ID: 1083859403

View in Genome Browser
Species Human (GRCh38)
Location 11:65411904-65411926
Sequence CTGGGCCACCACTCTGAGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 2, 1: 0, 2: 0, 3: 25, 4: 230}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083859388_1083859403 17 Left 1083859388 11:65411864-65411886 CCACCTTCCTCCTGCTGGTGCTC 0: 2
1: 1
2: 12
3: 82
4: 732
Right 1083859403 11:65411904-65411926 CTGGGCCACCACTCTGAGGAGGG 0: 2
1: 0
2: 0
3: 25
4: 230
1083859396_1083859403 -9 Left 1083859396 11:65411890-65411912 CCCCCAATACCAGGCTGGGCCAC 0: 1
1: 0
2: 2
3: 29
4: 208
Right 1083859403 11:65411904-65411926 CTGGGCCACCACTCTGAGGAGGG 0: 2
1: 0
2: 0
3: 25
4: 230
1083859385_1083859403 25 Left 1083859385 11:65411856-65411878 CCAGTTTCCCACCTTCCTCCTGC 0: 1
1: 2
2: 7
3: 410
4: 10797
Right 1083859403 11:65411904-65411926 CTGGGCCACCACTCTGAGGAGGG 0: 2
1: 0
2: 0
3: 25
4: 230
1083859389_1083859403 14 Left 1083859389 11:65411867-65411889 CCTTCCTCCTGCTGGTGCTCCAT 0: 1
1: 1
2: 6
3: 47
4: 442
Right 1083859403 11:65411904-65411926 CTGGGCCACCACTCTGAGGAGGG 0: 2
1: 0
2: 0
3: 25
4: 230
1083859390_1083859403 10 Left 1083859390 11:65411871-65411893 CCTCCTGCTGGTGCTCCATCCCC 0: 1
1: 1
2: 4
3: 50
4: 409
Right 1083859403 11:65411904-65411926 CTGGGCCACCACTCTGAGGAGGG 0: 2
1: 0
2: 0
3: 25
4: 230
1083859394_1083859403 -5 Left 1083859394 11:65411886-65411908 CCATCCCCCAATACCAGGCTGGG 0: 1
1: 0
2: 2
3: 43
4: 392
Right 1083859403 11:65411904-65411926 CTGGGCCACCACTCTGAGGAGGG 0: 2
1: 0
2: 0
3: 25
4: 230
1083859391_1083859403 7 Left 1083859391 11:65411874-65411896 CCTGCTGGTGCTCCATCCCCCAA 0: 1
1: 0
2: 1
3: 18
4: 218
Right 1083859403 11:65411904-65411926 CTGGGCCACCACTCTGAGGAGGG 0: 2
1: 0
2: 0
3: 25
4: 230
1083859387_1083859403 18 Left 1083859387 11:65411863-65411885 CCCACCTTCCTCCTGCTGGTGCT 0: 1
1: 3
2: 3
3: 40
4: 501
Right 1083859403 11:65411904-65411926 CTGGGCCACCACTCTGAGGAGGG 0: 2
1: 0
2: 0
3: 25
4: 230
1083859397_1083859403 -10 Left 1083859397 11:65411891-65411913 CCCCAATACCAGGCTGGGCCACC 0: 1
1: 0
2: 1
3: 17
4: 175
Right 1083859403 11:65411904-65411926 CTGGGCCACCACTCTGAGGAGGG 0: 2
1: 0
2: 0
3: 25
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083859403 Original CRISPR CTGGGCCACCACTCTGAGGA GGG Exonic
900103317 1:971936-971958 CGAGGCCACCACCCTGAGGGAGG - Intronic
900599110 1:3495603-3495625 CACGGCCACCTCTATGAGGATGG + Intronic
900976515 1:6020161-6020183 CTGGGCCAGGACTGTGGGGAGGG - Intronic
901712978 1:11130213-11130235 CTGCGGGTCCACTCTGAGGATGG - Intronic
902259998 1:15217772-15217794 TGGTGCCACCACACTGAGGAGGG + Intronic
903543238 1:24108412-24108434 CAGGGCCCCCAGTCTGAGGAGGG - Intronic
903738802 1:25546175-25546197 CTGGGTCACAACCCTGAGCAAGG - Intronic
905788491 1:40776645-40776667 CAGGGCCAGGACTCTAAGGAGGG - Intergenic
911043761 1:93612085-93612107 CTGGGGCACCACTGGCAGGATGG + Intronic
