ID: 1083859461

View in Genome Browser
Species Human (GRCh38)
Location 11:65412146-65412168
Sequence GTGTGGGTCTGGAGGCCAGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 596
Summary {0: 1, 1: 1, 2: 2, 3: 55, 4: 537}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083859461_1083859469 13 Left 1083859461 11:65412146-65412168 CCACCTGGCCTCCAGACCCACAC 0: 1
1: 1
2: 2
3: 55
4: 537
Right 1083859469 11:65412182-65412204 AAAACTGAAAATCCCCTGGTGGG 0: 1
1: 0
2: 2
3: 21
4: 194
1083859461_1083859470 23 Left 1083859461 11:65412146-65412168 CCACCTGGCCTCCAGACCCACAC 0: 1
1: 1
2: 2
3: 55
4: 537
Right 1083859470 11:65412192-65412214 ATCCCCTGGTGGGCACTCCCTGG 0: 1
1: 0
2: 0
3: 14
4: 140
1083859461_1083859467 9 Left 1083859461 11:65412146-65412168 CCACCTGGCCTCCAGACCCACAC 0: 1
1: 1
2: 2
3: 55
4: 537
Right 1083859467 11:65412178-65412200 GTGAAAAACTGAAAATCCCCTGG 0: 1
1: 2
2: 11
3: 69
4: 300
1083859461_1083859468 12 Left 1083859461 11:65412146-65412168 CCACCTGGCCTCCAGACCCACAC 0: 1
1: 1
2: 2
3: 55
4: 537
Right 1083859468 11:65412181-65412203 AAAAACTGAAAATCCCCTGGTGG 0: 1
1: 0
2: 2
3: 30
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083859461 Original CRISPR GTGTGGGTCTGGAGGCCAGG TGG (reversed) Exonic
900250461 1:1666095-1666117 GCCTGGGTCTGGAGGCTGGGTGG + Intronic
900313258 1:2044850-2044872 GGGTGGGGCGGGAGGCCCGGAGG + Intergenic
900465378 1:2822706-2822728 GTGTGGGTCTCGTGAGCAGGAGG - Intergenic
900547626 1:3237348-3237370 GTGGGGGTGGGGAGCCCAGGAGG - Intronic
900646999 1:3713477-3713499 GTGTGGGACTCGGGGCAAGGTGG + Intronic
900736042 1:4300139-4300161 GTGTGGGCCAGGAGGCTAGCGGG + Intergenic
901662534 1:10807570-10807592 GGTTGGGCCTGGAAGCCAGGGGG - Intergenic
901752627 1:11420727-11420749 GTGTAAGTCTGGAGTTCAGGAGG - Intergenic
902335342 1:15751289-15751311 GGGAGGGCATGGAGGCCAGGAGG + Intergenic
902392769 1:16115885-16115907 GTGGGGGACTGGGGGGCAGGAGG + Intergenic
902518023 1:17000248-17000270 GTGTGCGTGTGCCGGCCAGGGGG - Exonic
902888860 1:19426759-19426781 CTGTGGGTCAGGAGTTCAGGAGG - Intronic
903211725 1:21822691-21822713 GGGTGGGAATGCAGGCCAGGAGG + Exonic
903303165 1:22393243-22393265 GTGGGGGTCAGGAGTCCAGCAGG + Intergenic
903499248 1:23792569-23792591 GTGTGGGGCTGATGGCCTGGTGG + Intronic
903672919 1:25047020-25047042 GTGTGGGTCTGCAGAGCAGCTGG - Intergenic
904456440 1:30651065-30651087 CTGTGGGTCTGGGTGCCAAGTGG - Intergenic
904748459 1:32725709-32725731 ATGTGGGTATGCAGCCCAGGAGG - Intergenic
905894747 1:41538238-41538260 GTGTGGGTGGGGAGGTCTGGAGG + Intronic
905930455 1:41783232-41783254 GTGTGGGTGTTGGGGCCAGGAGG + Intronic
906098210 1:43238498-43238520 GTGGGGGTCTGGAGGATTGGAGG + Intronic
906100400 1:43256746-43256768 GGGTGGGGCTGCAGGCCAGTCGG + Intronic
906586592 1:46984083-46984105 GTGTCAGTCTGGAGGCCCAGGGG + Intergenic
907516653 1:54997246-54997268 GTCTGGCCCTGGAGCCCAGGCGG - Intergenic
907734479 1:57098475-57098497 TTGTGTGTCTGGAGGGCAGAAGG + Intronic
