAGGAGGAGGG - Intronic
937931664 2:127209890-127209912 CTGGAGCACCAGAAGGAGACGGG + Intronic
938239632 2:129733330-129733352 AAGGAGCACAAACAGGAGGAGGG - Intergenic
940124773 2:150311160-150311182 ATGGAGAACTAGCAGAAGCAGGG + Intergenic
942254270 2:174078062-174078084 TTGGAACACCAGGAAGAGGAGGG - Intronic
944135151 2:196391083-196391105 AGGGAGCACCAGCAAGAGACAGG + Intronic
944539591 2:200743059-200743081 CTGGGGCACCAGGATGAGGATGG + Intergenic
945831778 2:214795912-214795934 AGGGATATCCAGCAGGAGGATGG - Intronic
946210469 2:218143535-218143557 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
946219153 2:218211537-218211559 AAGGAGCCCCAGCAGGAGGAAGG - Intergenic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
947170486 2:227306174-227306196 ATGGGGCAACAGCAAGAGCAAGG + Intronic
947263502 2:228251598-228251620 ATGGGGCACCAGCAGGCCCAGGG + Intergenic
947837735 2:233187812-233187834 AGGGAGGAGGAGCAGGAGGACGG - Intronic
1168850005 20:969972-969994 ATGGGGCACCAATAGGAAGAGGG - Intronic
1169026077 20:2372540-2372562 ATGGATTACCTGCAGGAGGCAGG - Intergenic
1169498108 20:6133912-6133934 AGGGAGCACCTGAAGGAGGTGGG - Intergenic
1169730429 20:8779976-8779998 ATGGAGCACAAGCACGTGAATGG - Intronic
1170615399 20:17945009-17945031 CTTGAGCACCAGCAGAAGGTTGG - Intronic
1171152258 20:22837547-22837569 AGGAAGCACCAGCAGGAGAGTGG - Intergenic
1172386053 20:34534944-34534966 ATGGGACACCAGCTGGAGGCTGG - Intronic
1172390018 20:34559765-34559787 CTGGTTCACCAGCAGGAAGAAGG - Exonic
1173443308 20:43096512-43096534 CAGGAGCCCCAGGAGGAGGAGGG - Intronic
1173565329 20:44034466-44034488 ATGGAGTACCAGGAGCAGCATGG + Intronic
1175055170 20:56191305-56191327 AGGCAGAGCCAGCAGGAGGACGG + Intergenic
1175315837 20:58045982-58046004 ATGGGGCCTCAGGAGGAGGAAGG - Intergenic
1175351357 20:58322035-58322057 GTGAAGCCACAGCAGGAGGATGG - Intronic
1175489367 20:59369041-59369063 ATCAAGCACAAGCAGGAGCAGGG - Intergenic
1175774147 20:61642307-61642329 ATGGGGAACCAGCAGGTGGATGG + Intronic
1175774159 20:61642344-61642366 ATGGGGAACCAGCAGGTGGGTGG + Intronic
1176119790 20:63449085-63449107 CTGGGGCACTGGCAGGAGGACGG + Intronic
1176305024 21:5118767-5118789 GTGGGCCACGAGCAGGAGGAAGG - Exonic
1178854605 21:36239881-36239903 CTGCAGCAGCAGCAGGAGCACGG - Exonic
1178887179 21:36493598-36493620 CTGGGGCACGAGGAGGAGGAGGG + Intronic
1179852031 21:44143263-44143285 GTGGGCCACGAGCAGGAGGAAGG + Exonic
1180922053 22:19526047-19526069 ATGGGTCTGCAGCAGGAGGAAGG - Intronic
1181786029 22:25227931-25227953 ATGGACCAGCAGCCGAAGGACGG + Exonic
1183733080 22:39629188-39629210 GTGGAGCACCAGGGTGAGGACGG - Intronic
1184591017 22:45483367-45483389 ATGTAGCAGCAGCAGTGGGAAGG - Intergenic