914682048 1:149945221-149945243 CTAGGCAATCACTCAGAGGACGG - Intronic
915736867 1:158090603-158090625 CTTAGGCTCCACTCTGAGGAAGG + Intronic
915755987 1:158260308-158260330 CTGAACCACCACTCTGAGCAAGG - Intergenic
916558383 1:165911940-165911962 CTGGGTCACCAGCCTAAGGAAGG - Intergenic
917967761 1:180189212-180189234 ATGTGCCACCACTGGGAGGAAGG - Intronic
920045537 1:203129931-203129953 CTGGACACCCACACTGAGGACGG - Intronic
920674335 1:208028940-208028962 CTGGGCCACCACAGAGAGGCAGG + Exonic
922182574 1:223246749-223246771 CAAGGCCACCACTCAGAGGTGGG + Intronic
922650720 1:227335754-227335776 GTGGGTCTCCACTCTGATGACGG + Intergenic
924489861 1:244525964-244525986 TGAGGCCAACACTCTGAGGATGG - Intronic
1062901535 10:1150362-1150384 GGGGGCCACCTGTCTGAGGATGG - Intergenic
1063216238 10:3928241-3928263 CTGGGCCAGCTCTATGAAGATGG - Intergenic
1067111960 10:43407522-43407544 CTGGTCCACGACTCTGCGGTTGG + Intronic
1069628870 10:69885472-69885494 CTGGGACACCACTTTCTGGAGGG - Intronic
1069891060 10:71652781-71652803 CAGGGCCACAGCTCTGAGGGTGG - Intronic
1071480938 10:86064505-86064527 CTGGCCCAGCACACTGAGGCAGG - Intronic
1073516188 10:104077583-104077605 CTGGTCCCCCACCCTGTGGAAGG + Intronic
1074106157 10:110391270-110391292 CTGGCCCAACATTCTGTGGAGGG + Intergenic
1074348738 10:112714127-112714149 CTGAGAAACCAATCTGAGGACGG + Intronic
1074849058 10:117424273-117424295 CTGGGCCCCCAGACTGAGCAAGG - Intergenic
1075291622 10:121236093-121236115 CTGGACCCTGACTCTGAGGAGGG - Intergenic
1076603423 10:131674068-131674090 CTGGGGTCCCACCCTGAGGAAGG + Intergenic
1076833220 10:133007311-133007333 CTGGGCCTCCACTCTTGGGAGGG + Intergenic
1077400441 11:2353505-2353527 CTGTGTCACCACACTGTGGATGG + Intergenic
1077885650 11:6385731-6385753 CAAGGCTTCCACTCTGAGGAGGG - Intergenic
1079485148 11:20928367-20928389 CCACGGCACCACTCTGAGGAAGG - Exonic
1083292612 11:61698287-61698309 CTGGGCCGCCCCTCTGCAGATGG - Intronic
1083800683 11:65044711-65044733 CTGGGTCCCCAGCCTGAGGAGGG + Exonic
1083859403 11:65411904-65411926 CTGGGCCACCACTCTGAGGAGGG + Exonic
1084118839 11:67057126-67057148 CTGGGACACCCCTCGGAGGCCGG - Intronic
1084149462 11:67281408-67281430 CTGGGCCCCTGCTCTGAGGGTGG + Intronic
1084273914 11:68042418-68042440 CTTGGCCACCACTCAGAAGAGGG - Intronic
1084399242 11:68934133-68934155 CTGGGCCACCATTCAGGAGAAGG - Intronic
1085024286 11:73227742-73227764 CAGGGCCACCCCTCTGTGAAAGG + Intronic
1085304167 11:75475828-75475850 CTGGGTCACCAATCTGAGGCAGG - Intronic
1085765531 11:79278675-79278697 CTGGACCATTTCTCTGAGGAAGG + Intronic
1088812324 11:113400086-113400108 CTCGACCAGCACTTTGAGGATGG - Exonic
1089635315 11:119808063-119808085 CTGGGCCACCAGCCTGTGGCAGG + Intergenic
1090265472 11:125350695-125350717 CTGGGGCTACAGTCTGAGGACGG + Intronic
1090851056 11:130570916-130570938 CAGGGTCACCATTCTGAGGGCGG + Intergenic
1091230247 11:133983681-133983703 CTTGGCCCCCTCTGTGAGGAAGG - Intergenic