907962298 1:59295135-59295157 GTGGAGGTCTGGAGGGCAGTGGG + Intergenic
908430494 1:64051939-64051961 GTGTGTGCCTGGAGGCCCAGTGG + Intronic
910805105 1:91181933-91181955 TCATGGCTCTGGAGGCCAGGAGG + Intergenic
911473248 1:98344477-98344499 GTGTGTGTGTGGAGGCGGGGTGG - Intergenic
911803481 1:102174938-102174960 ATGTGGGTCTGGAATCCAAGTGG - Intergenic
912576372 1:110675349-110675371 CTAGGGGTGTGGAGGCCAGGGGG - Intergenic
912861468 1:113217626-113217648 GTCTGGGTCAGGAGCACAGGAGG + Intergenic
913442168 1:118909505-118909527 GGATGGGGCTGGAAGCCAGGAGG + Intronic
914829446 1:151159988-151160010 GAGAGGGTCTGGAGGGGAGGGGG + Exonic
914870978 1:151473501-151473523 GCGTGGGTGTGGAGGCCGCGGGG + Intergenic
915444194 1:155965573-155965595 GTGTGGCAGTGGAGGCCAAGGGG - Intronic
916493807 1:165326930-165326952 GTGTGTGTCTGGGGGTGAGGGGG - Intronic
916522387 1:165575877-165575899 GCGTGGGCCTGGGGGTCAGGAGG - Intergenic
917487419 1:175467601-175467623 GTGTGAGTCTTGAGGCCACCTGG + Intronic
917535750 1:175873129-175873151 GTGTGGTGCTGGATTCCAGGGGG - Intergenic
917790601 1:178496516-178496538 GTGGGGGTCTGTGGACCAGGGGG - Intergenic
918485291 1:185022372-185022394 TTATGGTTCTGGAGGCTAGGAGG + Intergenic
918632909 1:186740139-186740161 ATGTGGGTTTGGAGTTCAGGAGG - Intergenic
918673931 1:187258099-187258121 GTGGGGGTTTGGAGGGGAGGTGG - Intergenic
919729079 1:200901494-200901516 CTGTGGGCCTGGAGGGCAGCGGG - Intronic
919885660 1:201932380-201932402 GAGAGGGTCAGGAGGACAGGAGG + Intronic
920432444 1:205927635-205927657 GTGTGGGGCTGGGGGGCACGGGG + Intronic
921265015 1:213414962-213414984 GGGTGGGTGTGGAGGCCAGAGGG + Intergenic
922290503 1:224205533-224205555 GTGTGAGTGTGGATGTCAGGTGG + Intergenic
924133735 1:240940372-240940394 CTGTGGATCTGGAGACCAGGTGG - Intronic
1063015582 10:2073749-2073771 ATGTGGGTATGGAGTCAAGGTGG - Intergenic
1063377697 10:5563899-5563921 GGGTGGGTGTGCAGGCCCGGCGG - Intergenic
1064118201 10:12596793-12596815 AAGGGGGACTGGAGGCCAGGAGG - Intronic
1064254424 10:13732039-13732061 CTGTGCTTCTGAAGGCCAGGAGG + Intronic
1064283410 10:13971008-13971030 GTGTGGGACAGGAGGCAAGGCGG - Intronic
1064936091 10:20680536-20680558 GTGTGTGTGTGGAGGCGGGGGGG + Intergenic
1065488209 10:26255045-26255067 GTATGGGCCTGGAGCTCAGGAGG + Intronic
1065935183 10:30514973-30514995 TGTTTGGTCTGGAGGCCAGGAGG - Intergenic
1066062851 10:31739480-31739502 CTATGGGTCTGGAGGCAATGAGG - Intergenic
1066253944 10:33660827-33660849 GGGAGGGGCTGGAGGGCAGGGGG - Intergenic
1066350936 10:34636316-34636338 GTGTGGGTTTGGATGACAGAGGG - Intronic
1066415044 10:35213957-35213979 GCTTGGGTCTGGAGGACAGAGGG + Intergenic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1067077733 10:43197678-43197700 CTGTGGGATTGGAGGTCAGGAGG - Intronic
1067083760 10:43227606-43227628 GTGTGGGTAGGGTGGCCAGGAGG + Intronic
1067103779 10:43351484-43351506 GTGGGGGTCTGGAATGCAGGGGG - Intergenic
1067288709 10:44926318-44926340 GTGAGGGCCTAGAGACCAGGTGG - Intronic
1067297086 10:44980745-44980767 GGGTGGGGCTGGAGGGCAGTGGG + Intronic