1184677194 22:46050177-46050199 ATGGGGCAGCAGCAGCAGGAGGG + Exonic
1184757687 22:46526161-46526183 ATGGAGGAGCAGGAGGCGGACGG - Intronic
1184967918 22:47995217-47995239 CTGGAGCCCCAGCAGCTGGAAGG - Intergenic
1185038722 22:48493198-48493220 ATTCAGCACGAGCAGGTGGATGG + Intronic
1185202289 22:49514946-49514968 AAGGAGTACCAGCAGCAGGCGGG + Intronic
949783696 3:7717678-7717700 ATGGCCCACCAGCAACAGGAAGG + Intronic
950595674 3:13979160-13979182 ATGGAGCAGAAGCAGGAAGCAGG - Intronic
951975355 3:28501200-28501222 AGGCAGCTCCAGCAGGAAGAAGG + Intronic
952700094 3:36318536-36318558 ATGGAGGAGGAGGAGGAGGAAGG - Intergenic
953435836 3:42876459-42876481 ATGGAGCACTAGCATGAGCCAGG - Intronic
953586314 3:44204401-44204423 ATGGAGCCACAGCTGGAGAATGG + Intergenic
954524861 3:51261257-51261279 ATGGAGGGCAAGCAGAAGGAGGG + Intronic
955927628 3:64023391-64023413 CTGGAGAACCTGGAGGAGGAGGG - Exonic
956268750 3:67427637-67427659 ATGGAGCACGAGCCGAAGCAGGG + Intronic
956308865 3:67856934-67856956 ATGGACCAGCAGCAGCAGCATGG + Intergenic
957011354 3:75009193-75009215 ATGGAGGGCCAGCAGAAGCAGGG - Intergenic
957288859 3:78250740-78250762 ATGGAGGACAAGCAGGGGTAGGG - Intergenic
957747758 3:84366598-84366620 ATGGAGGGCCAGCAGAAGCAGGG - Intergenic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
961254871 3:125540892-125540914 AAGGAGCATGAGGAGGAGGAAGG + Intronic
961370668 3:126427902-126427924 CTGGAGCAGCAGCAAGAGAATGG + Intronic
963505150 3:146175728-146175750 TTGGAGCAACAGAAGTAGGAGGG - Intergenic
963595264 3:147317603-147317625 ATGGAGCATGAGCCGAAGGAGGG - Intergenic
964170579 3:153765493-153765515 TGGGAGCACCAGCAGGAGACTGG - Intergenic
965673477 3:171171392-171171414 TTGGAGCAAAAGCAGGAGGCTGG + Intronic
965848345 3:172990963-172990985 AGTGAGCAGCAGCAGGAGAAGGG + Intronic
967654869 3:192034990-192035012 ATGGAGCACCTTCAAGAGAACGG + Intergenic
967681572 3:192370002-192370024 GAGCAGCACCAGCAGGAGCAAGG + Intronic
968412698 4:403612-403634 ATGGACCATCAGCAGGATGTGGG - Intergenic
969837142 4:9851048-9851070 GTGGGGCACCAGCAGGAGTTGGG - Intronic
970273164 4:14368493-14368515 ATGGAGAGCCAGAAGGGGGATGG + Intergenic
970508415 4:16756021-16756043 ATGGAGCACGTGGAGGAAGAGGG + Intronic
973673654 4:53241755-53241777 ATGGTGGTGCAGCAGGAGGAGGG - Intronic
975814705 4:78205722-78205744 TGGGAGCAGCAGCAGGAAGAGGG + Intronic
975888241 4:78991811-78991833 AGAGAGCAGCAGCAGGAGGCTGG + Intergenic
978136406 4:105266785-105266807 TTGGAGTACCAGAAGGAGGTGGG + Intronic
981041186 4:140224004-140224026 AGGGAGCACCATCAGGCAGAGGG - Intergenic
981131501 4:141162648-141162670 ATGGAGGACAAGCAGAAGCAGGG + Intronic
983044603 4:162970170-162970192 ATGGAGGGCCAGCAGAAGCAGGG - Intergenic