1091623306 12:2105834-2105856 CTGGGCGCCCACCCTGGGGAGGG + Intronic
1091623488 12:2106420-2106442 CTGGGCGCCCACCCTGGGGAGGG + Intronic
1092290123 12:7155490-7155512 TTTGGCCTCCACTCTGAGGGTGG + Intronic
1092770454 12:11891839-11891861 TTGGGCCACCCATCTGAGGGAGG + Exonic
1093218774 12:16393739-16393761 CTGGGCCACAGGTCTAAGGAAGG - Intronic
1094669269 12:32553151-32553173 CTGCTCCACCACTCTCGGGATGG - Intronic
1096821993 12:54243584-54243606 ATGAGCCACCACGCTGAGGCTGG - Intronic
1097610895 12:61818578-61818600 ATGGAGCACCACTCTGAGGCAGG + Intronic
1101432893 12:104641487-104641509 CTGTTCCACCCCTCAGAGGAGGG - Intronic
1102950138 12:117025917-117025939 CAGGGCCACACCTCTGGGGAAGG - Intronic
1103411516 12:120715344-120715366 CTGGGCAACCAGGCTGAGTAGGG - Intronic
1104002864 12:124871505-124871527 CAGGGCAACGACTCTGAGGCAGG + Intronic
1104901935 12:132194161-132194183 GTGGGGCACCCCTCTGAGGCAGG + Intergenic
1104986705 12:132601415-132601437 CTGGGTCACCCCCGTGAGGACGG + Intergenic
1105276404 13:18932052-18932074 CTGGGCCACCTCTCCCAGAAGGG + Intergenic
1113495667 13:110726451-110726473 CTGGGCCTCCACTCCTGGGATGG - Intergenic
1115707440 14:36013523-36013545 CTGAGCCTCCACTGTTAGGAAGG - Intergenic
1118038484 14:61892963-61892985 CTGAGTCACCACACTGAGGAAGG - Intergenic
1118301308 14:64618910-64618932 CTGGGGCACCCAACTGAGGAAGG - Intergenic
1119151449 14:72363519-72363541 CTGGGCCACCCGTGTAAGGATGG + Intronic
1121342564 14:93114457-93114479 CTGGGCCACCTGTCTGAGAACGG - Intronic
1121910316 14:97784432-97784454 CTCCGTCACCTCTCTGAGGAGGG + Intergenic
1122181166 14:99955816-99955838 CTGGGCCACCAGTTTGCAGATGG + Intergenic
1122428550 14:101625581-101625603 CTGGTCCACCCTTCTCAGGAAGG + Intergenic
1122629852 14:103102667-103102689 CTGGGCCACGGCGCTGTGGAAGG - Exonic
1122783787 14:104154787-104154809 CCGGGCCGCCCCTCTGTGGAGGG - Intronic
1122976234 14:105171963-105171985 CTGGGCCATCAGTCTGCGGCAGG - Intergenic
1124221233 15:27851435-27851457 CTGAGCCACGACCCTGAGGTTGG - Exonic
1125420666 15:39501139-39501161 CTGGGCCACCACTGTGGCCAGGG + Intergenic
1128131451 15:65229778-65229800 CTGGAGCATCATTCTGAGGATGG + Intergenic
1128153945 15:65380216-65380238 CTGGCCCACCACTTTGGGGGTGG + Intergenic
1132391660 15:101443556-101443578 CTGGGGGTCCATTCTGAGGAAGG + Exonic
1135994213 16:27236096-27236118 CAGGTCCATCAGTCTGAGGAGGG + Intronic
1138418876 16:56886634-56886656 CTCGGCCCCCACTCTGTGGGTGG - Intronic
1140808478 16:78554820-78554842 CTGGGCCACCATTCAGAGTCAGG - Intronic
1141003231 16:80327698-80327720 CTGGGCCCCTTCCCTGAGGAGGG - Intergenic
1141425572 16:83942410-83942432 CTGGGCCATCAGTCTGGGGTGGG + Intronic
1142273335 16:89102493-89102515 CTGGGCCTCCCCACTGAGGAAGG - Intronic
1142918539 17:3163750-3163772 CTGGATCCCCACTCTGGGGAAGG - Intergenic
1143716698 17:8776868-8776890 CTGGGCCACCAAGCTGGAGAGGG + Intergenic
1143845872 17:9772402-9772424 CTCGGCCTCCACTCTGTGCAAGG + Intronic