1067428656 10:46227833-46227855 GTGTTCATCTGGAGGCCCGGGGG - Intergenic
1067457154 10:46427218-46427240 GTGGGGCCCTGGAGGCCAGCAGG + Intergenic
1067630047 10:47957420-47957442 GTGGGGCCCTGGAGGCCAGCAGG - Intergenic
1067698422 10:48551907-48551929 GTGTGGCTTTGGAAGCCAGATGG + Intronic
1068953612 10:62802986-62803008 GTCTGGGTCTGTTGCCCAGGCGG - Intergenic
1070363950 10:75717583-75717605 CTGTGGGCCAGGAGGCAAGGAGG + Intronic
1070684393 10:78470254-78470276 GTGAGGGTCTGGATGCCCAGAGG - Intergenic
1070773437 10:79096149-79096171 GGGTGGGTCTGGAGGAGAGGGGG + Intronic
1071407413 10:85351489-85351511 CTGAGTGTCTGGAGGCCTGGAGG + Intergenic
1071502503 10:86213724-86213746 GTGGGGGTCAGGACCCCAGGGGG - Intronic
1072035576 10:91560468-91560490 GTAGGGGTCTGGAGGCAGGGAGG - Intergenic
1072621767 10:97084350-97084372 TTGTGGCTCTGCAGCCCAGGTGG - Intronic
1073323524 10:102629686-102629708 GGGAGGGTCTGGAGGCTATGGGG - Intronic
1073574913 10:104614352-104614374 GTGTGGGTCAGGAAGACAAGAGG - Intergenic
1074095107 10:110304751-110304773 GTGTGGGGCTGGGGGCGGGGCGG + Exonic
1074769628 10:116724898-116724920 TTCAGGGTCTGGGGGCCAGGTGG - Intronic
1075339311 10:121632903-121632925 CAGTGGGTTTGCAGGCCAGGAGG + Intergenic
1075578501 10:123598237-123598259 GTGAGGATCTGAAGGCCAGAGGG - Intergenic
1075626652 10:123968821-123968843 GGGTGAGTCTGGAGCACAGGAGG - Intergenic
1075807025 10:125196566-125196588 GTGGGGGTCTGGAGCCGAGTTGG - Intergenic
1076065104 10:127442326-127442348 GGCTGGGTCTGGGGGCCTGGTGG - Intronic
1076156134 10:128207078-128207100 GTGTGACTCTGGACTCCAGGTGG - Intergenic
1076317199 10:129550952-129550974 GTTTCGGCCTGGAGGGCAGGTGG + Intronic
1076525928 10:131112389-131112411 GTGGGGGCCTGGGGGACAGGGGG - Intronic
1076783475 10:132737228-132737250 GTGTGTGTCCAGAGGGCAGGTGG + Intronic
1076879198 10:133231576-133231598 GTGCGGGTCTGGAGACGGGGAGG + Intergenic
1077076857 11:706006-706028 GGCTGGGGCTGGAGCCCAGGCGG + Intronic
1077109174 11:854533-854555 GTGTGAGTCTCGGAGCCAGGTGG + Intronic
1077194467 11:1272337-1272359 GTCTGGGTGGGGAGGCGAGGAGG + Intergenic
1077195625 11:1278648-1278670 GTGTGGGTGTGGAGGAAAGGTGG - Intronic
1077299130 11:1839109-1839131 GCGGGGGTCTGGGGGCCTGGGGG + Intronic
1077508434 11:2942885-2942907 TTCTGGTCCTGGAGGCCAGGGGG - Intergenic
1077550361 11:3197467-3197489 GTGTGTGTCAGGTGGCCACGAGG + Intergenic
1077579027 11:3405048-3405070 ATGTGGCTCTGGAGGCCACTTGG + Intergenic
1077980472 11:7294729-7294751 GTGTGGGTGTGTGGGCCATGTGG - Intronic
1079735590 11:23993747-23993769 GTGTCGGTCTGGAGGCCCCAGGG - Intergenic
1080283842 11:30586205-30586227 GGCTGGGGCTGGGGGCCAGGGGG + Intronic
1080541060 11:33265857-33265879 GGGTGGGTCATGAGGTCAGGAGG + Intronic
1080896671 11:36453902-36453924 GGGAGGGTTTGGAGGACAGGAGG + Intronic
1081432961 11:42996691-42996713 GTGTGTGTGTGGAGGGCGGGGGG - Intergenic
1081611799 11:44567383-44567405 GTGTGTGTATGTAGGGCAGGGGG + Intronic
1081700204 11:45147713-45147735 GTGTGTGTCTAGAGCCCAGTTGG + Intronic