983238646 4:165207490-165207512 CAGCAGCAGCAGCAGGAGGAAGG + Intronic
983367292 4:166809197-166809219 ATGGAAGGCAAGCAGGAGGATGG - Intronic
983660700 4:170128050-170128072 ATGGTGCAGCAGCAGGCTGAAGG + Intergenic
984551964 4:181171301-181171323 GAGGAGCACCAGGAAGAGGATGG - Intergenic
984732385 4:183079832-183079854 ATGGAGAAGCAGCAGGAGCCAGG + Intergenic
985520026 5:370043-370065 ATGGGGCACCAGCAAGAGCCCGG - Intronic
985694332 5:1331398-1331420 AAGGAACACCGGCGGGAGGACGG + Intronic
987025910 5:13926188-13926210 AAGGAGCACCTGAGGGAGGATGG + Intronic
987081798 5:14431850-14431872 ATGGAGAATCAGCAAGAGGGTGG - Intronic
987092927 5:14523441-14523463 TGGGAGCACCAGCAGGAGGAAGG - Intronic
988205339 5:28126516-28126538 ATGGAGAGCCAGAAGGGGGATGG - Intergenic
988716265 5:33831584-33831606 AAGGAGGACCAGCTGGAAGATGG - Intronic
988861223 5:35281992-35282014 CTGGAGAGTCAGCAGGAGGAGGG + Intergenic
991344294 5:65646242-65646264 ATGGAGCATCATCGGGTGGAGGG + Intronic
992004465 5:72463706-72463728 AGAAAGGACCAGCAGGAGGATGG + Intronic
992073896 5:73173663-73173685 CTGGAGAACCATAAGGAGGAGGG - Exonic
992873447 5:81028822-81028844 ATGGAGCATGAGCAGAAGCAGGG + Intronic
992904619 5:81334108-81334130 ATGGGGAGCCAGAAGGAGGATGG - Intronic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
995350824 5:111173459-111173481 AAGGAACAGCAGCAGAAGGAAGG + Intergenic
997884277 5:137616279-137616301 AAGCAGCTTCAGCAGGAGGAGGG + Intergenic
998450612 5:142231766-142231788 GGGAAGCACCAGCAGGAGGCTGG + Intergenic
1000383678 5:160652142-160652164 AAGGAGACACAGCAGGAGGAAGG - Intronic
1000927928 5:167216308-167216330 AAGGATCACCAGGAGGAAGAAGG + Intergenic
1001543711 5:172557113-172557135 AGGGAGCAGAAGCAGGAGGAGGG - Intergenic
1001549042 5:172588661-172588683 CAGGAGCACCAGCTGGAGGTGGG + Intergenic
1002685135 5:181003974-181003996 AGGAAGCACCGGCAGGTGGAGGG + Intronic
1002935345 6:1666920-1666942 ATGGAGCACCCTCTGGGGGAAGG + Intronic
1003061786 6:2869464-2869486 ATGGACCATTAGCAGGAGGTGGG - Intergenic
1003105395 6:3211326-3211348 AGGGAGCAGGAGGAGGAGGATGG - Intergenic
1003114118 6:3272000-3272022 AGGGAGCACCCGCAGGAGCTGGG - Exonic
1003528413 6:6917454-6917476 ATGGAGAACCTGCAGGAAAAAGG - Intergenic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1003990708 6:11483587-11483609 AGGGAGCAGAAACAGGAGGAGGG - Intergenic
1004392302 6:15220020-15220042 AGCGAGCACCATCTGGAGGAAGG - Intergenic
1005583620 6:27255191-27255213 TTTCAGCACCAGCAGAAGGAGGG - Intronic
1006815989 6:36850353-36850375 GTGGAGGCGCAGCAGGAGGAAGG - Intergenic
1007417510 6:41700680-41700702 TCTGAGCACCAGCAGGAGGTGGG + Intronic
1009043109 6:58205288-58205310 ATGGAAGAACAGCAGCAGGAGGG - Intergenic
1009218946 6:60959537-60959559 ATGGAAGAACAGCAGCAGGAGGG - Intergenic