1144575840 17:16428828-16428850 CTGGGACACCACTGTGAGCAGGG - Exonic
1144730469 17:17523117-17523139 CTGGCCCAGCACACTGAGGAAGG + Intronic
1145235003 17:21202099-21202121 CGGGGCCTCCACTCTCAGGTGGG + Intronic
1145273279 17:21415815-21415837 CTGGGCCACCACCATGAAGACGG - Exonic
1145311468 17:21703259-21703281 CTGGGCCACCACCATGAAGACGG - Exonic
1145811314 17:27765838-27765860 CTAGGCCACCACCCTGAGCTTGG + Intronic
1145841989 17:28002887-28002909 CAGGGCCCCCTCTCTGAGCATGG + Intergenic
1148054586 17:44786629-44786651 CTGGGCCACCACTGGGTGCAGGG + Intergenic
1148127265 17:45243258-45243280 CTTGGCCATCACCCTGCGGAAGG + Exonic
1148159961 17:45444152-45444174 CTGGGCCAGCCCTGTGGGGAGGG + Intronic
1149137797 17:53390767-53390789 CAGGGCCACGTCTCTGGGGAAGG - Intergenic
1150228317 17:63535735-63535757 CTGGACCGCTACTCTGAGTATGG + Exonic
1150391251 17:64791031-64791053 CTGGGCCAGCCCTGTGGGGAGGG + Intergenic
1150538891 17:66076201-66076223 CTGGGCCAGAACTCAGAGAAAGG + Intronic
1151619586 17:75237765-75237787 CTGGGCCACCTCCCTGGGGATGG + Exonic
1151815724 17:76470508-76470530 CTCACCCACCACACTGAGGATGG - Intergenic
1152794079 17:82298407-82298429 CTGGGCAACCTTCCTGAGGACGG + Intergenic
1152919409 17:83058423-83058445 CTGGGCATCCACTCTGGGAAGGG + Intergenic
1153234294 18:2971008-2971030 CTGGGCCGCCACTCGGAGAGAGG - Intronic
1153381886 18:4449493-4449515 AAGGGCCATAACTCTGAGGATGG - Intronic
1156979208 18:43265243-43265265 CTGGGAGACAACTCTGAGTAGGG - Intergenic
1159207133 18:65267175-65267197 CAGGGGCACCACTCAGATGAGGG - Intergenic
1159954828 18:74511899-74511921 CTGAGCCCTCACTCTGAGCAAGG + Intronic
1161379222 19:3955882-3955904 CGGGGTCACCCCACTGAGGAAGG + Intergenic
1161400147 19:4063706-4063728 CTGGGCCACCACACAGTGGGAGG + Intronic
1164006184 19:21151584-21151606 CTGGGCCACCATTATGATGGTGG + Intronic
1164562385 19:29301185-29301207 CTGGGCCACCAAGTAGAGGACGG - Intergenic
1166054877 19:40282465-40282487 CCTTGCCTCCACTCTGAGGAGGG + Intronic
1166688750 19:44810644-44810666 CAGGGCCACCTCTGTGATGATGG - Intronic
1167611415 19:50509568-50509590 CTCGGCCTCCGCTATGAGGAGGG + Intronic
1167826401 19:51977574-51977596 CTGGGCCACAATCCTGAAGAGGG + Intronic
924987675 2:287232-287254 GTGGGCCACCACTCTGGGCAGGG + Intronic
925338193 2:3114197-3114219 CTGGGCCCCCACTCACAGGGGGG - Intergenic
927638249 2:24831460-24831482 CTGGGCCACCAGGCTGTGGCAGG - Intronic
929263582 2:39893946-39893968 CTGGAGCATCACTCTGGGGAGGG - Intergenic
929905314 2:46040520-46040542 CTGGGGGAGCACTCTGGGGAAGG + Intronic
931876269 2:66516743-66516765 CGGGTCCGCCACTCTAAGGACGG + Intronic
932793488 2:74675310-74675332 GTGGGCCACGACTCTGAGATAGG - Exonic
935292274 2:101620730-101620752 CTGGGCCACCCTGGTGAGGAGGG + Intergenic
936350269 2:111707089-111707111 CTGGGGCACCAAGGTGAGGAGGG + Intergenic
937341791 2:121095936-121095958 CTGGGGAACCAGTCTGAGGCCGG + Intergenic
937347147 2:121133099-121133121 CCAGGCCAGCTCTCTGAGGAAGG - Intergenic