1081907319 11:46678209-46678231 GTGTGGGAAAGGAGGCCAAGAGG + Exonic
1082975102 11:59063229-59063251 GGGTGGGTCTGAAGGCCGGGCGG - Intergenic
1083616291 11:64028246-64028268 CTGAGGGTCTGGAGCCGAGGGGG + Intronic
1083681604 11:64354169-64354191 AGGTGGGTCTGGGGGTCAGGTGG + Exonic
1083738507 11:64695170-64695192 CAGTGGGGCTGGGGGCCAGGAGG - Intronic
1083827764 11:65212796-65212818 GTGAGGGGCTGGAGGGCAGGAGG + Intergenic
1083857390 11:65399938-65399960 GTGGGGGCCTGGGGGCAAGGTGG + Intronic
1083859461 11:65412146-65412168 GTGTGGGTCTGGAGGCCAGGTGG - Exonic
1084209635 11:67615046-67615068 GAGTGGGGCTGGAGCACAGGTGG - Intergenic
1084500078 11:69530231-69530253 CTCTGAGTCTGGAGTCCAGGAGG + Intergenic
1084610862 11:70202281-70202303 CCGTGGGTCTGGAGGTGAGGAGG - Intergenic
1084960214 11:72712565-72712587 GAGTGGGTCTCGGGGGCAGGAGG - Exonic
1085027480 11:73244992-73245014 GAGTGGGCCTGGAGGGGAGGAGG + Intergenic
1085462176 11:76700792-76700814 GGGTGGCTCTGGAGGCAAGAGGG + Intergenic
1085607140 11:77911327-77911349 GTGTGAGTTTGGTGGCCAGATGG + Intronic
1085753505 11:79184543-79184565 GTGTGGGGGTGGAGGTTAGGGGG + Intronic
1085771088 11:79326478-79326500 CTGTGGGTCTTTAGGCGAGGGGG - Intronic
1088289299 11:108219179-108219201 GTGGGAGGCTGGAGGGCAGGAGG + Intronic
1088554626 11:111049180-111049202 GTGTGGCTTTGGGGCCCAGGTGG - Intergenic
1088717121 11:112558681-112558703 CTGTGGGTCAGGAAGCCAAGTGG + Intergenic
1089055894 11:115584516-115584538 GGTTGGGGCTGGAGGCCAGGGGG + Intergenic
1089505416 11:118958818-118958840 GTGGAGGCCTGGAGGCCTGGGGG + Intergenic
1089683971 11:120135121-120135143 ATGTGGTTCTGGTGGGCAGGAGG - Intronic
1090413964 11:126528152-126528174 GTCTGGGTCTGTAGAGCAGGAGG - Intronic
1090977119 11:131687860-131687882 GTGTGGGGCTGGAGGATACGTGG - Intronic
1091615953 12:2051941-2051963 GGGTGGATGTGGAGGCGAGGAGG + Intronic
1091704092 12:2681970-2681992 GTGAGGATCTGGAGCTCAGGAGG + Intronic
1091713620 12:2760495-2760517 GGGAGGGTCTGGAGCTCAGGAGG + Intergenic
1091999307 12:5019475-5019497 GTGAGCCTCTGGAGGGCAGGGGG - Intergenic
1092209554 12:6637521-6637543 GAGTGTGGCTGGAGCCCAGGAGG + Intergenic
1092560177 12:9604509-9604531 GTGAGCGTATGGAGGCCAGATGG - Intronic
1092609201 12:10153940-10153962 GAGAGGGGCTGGAGGGCAGGAGG + Intergenic
1093450294 12:19306309-19306331 TTGTGGGGTTGGAGGCGAGGTGG + Intronic
1094526727 12:31235988-31236010 GTGAGGATCTGCAGGACAGGAGG - Intergenic
1094671026 12:32569438-32569460 GCTGGGGTCTGGAGGCCAGCAGG - Intronic
1096048628 12:48586614-48586636 GGGAGGGGCTGGAGGGCAGGAGG - Intergenic
1096618462 12:52847831-52847853 GTTTGGGTCTGTCAGCCAGGAGG - Intronic
1096650121 12:53058464-53058486 GCCTGGGGCTGGAGTCCAGGTGG + Intronic
1096774922 12:53957805-53957827 GTGGAGGTTTGCAGGCCAGGAGG - Exonic
1096882235 12:54682604-54682626 GGGTGGGTCAGGAGGACGGGAGG - Intergenic
1097277652 12:57824176-57824198 GAGTGGGTGTGGTGGCCACGGGG - Intronic
1101463535 12:104923134-104923156 GTGTGGGTCACGAGGTCAGGAGG + Intronic
1101745540 12:107538720-107538742 GTGTCTGTCTGGAGGACAGCGGG - Intronic