1010028374 6:71245743-71245765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
1010628467 6:78168273-78168295 ATGGGGAACCAGAAGGGGGATGG + Intergenic
1013373464 6:109490904-109490926 TTGGGGCAGCAGCTGGAGGATGG + Intergenic
1015210663 6:130694865-130694887 ATGGAGAAGCAGCAGCAGGAAGG + Intergenic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015447021 6:133317944-133317966 ATGGATCAACGGAAGGAGGATGG - Intronic
1015633636 6:135255094-135255116 ATGAAGGACATGCAGGAGGAGGG - Intergenic
1015880293 6:137865382-137865404 AAGGAGCACCAGCAGGAGAGTGG + Intergenic
1016277009 6:142365685-142365707 AGGGAGGAAGAGCAGGAGGAGGG + Intronic
1016354979 6:143208982-143209004 ATAGAGGACAAGCAGGAGAAAGG + Intronic
1016533456 6:145084611-145084633 ATGGGGCACCAACAGGATGCAGG + Intergenic
1017037584 6:150280367-150280389 GTGGAGGAAGAGCAGGAGGAAGG - Intergenic
1017055392 6:150431432-150431454 ATGTAGAACCAGAAGCAGGAGGG + Intergenic
1017949127 6:159120892-159120914 CTGAAGCAATAGCAGGAGGAAGG - Intergenic
1018686596 6:166308331-166308353 CGGGAGCACCCCCAGGAGGAGGG - Exonic
1018924285 6:168195531-168195553 ATGGAGCAGGGGGAGGAGGAGGG - Intergenic
1018952837 6:168390459-168390481 ACGGGGCACCAGCAGGTGCAGGG - Intergenic
1019192591 6:170261851-170261873 ATGGAGAATCAGCAGGTGCACGG + Intergenic
1019403825 7:872068-872090 AGGCCTCACCAGCAGGAGGAGGG - Intronic
1019660186 7:2219775-2219797 CTGGAGCACCAGGAGGAGGGTGG - Intronic
1019959826 7:4449804-4449826 AGGGGGCAGCAGCAGGAGCAGGG - Intergenic
1020260754 7:6529597-6529619 ATGGAGGGCCAGCAGGAGCCAGG - Intronic
1020673229 7:11146383-11146405 ATGGGGCAACAGCTGGAGAAGGG - Intronic
1021163516 7:17305112-17305134 ATAGGGCAGCAGCAGGAGGGTGG + Intronic
1022563404 7:31373180-31373202 ATGGAGCATCAGCAAGGGGCAGG - Intergenic
1022873493 7:34503998-34504020 CTGGAGCAGGAGCAAGAGGAGGG + Intergenic
1023156115 7:37254117-37254139 ATGCAGGACCAGCAGAAGGAAGG + Intronic
1024019130 7:45349209-45349231 CTGGAGGATCACCAGGAGGATGG + Intergenic
1026189450 7:68111526-68111548 ATGGACCACCAGCAGTTGGTGGG + Intergenic
1026955907 7:74376373-74376395 ATGGAGCACCAGCTGGAGCTGGG + Exonic
1028076852 7:86527097-86527119 ATGTTGGACCAGCAGAAGGATGG - Intergenic
1028580195 7:92401821-92401843 ATGAAGCACCAGCTGGGGCATGG - Intergenic
1028629225 7:92915607-92915629 ATGCGGCAACAGCAGAAGGACGG + Intergenic
1028882316 7:95893613-95893635 ATGGAGTGCCAGCAAGATGATGG - Intronic
1029283958 7:99453500-99453522 AGGGAGCCCCACCAGGAGGAGGG - Intronic
1029337769 7:99916929-99916951 ATGGAGCATGGGAAGGAGGATGG - Intronic
1031232308 7:119123647-119123669 ATGGGGAGCCAGCAGGGGGATGG - Intergenic
1031368608 7:120935825-120935847 ATGTAGCAGAAGCAGGAGGTAGG + Intergenic