937812564 2:126215323-126215345 ATGGCCCACCTCTCTGAGGGAGG - Intergenic
937872458 2:126795911-126795933 CTGTGCCACTACTCTGAGAACGG + Intergenic
937925208 2:127162646-127162668 CTGGCCCTCCACCCTGGGGAGGG - Intergenic
938079437 2:128361812-128361834 CTGGGCCACCACGCGATGGAAGG - Intergenic
938342354 2:130544156-130544178 CTGGGCCAGCAGGCTGGGGAGGG - Intronic
938347478 2:130576553-130576575 CTGGGCCAGCAGGCTGGGGAGGG + Intronic
938420696 2:131144011-131144033 CCTGGTCACCACTCTGAGGCAGG - Intronic
939008677 2:136819619-136819641 CTGAGCCACCACCTGGAGGAAGG + Intronic
940014790 2:149092777-149092799 CTGGTCCACCATCCTGAGCAGGG - Intronic
941445484 2:165593541-165593563 CTGGGCCAACTCTCCAAGGAAGG - Intronic
944539591 2:200743059-200743081 CTGGGGCACCAGGATGAGGATGG + Intergenic
945545489 2:211145143-211145165 CTGGGCCACAGCTCTGGGGCTGG - Intergenic
945721362 2:213421872-213421894 CTGGGTCTCCTCTCTGTGGAGGG + Intronic
945759591 2:213897776-213897798 CTGGGCAATCACTCTAAGTAAGG - Intronic
946401882 2:219472549-219472571 CCAGGCACCCACTCTGAGGATGG - Intronic
947795561 2:232891900-232891922 CTGGGCCACAGCGCTGATGAGGG + Intronic
948977899 2:241474941-241474963 CTACGCCACCACTCTCAGCATGG + Intronic
948978784 2:241481858-241481880 CTGCGCCCCCTCTCTGAGGCAGG + Intronic
1168774253 20:434904-434926 CAGGGCCTCCACCCTGGGGATGG - Intergenic
1169215884 20:3794737-3794759 CTTGGCCACCCCTCTCAGGTGGG + Intronic
1169642683 20:7772303-7772325 CTGGGCCACCGACCTGGGGATGG + Intergenic
1169975584 20:11323643-11323665 ATGGATCACCATTCTGAGGAAGG - Intergenic
1172304828 20:33873347-33873369 ATAGGACACCCCTCTGAGGAGGG - Intergenic
1172572369 20:35980642-35980664 CTTGGCCACCAGGCTGAGGCTGG + Intronic
1173869943 20:46335019-46335041 CAGGGCCACCTCTCTGAGAGAGG + Intergenic
1174399185 20:50266894-50266916 CTAGGCCAGCACCCTGAAGAAGG + Intergenic
1175165835 20:57043897-57043919 CTGGACCGGCACTCTGAGCAGGG + Intergenic
1175323708 20:58107786-58107808 ATGTGCCACCACTGTGTGGAGGG - Intergenic
1175429034 20:58889871-58889893 CCGGGCCACCATGCTGAAGATGG + Intronic
1175802280 20:61807613-61807635 TTTGGCCACCACTCTGTGGCTGG - Intronic
1181508106 22:23375297-23375319 CTGGTACACTACTCTGAGAAAGG + Intergenic
1181582777 22:23837231-23837253 CAGGGCCACCAGGCTGTGGATGG - Intronic
1181673446 22:24436855-24436877 CTGGGACAAGACCCTGAGGAAGG + Intronic
1182326707 22:29518770-29518792 CTGGGCCTCCTCTGTGAGGCAGG + Intronic
1182374948 22:29839775-29839797 GTGGGCCAGGAATCTGAGGATGG + Intergenic
1183036291 22:35143269-35143291 CTGAGTCACCACTTGGAGGAGGG + Intergenic
1183104508 22:35606566-35606588 CTGGGCCACCGCTCAGAGGCAGG - Intergenic
952004738 3:28830366-28830388 CTTGTCCACCACTCTCAGGTAGG + Intergenic
953581372 3:44160106-44160128 TAGGCCCACAACTCTGAGGATGG + Intergenic
953712690 3:45288049-45288071 CTCTGCCACCACCCTGTGGAAGG + Intergenic
953796045 3:45986704-45986726 CAGGGACACCAAACTGAGGATGG + Intronic