1102229904 12:111255465-111255487 GTGGGGGACGGGAGGCCAGGAGG - Intronic
1102819691 12:115897299-115897321 CCCTGAGTCTGGAGGCCAGGTGG + Intergenic
1102819700 12:115897335-115897357 CCCTGAGTCTGGAGGCCAGGTGG + Intergenic
1102819709 12:115897371-115897393 CCCTGAGTCTGGAGGCCAGGTGG + Intergenic
1102953540 12:117045555-117045577 GTTTGCCTCTGGAGCCCAGGGGG - Intronic
1104709845 12:130977763-130977785 GTGTGGGTACAGACGCCAGGCGG + Intronic
1105953481 13:25255947-25255969 GAGTGGGAATGGAGGCTAGGAGG - Intronic
1106195442 13:27490398-27490420 TTCTGGATCTGGAGCCCAGGAGG - Intergenic
1106456994 13:29936229-29936251 GTGTGGGTGTGGAGAGCAGTGGG + Intergenic
1107824155 13:44312413-44312435 GTGCCTGTCTTGAGGCCAGGGGG - Intergenic
1110794295 13:79619258-79619280 TTATTGGTCTGGTGGCCAGGAGG + Intergenic
1112774950 13:102833633-102833655 ATTTGGGGCTGGAGGCCATGTGG + Intronic
1113597805 13:111547034-111547056 GTGTGGATGTGGGGGCCACGTGG + Intergenic
1113959119 13:114116017-114116039 GTGTGGATGTTGAGGCCTGGAGG + Intronic
1114131640 14:19799942-19799964 GTGTTGGTCTGGAGGCCCCCCGG - Intronic
1114527058 14:23373062-23373084 GTTTGGGGCTGGGGGCCAAGTGG + Exonic
1114600521 14:23952669-23952691 GTCTGGCTTTGGAGGCCAGTGGG + Intergenic
1114604755 14:23987813-23987835 GTCTGGCTTTGGAGGCCAGTGGG + Intronic
1116435086 14:44887352-44887374 GTGTGGATGGGCAGGCCAGGAGG + Intergenic
1117326991 14:54678505-54678527 GTGTGTGTGTGTAGGTCAGGTGG + Intronic
1117574405 14:57083594-57083616 GTCTGAGTTTGGAGGCCAAGTGG - Intergenic
1118303211 14:64633448-64633470 TTGTGGGGGTGGAGGCCCGGAGG + Intergenic
1118326602 14:64785707-64785729 GTGTGGCTCTGGGGGCCTCGTGG + Intronic
1121183232 14:91945322-91945344 TTGTGGGTGTGGATGCCAGATGG + Intronic
1122093566 14:99355149-99355171 GTGTGGGAGTGGAGGACATGGGG - Intergenic
1122156341 14:99752655-99752677 GTCAGGGTCTGGAGGCCCCGTGG - Intronic
1122292562 14:100687497-100687519 GGGTGGGTGGAGAGGCCAGGAGG + Intergenic
1122393376 14:101406169-101406191 GTGCAGGTCAGGAGGTCAGGAGG + Intergenic
1122403020 14:101478672-101478694 GGGTGGGTGTGGGGGCCAGGCGG - Intergenic
1122606092 14:102948324-102948346 GGGTGGGTTTGGAGGTGAGGGGG + Intronic
1122606239 14:102948677-102948699 GGGTGGGTGTGGAGGTGAGGGGG + Intronic
1122794665 14:104200149-104200171 GGGTGGGGCTGGAGGCCGTGGGG + Intergenic
1122798761 14:104219551-104219573 GTGAGGGGCTGGGGGCCTGGGGG - Intergenic
1122994602 14:105256296-105256318 GTGTGGGTCTCCATGGCAGGAGG - Intronic
1123126805 14:105952697-105952719 GAGTGTGGCTTGAGGCCAGGAGG - Intergenic
1202905947 14_GL000194v1_random:72594-72616 GAGTGGAACTTGAGGCCAGGTGG + Intergenic
1123827826 15:24101309-24101331 GTGTGGGTCTGGGAGAAAGGAGG + Intergenic
1124530434 15:30500750-30500772 ATTTGTGTCTGGAGGGCAGGGGG - Intergenic
1124768225 15:32506938-32506960 ATTTGTGTCTGGAGGGCAGGGGG + Intergenic
1125141488 15:36413124-36413146 GTGTGGATCACGAGGTCAGGAGG - Intergenic
1125310324 15:38372098-38372120 CTGTGGGTCTGGAATTCAGGAGG - Intergenic