1031780784 7:125961458-125961480 ATGGAACAGCAGGAGGAGGGAGG - Intergenic
1033586696 7:142779641-142779663 ATGGAGGAGCAGGAGCAGGAGGG - Intergenic
1034293465 7:149950303-149950325 AGGGAGCACCTGCTGGAGAAGGG + Intergenic
1034812600 7:154146550-154146572 AGGGAGCACCTGCTGGAGAAGGG - Intronic
1035084868 7:156249425-156249447 CTGGAGCACCACGAGAAGGAAGG + Intergenic
1035743441 8:1945487-1945509 CTGGAGGCCCACCAGGAGGAAGG + Exonic
1035760308 8:2064136-2064158 ACGGAGCAGATGCAGGAGGAAGG - Intronic
1036390319 8:8318956-8318978 CTGGAGCACCTGAAGGAGCACGG - Exonic
1036744064 8:11391512-11391534 AAGGAGTTCCAGAAGGAGGACGG - Intronic
1037287667 8:17318481-17318503 CTGGAACTGCAGCAGGAGGATGG + Intronic
1038004136 8:23415924-23415946 CTGGGGCTCCTGCAGGAGGAAGG - Intronic
1038437229 8:27544559-27544581 ATGGTGCCCCAGCAGGTGGAAGG - Exonic
1038670015 8:29575346-29575368 CTGAAACACCAGCAGGAGGAAGG - Intergenic
1039293688 8:36126559-36126581 TTGGAGTACCAGAAGGAGGTGGG - Intergenic
1039410626 8:37352286-37352308 ATGTGGCTCCAGGAGGAGGAGGG + Intergenic
1039693526 8:39885331-39885353 ATGGACAATCAGCAGGAGGTGGG - Intergenic
1040843066 8:51804949-51804971 ATGGAGCCCAAGCAGGAGAATGG - Intronic
1041946574 8:63450379-63450401 AAGGAGCCCAAGCAGGAGGTAGG + Intergenic
1042568216 8:70134114-70134136 GTGGAGAAGAAGCAGGAGGAAGG - Intronic
1042750588 8:72153709-72153731 GTGGAGCCCCAGGAGAAGGAAGG - Intergenic
1042811908 8:72834950-72834972 TTGGAAAACCAGCAGGAGGAAGG + Intronic
1044916035 8:97113305-97113327 AGAGAGCAGCAGCAGGAGAAGGG + Intronic
1045481690 8:102597868-102597890 ATGGAGTGCCAGCAAGAGCAGGG + Intergenic
1046053716 8:109054831-109054853 AAGGAGCAGGAGGAGGAGGAAGG - Intergenic
1046814144 8:118565446-118565468 AAGTAGCACCAGCAGGGGCAGGG + Intronic
1047482105 8:125293563-125293585 AGGGAACACAAACAGGAGGAAGG + Intronic
1048572484 8:135667295-135667317 ACTGAGCACCAGCAGGAGGAGGG - Intergenic
1048767402 8:137859932-137859954 AAGGAGGAGGAGCAGGAGGAGGG + Intergenic
1048989707 8:139754145-139754167 ATGGAGCAGCAGCAGGCTGGGGG - Intronic
1049092940 8:140530397-140530419 AGGGAACAGCAGCAGGAAGAGGG + Intergenic
1049169246 8:141148349-141148371 ATGGACCAACAGCCGGAGCAGGG + Intronic
1049792729 8:144479386-144479408 CTCGAGCACCAGGAGGGGGAAGG - Intronic
1049997818 9:1047995-1048017 ATGGAGGACACACAGGAGGAAGG + Intergenic
1051609631 9:18948621-18948643 GCGAAGCACCATCAGGAGGAGGG + Intronic
1052709966 9:32042154-32042176 GAGGAGCAGCAGCTGGAGGATGG - Intergenic
1052968769 9:34363625-34363647 AGAGAGCAGCAGCAGGGGGAAGG - Intergenic
1052983465 9:34466913-34466935 AGGGAGAACCAGCAGTTGGATGG - Intronic
1053728992 9:41033466-41033488 AGGAGGCACCAGCAGGAGGTTGG + Intergenic