954070425 3:48138985-48139007 CTTGGCCACCAACTTGAGGAGGG + Intergenic
954390386 3:50265386-50265408 GTGGGACACCCATCTGAGGAAGG - Intergenic
955713945 3:61809114-61809136 CTGGGCCTTCACTATGTGGAAGG - Intronic
956000074 3:64720449-64720471 CAGGCCCATCACTCTGAGGTTGG - Intergenic
956015108 3:64874181-64874203 CAGTGCCACCATGCTGAGGAAGG - Intergenic
956450614 3:69371215-69371237 GTGGGCTACAACTCTGAGGCTGG + Intronic
957107259 3:75906724-75906746 CTGCGCCACCACCCGGAGGAGGG + Exonic
961652187 3:128422158-128422180 CTGGGCCAGTGCTCTGAGGCTGG + Intergenic
962853178 3:139323185-139323207 CCCCGCCACCACTCTCAGGAGGG - Intronic
962907041 3:139813403-139813425 CTGGGCAACCACTCTGCCTATGG - Intergenic
963923820 3:150930495-150930517 CTCAGCTACCACTCTGAGGATGG - Intronic
965794743 3:172428111-172428133 CTGGGGCATGACACTGAGGAGGG - Intergenic
968486883 4:867156-867178 CTGGGCCTGCACTCCGAGGTGGG - Exonic
970004494 4:11397431-11397453 CTGGGACACACCTCTTAGGATGG + Exonic
970977204 4:22055844-22055866 CTGGGCCTCTTCTCTCAGGATGG - Intergenic
971696258 4:29907764-29907786 CTGGGTCACAACTCTGGAGAAGG + Intergenic
972189126 4:36568935-36568957 CTTGGCCAGAACTCTGAGGAGGG - Intergenic
976224109 4:82781626-82781648 CTGGGCCACTACCCTTATGAAGG + Intronic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
977320728 4:95512280-95512302 CAGGCACACCACTCTGATGAAGG + Intronic
978985983 4:115013584-115013606 GTGGTCCACCACTCAGAGTACGG + Intronic
979174887 4:117651365-117651387 CTGGGCCAGCCCTGAGAGGAAGG + Intergenic
980567760 4:134567463-134567485 TAAGGGCACCACTCTGAGGAAGG - Intergenic
984499252 4:180537518-180537540 ATGGTCAACCACTCTGTGGAGGG - Intergenic
985657609 5:1140250-1140272 CAGGGCCACCTTTCTCAGGAGGG - Intergenic
986677711 5:10201407-10201429 CTTGGCCATGTCTCTGAGGAGGG + Intergenic
989007674 5:36833388-36833410 ATAGGCCAGCAGTCTGAGGAAGG + Intergenic
992189873 5:74281282-74281304 CTGGGCCATCAAGGTGAGGAGGG - Intergenic
995678931 5:114695681-114695703 CTCAGCCACCTCTCTGAGGCGGG + Intergenic
995906614 5:117131730-117131752 CTGGTCAATCACTCTGTGGAAGG + Intergenic
996436465 5:123438538-123438560 CTGAGCCACCATTCTCAGTACGG - Intergenic
996837807 5:127813175-127813197 CTGGGCCCCCGCAATGAGGAAGG - Intergenic
999300287 5:150486376-150486398 CTGGGGCGCCACTCGGGGGAAGG - Intronic
999687331 5:154114892-154114914 CTGGGCCAGCTCTCTGGGGAGGG - Intronic
1000343928 5:160298526-160298548 CTGGGCCTACAGTCTGGGGAGGG + Intronic
1001590484 5:172861188-172861210 CTTGGCCAAGACTCTGAGGTGGG - Intronic
1001939714 5:175731824-175731846 CTGAGCCACCACTCCCTGGATGG - Intergenic
1002180759 5:177429946-177429968 GTGGGCCACCAGGTTGAGGAGGG - Intronic
1002189465 5:177471210-177471232 CAGGACCATCACTCTCAGGATGG + Intronic
1003610983 6:7614850-7614872 CTGTGCCCCATCTCTGAGGAGGG - Intergenic
1004251035 6:14023354-14023376 CTGGGGCCACACCCTGAGGACGG - Intergenic
1007304401 6:40892787-40892809 CTGGACCCCCATCCTGAGGATGG - Intergenic