1125400531 15:39297793-39297815 GAGTGGGTCTGTTGGCCTGGTGG + Intergenic
1125929387 15:43589757-43589779 GGGTGGGGCTGGAGTCCAGGAGG - Intronic
1125942554 15:43689589-43689611 GGGTGGGGCTGGAGTCCAGGAGG - Intergenic
1126829069 15:52580868-52580890 GTGTGTGGCTGCAGGCCAGCAGG - Intergenic
1128019913 15:64381290-64381312 GTGTGGTACTGGAGGGCGGGGGG - Intronic
1128217639 15:65945383-65945405 GTGTGGGGCTGCAGGCCTGAGGG + Intronic
1128278013 15:66370467-66370489 GTGGGGGGCTGGAGGGGAGGAGG + Intronic
1128327598 15:66735189-66735211 GTGTGGCTTTGGTGGCCAGCAGG - Intronic
1128479836 15:68027739-68027761 GTTTTTGTCTGGAGTCCAGGAGG + Intergenic
1129326011 15:74800642-74800664 GTGAGGGCCTGGAGGCCACTAGG - Intronic
1129604030 15:77016075-77016097 GTGTGGGGCTGGGCTCCAGGTGG + Intronic
1129703771 15:77782999-77783021 GGCTGTGTCTGGAGACCAGGAGG - Intronic
1130181599 15:81634894-81634916 GTATTGGTCTGGAGGCCGGGGGG + Intergenic
1130896531 15:88174443-88174465 GTGTCTGGGTGGAGGCCAGGAGG - Intronic
1130979867 15:88804847-88804869 CTGTGGGGCTGGCTGCCAGGAGG + Intronic
1132337815 15:101059965-101059987 GTGTGTGTCTCTAGGCCAGCAGG - Intronic
1132352017 15:101145701-101145723 GTGTGAGTCTGGAGTCCTGGGGG - Intergenic
1132978424 16:2721586-2721608 CTGGGGGTCTGGAGGGAAGGAGG + Intergenic
1133465155 16:6020682-6020704 GTGTTGTTGTGCAGGCCAGGGGG + Intronic
1134007450 16:10827789-10827811 GTGTTGCTGGGGAGGCCAGGCGG - Intergenic
1134059832 16:11192418-11192440 GGGTGAGGGTGGAGGCCAGGAGG + Intergenic
1134438931 16:14286042-14286064 GGCTGGGTCTGCAGTCCAGGGGG - Intergenic
1135069898 16:19342720-19342742 GTGTGGTTACAGAGGCCAGGTGG - Intergenic
1135850256 16:25957040-25957062 GGGTGGATCTGGAGACAAGGAGG + Intronic
1136014141 16:27384048-27384070 GTGTGGGTGGGGAGGGCAGAGGG - Intergenic
1136294150 16:29292123-29292145 GTGAGGCTCAGGAGGGCAGGGGG + Intergenic
1136349421 16:29697242-29697264 GTGTGGCTGTGGAAGCCAGTGGG + Exonic
1136515986 16:30768565-30768587 GAGTGGGACTGGAGGCCACCTGG - Intronic
1137555942 16:49470417-49470439 GAGTTGGTCTGCAGGGCAGGGGG + Intergenic
1137761005 16:50940354-50940376 GTGTGGATCTGGCTTCCAGGAGG - Intergenic
1138419804 16:56891954-56891976 GTGGGGCTGTGGAGGCCAGGTGG + Intronic
1138477997 16:57283559-57283581 GTGAGGGTCTGGAAGCTGGGTGG - Intronic
1139339544 16:66259168-66259190 GTGTGGGTCCCGGGGACAGGTGG - Intergenic
1139494912 16:67309377-67309399 GTTGGGATCTGGAGGCCAGAGGG + Intronic
1139504802 16:67393489-67393511 GGGTGGGACTGCAGCCCAGGCGG + Intronic
1139616143 16:68094138-68094160 TTGTGGATCTGGAGGTCAAGAGG + Intronic
1141475741 16:84271986-84272008 GTGTATGCCTGGAGGCTAGGGGG + Intergenic
1141953320 16:87353305-87353327 GTGCGGGTCCTGAGGCAAGGGGG - Intronic
1142100054 16:88266169-88266191 GTGAGGCTCAGGAGGGCAGGGGG + Intergenic
1142186683 16:88698081-88698103 GCGAGGGTCTGCAGGCCCGGGGG + Intronic
1142334522 16:89479038-89479060 GTGTGGGTCTTGAGGCCCGAAGG - Intronic
1142753087 17:1999938-1999960 GTGGGGCCCTGGAGGCCAGGTGG + Intronic