1053750017 9:41243742-41243764 ATGGAGAACCAGGAGAAAGAAGG - Intergenic
1054255516 9:62808080-62808102 ATGGAGAACCAGGAGAAAGAAGG - Intergenic
1054335789 9:63807528-63807550 ATGGAGAACCAGGAGAAAGAAGG + Intergenic
1054699520 9:68398617-68398639 AGGAGGCACCAGCAGGAGGTTGG - Intronic
1055943704 9:81673914-81673936 ATGGACCACCAGATGGAGAAAGG - Intronic
1056327355 9:85490915-85490937 ATGGGGAGCCAGAAGGAGGATGG - Intergenic
1056453017 9:86734838-86734860 ATGTTGCCCCAGCAGGAAGAGGG - Intergenic
1056874122 9:90311607-90311629 ATAGAACACCTGCAGGAGGAGGG - Intergenic
1057325858 9:94062606-94062628 TGGGAGCAGGAGCAGGAGGAAGG + Intronic
1057388210 9:94622669-94622691 AAAGAGAAGCAGCAGGAGGAGGG - Intronic
1058805792 9:108590378-108590400 ATTGAGCAACAGCATGAAGAAGG - Intergenic
1059256610 9:112936818-112936840 ATGGAGCACAAGGAATAGGAGGG + Intergenic
1059694862 9:116721435-116721457 ATGGAGCCCCAGTGGGAAGAAGG + Intronic
1060222493 9:121772102-121772124 AGGGAGCGGCAGCAGGAGGCTGG + Intronic
1060989402 9:127839457-127839479 AAGAAGCAGCAGGAGGAGGAAGG + Intronic
1061263310 9:129491657-129491679 CTCGAGCACAGGCAGGAGGAAGG - Intergenic
1061329086 9:129881031-129881053 TTGGAACACCAGGAGGAGGTTGG + Exonic
1061385459 9:130286890-130286912 ATGGAGCCCCGAGAGGAGGAAGG - Intronic
1062564534 9:137158295-137158317 AGGGAGAAGCAGCAGGGGGAAGG + Intronic
1062589304 9:137266338-137266360 CCGGAGCAGCAGCAGGAGGTCGG - Exonic
1203375716 Un_KI270442v1:374937-374959 ATGGAGAACCAGGAGAAAGAAGG + Intergenic
1185504415 X:620518-620540 CTGGGGCACGGGCAGGAGGAAGG + Intergenic
1186431094 X:9504836-9504858 GTGGAGTACCAGAAGGAGGTGGG + Intronic
1190427250 X:50345255-50345277 AGGGAGGAAAAGCAGGAGGAAGG - Intronic
1190533784 X:51407047-51407069 CAGAAGCACCAGCAGGACGAGGG + Exonic
1191846303 X:65550361-65550383 GTGGAGCACCAGCAGGAGGAAGG + Intergenic
1191846314 X:65550412-65550434 GTGGAGCACTACCAGGAGGAAGG + Intergenic
1192098515 X:68239071-68239093 ATGGGGAGCCAGAAGGAGGATGG + Intronic
1193571596 X:83151533-83151555 ATGGAGGACGAGCAGAAGCAGGG + Intergenic
1194903188 X:99540672-99540694 ATGGAGTCCCAGAAGGAGAAAGG + Intergenic
1195654754 X:107323938-107323960 ATGGAGCACGAGAGGCAGGAGGG + Intergenic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1198082915 X:133255828-133255850 ACAGAGCAAAAGCAGGAGGAGGG - Intergenic
1198292050 X:135249188-135249210 ATGGAGCATCAGGAGGAAGGTGG - Intronic
1198767210 X:140091743-140091765 ATGGAGGAGCAGCAGAAGGAGGG + Intergenic
1198936299 X:141904703-141904725 CTGGAGCACCTGCAAGAGGAAGG - Exonic
1200952653 Y:8915780-8915802 ATGGTGCACCACCAGCATGAGGG + Intergenic
1201066313 Y:10098629-10098651 ATGGAGAACCAGGAGAAAGAAGG - Intergenic
1201300219 Y:12498670-12498692 AAGCAGCAGCAGGAGGAGGAGGG - Intergenic