1008109172 6:47474146-47474168 ATGGGCCACCAGTTTGAGCAGGG + Intergenic
1008208038 6:48686967-48686989 CTTGGCCACAGGTCTGAGGAAGG - Intergenic
1014014605 6:116515898-116515920 ATTGTCCACCACTCTGTGGAGGG - Exonic
1014829603 6:126086871-126086893 TGGGGGCACCACTCTGAGAAGGG + Intergenic
1016920647 6:149289731-149289753 CTGTGACACAACTCTCAGGAGGG + Intronic
1018235292 6:161717814-161717836 CTGGGCCAAAACTCTCAGGCAGG - Intronic
1019770991 7:2883504-2883526 TGGGGCCACCACAGTGAGGAAGG - Intergenic
1019985580 7:4652997-4653019 CTGGGCCACCACCTTGCAGATGG - Intergenic
1020092302 7:5348586-5348608 CTGGGCCACCTCAGAGAGGAAGG + Intronic
1024017203 7:45327966-45327988 CTGTGTCACCACACTGAGGGAGG - Intergenic
1024226879 7:47332201-47332223 TTGGGACACCACTGTGAGGCAGG + Intronic
1025020517 7:55476316-55476338 CTGGGCCAGCTCACTGAGAAGGG - Intronic
1026549905 7:71359279-71359301 CTGTGCCACCTCTCAGAGGAGGG + Intronic
1027800901 7:82747740-82747762 CTGGTCATCCAGTCTGAGGAAGG + Intergenic
1028482485 7:91322763-91322785 CTGGGTCATCACTCTCAGGAAGG + Intergenic
1029606150 7:101600681-101600703 CTGGACCTCCACTGTGAGGTGGG - Intergenic
1030902334 7:115140122-115140144 CTGAGGCTCCACTCTGATGAAGG + Intergenic
1033771865 7:144561176-144561198 CTGGGCTATCAGTCTGAGAAAGG + Intronic
1034273755 7:149815300-149815322 CTGGGCCAGCTCTCCCAGGACGG + Intergenic
1036423348 8:8618590-8618612 CTGGGCCACCACTCAGAGCTTGG - Intergenic
1037905998 8:22716423-22716445 CTGGGCCACCACTCTGTGCCTGG + Intronic
1040563609 8:48546314-48546336 ATGGGCCAACAACCTGAGGAAGG - Intergenic
1040599508 8:48870205-48870227 CGGGGCCCACGCTCTGAGGAGGG - Intergenic
1040625840 8:49149229-49149251 CTGGGGCAGCATTCTGAGGTGGG + Intergenic
1042020414 8:64368431-64368453 CTGGGCCTCCCCTCTGGAGATGG - Intergenic
1047582108 8:126227243-126227265 CAGGGCCAGCACTTTGAGAATGG + Intergenic
1049378934 8:142302475-142302497 CTGGGACAGGACTCTCAGGATGG + Intronic
1051446666 9:17147257-17147279 CTTGCCCAACACTCTGAGTAGGG + Intronic
1057123786 9:92600523-92600545 CTGGGCCACCCCACTGGGGCTGG + Intronic
1057212851 9:93210033-93210055 TTGGGGCCCCACTGTGAGGATGG + Intronic
1059579131 9:115524532-115524554 CTGGCCCACCAGTCAGATGAGGG - Intergenic
1061198781 9:129124127-129124149 CTGGGTGACCACTGTCAGGAGGG - Intronic
1061782352 9:133003627-133003649 CTGGGCGTCCACTCTGGGCAGGG + Intergenic
1189737136 X:44083110-44083132 CTGGCCCACCACTCGGAAGGAGG + Intergenic
1191846288 X:65550324-65550346 CTGGGCCACCACTCTGAGGAGGG - Intergenic
1192190548 X:68988774-68988796 CTGGGCCCCTACTCTGAGACAGG + Intergenic
1193271048 X:79530656-79530678 CTGGCCCACCACTCTGAGCCTGG - Intergenic
1196107558 X:111912794-111912816 CTAGGTCCCCACTCTGATGATGG - Exonic
1198341003 X:135713462-135713484 CTGGGCCAGCACACTGTGGCTGG + Exonic
1199089949 X:143680070-143680092 CTGAGCCACCACTCTCAGTTGGG - Intergenic
1201306644 Y:12556337-12556359 CCTGGCCAGAACTCTGAGGAGGG + Intergenic