1143329317 17:6121840-6121862 GTGAGGCTGTGGAGGCCAGGAGG + Exonic
1143336888 17:6178193-6178215 GTGTGGGTCGGGAGATGAGGTGG + Intergenic
1143461611 17:7108011-7108033 GTGTGGTCCAGGAAGCCAGGAGG - Intronic
1143593133 17:7897948-7897970 CTGTGGGGCAGGAGGCCATGGGG - Intronic
1144511810 17:15883480-15883502 CTGTGGTTCTGGAGGAGAGGAGG + Intergenic
1144653146 17:17019403-17019425 GTGTGGTTCTGGGGGCATGGAGG + Intergenic
1144698214 17:17320253-17320275 GAGTGGGTCTGGATGCTGGGTGG + Intronic
1144833298 17:18143624-18143646 GTGTGGGTCTGGGTGGCAGCAGG + Intronic
1145115885 17:20210676-20210698 GTGAGGGAGTGGAGGCCTGGTGG - Intronic
1145254693 17:21316212-21316234 GACTGGGGCTGGAGGACAGGAGG - Intergenic
1145279186 17:21455819-21455841 GAATGGGTCTGGAGACCTGGGGG + Intergenic
1145321904 17:21771753-21771775 GACTGGGGCTGGAGGACAGGAGG + Intergenic
1145398671 17:22514628-22514650 GAATGGGTCTGGAGACCTGGGGG - Intergenic
1145904019 17:28506591-28506613 GTGAGTGCCTGGAGGCCAAGGGG + Intronic
1145937954 17:28726192-28726214 GTGTGGGGCTGGCGGCCGGCGGG - Exonic
1146792611 17:35760957-35760979 GAGTGGGGCTGGAGGCAGGGTGG + Intronic
1147882889 17:43665352-43665374 GGGTGGGTGGGGAGGTCAGGAGG + Intergenic
1148215679 17:45833030-45833052 GACTGGGGCTGGAGGCCAAGAGG - Intronic
1148216229 17:45835337-45835359 GTAAGGTTCTGGAGGCCTGGGGG - Exonic
1148244976 17:46024686-46024708 GGGTGGGGCGGGAGGCCACGGGG + Exonic
1148581902 17:48750015-48750037 GGCTGGGTCTGGAGGGCTGGCGG + Intergenic
1148656857 17:49290708-49290730 GTGTGGGTGTGGAGTCCTTGTGG - Intronic
1149610964 17:57957426-57957448 GTGAGGGGCTGGAGCCCTGGGGG - Intergenic
1150294704 17:64001576-64001598 GAGTGAATCAGGAGGCCAGGAGG + Intronic
1150303354 17:64064168-64064190 GTGAGGGTCAGGAGCCCTGGAGG + Intronic
1151306793 17:73267741-73267763 GGGAGGGGCTGGAGGTCAGGAGG + Intergenic
1151492746 17:74442554-74442576 GTGCTGATCTGGAGGCCTGGGGG + Intronic
1152231778 17:79117522-79117544 GTGTGGGTGTGGAGGGAAGCGGG - Intronic
1152568632 17:81111550-81111572 GTGTGGATCTGCAGACCTGGAGG + Intronic
1152582239 17:81171201-81171223 GGGCAGGGCTGGAGGCCAGGAGG + Intergenic
1152851624 17:82639874-82639896 GTGTGGGTCGGGAGGGCTGCTGG + Intronic
1152889743 17:82873714-82873736 GTCTGGGTGTGGAGGGCTGGGGG + Intronic
1153350638 18:4077567-4077589 GGGTGGGTCAGGCGGGCAGGAGG - Intronic
1154026370 18:10710734-10710756 GGAAGGGTCTGGTGGCCAGGAGG - Intronic
1157138633 18:45083780-45083802 GTGGGATTCTAGAGGCCAGGAGG - Intergenic
1157570521 18:48709422-48709444 GTGCAGGTAAGGAGGCCAGGAGG + Intronic
1157662856 18:49460607-49460629 GCGTCGGTGCGGAGGCCAGGAGG + Exonic
1157887663 18:51384314-51384336 GAGTGGGTGTGGTGGCCAAGAGG + Intergenic
1157918470 18:51692741-51692763 GTGTGTGTGTGGAGGGGAGGGGG + Intergenic
1158423594 18:57319071-57319093 ATGTAGGTCTGGAGGCCAGAAGG - Intergenic
1158997696 18:62940000-62940022 GGGTTGATCTGGGGGCCAGGGGG + Intronic
1160273235 18:77407300-77407322 GTGTGAGACCGGAGTCCAGGAGG + Intergenic
1160825373 19:1077834-1077856 CTGTGGGTGTGGGAGCCAGGAGG - Intronic
1161107070 19:2449272-2449294 GTGTGGGTCTGTGGCCTAGGAGG + Intronic
1161153934 19:2722658-2722680 GAAGGGGTCTGGAGGCCAGGAGG - Intronic
1161314856 19:3613031-3613053 GGGCGGGGCTGGAGGCCAGGGGG - Intronic
1161761037 19:6173004-6173026 GTGTGGGGTGGGAGGGCAGGTGG + Intronic
1163124720 19:15238722-15238744 CCGTGAGTCTGGAGGCCTGGTGG - Exonic
1163268753 19:16236477-16236499 GTTTAGGTTTGGGGGCCAGGTGG + Intronic
1163360087 19:16840435-16840457 CTGGAGGCCTGGAGGCCAGGAGG - Intronic
1163422608 19:17222651-17222673 GGGTGGATCTAGAGGTCAGGAGG + Intergenic
1163861378 19:19744684-19744706 ATGTGGGGCCGGAGCCCAGGTGG + Intergenic
1164695046 19:30237116-30237138 GTGTGGATCTGGGGGACAGCAGG + Intronic
1165018058 19:32898401-32898423 GTGGGGGGCTGGGGGGCAGGTGG + Intronic
1165250033 19:34523676-34523698 ATGTGGGTCTGGTGCACAGGTGG + Intergenic
1165364998 19:35359892-35359914 CTGTGGAACTGGTGGCCAGGTGG + Exonic
1165366817 19:35372361-35372383 CTGTGGAACTGGTGGCCAGGTGG + Exonic
1165712134 19:38019377-38019399 TAGTGAGTCTGGAGTCCAGGTGG + Intronic
1165756488 19:38296208-38296230 TGCTGGGTCTGGAGGCCAGAGGG - Intronic
1165787931 19:38473542-38473564 GCGGGGGGCTGCAGGCCAGGAGG - Exonic
1165806930 19:38586139-38586161 GTGTGAGTCTCGAAGCCATGCGG - Exonic
1166063665 19:40343580-40343602 GTGTGGGGAAGGAGGCCTGGAGG - Intronic
1166120341 19:40682696-40682718 CTGTGGGGGTGGACGCCAGGGGG - Intronic
1167267917 19:48492795-48492817 GTGTGGGTCTGGAAGGAAAGAGG - Intronic
1167537755 19:50065822-50065844 GGGTAAGTCTGGGGGCCAGGAGG + Intergenic
1168302680 19:55415309-55415331 GTGTGGATGTGGAGGGTAGGAGG - Intergenic
1168362974 19:55758363-55758385 GTGGGAGACTGGAGGTCAGGTGG - Intergenic
1168363929 19:55768363-55768385 GTGGGAGACTGGAGGTCAGGTGG - Intergenic
1168543689 19:57232686-57232708 GTGCGGGTCTGGAGGCTCTGGGG + Intronic
925305080 2:2842546-2842568 GTGTGGCTCTGGTGGGCTGGAGG + Intergenic
925428242 2:3769172-3769194 GTTTGGGACTGCAGACCAGGTGG + Intronic
925601186 2:5610234-5610256 TTGTGGGGCTGGAGGCAGGGAGG + Intergenic
925719960 2:6817504-6817526 GGGAGGGTCTGGAAACCAGGAGG + Intergenic
926830639 2:16958507-16958529 CTGTGGGTCTGGAGCCATGGAGG - Intergenic
928219233 2:29389437-29389459 GTGTGTGTTTGGAGAACAGGTGG + Intronic
928434864 2:31248461-31248483 GTGCAGGACAGGAGGCCAGGAGG - Intronic
929067749 2:37996951-37996973 CTCTGGGTCAGGAGGCCAGTTGG + Intronic
929520817 2:42649073-42649095 GAGTGGTACTAGAGGCCAGGGGG - Intronic
932002125 2:67894570-67894592 GTGTGGGTATTAAGGCTAGGAGG - Intergenic
932685243 2:73863632-73863654 GGGTGGGTCTGGGGGCCAGCTGG + Exonic
933356676 2:81218994-81219016 GTGTGGGGCTGGAGGGGAGGTGG - Intergenic
934550767 2:95260251-95260273 GTGTGTGTTTGGCGCCCAGGAGG - Intergenic
934951125 2:98576422-98576444 CTGTGGGGCTGGTGGTCAGGAGG + Intronic
936732902 2:115405492-115405514 CTGTGGGTCTGGAGTCCAGAGGG + Intronic
937339164 2:121079968-121079990 CTGAGGGTCTGGAGGGTAGGAGG + Intergenic
938379688 2:130829548-130829570 GTGTGGGGCTGGGGGCCCGGTGG - Intergenic
939617421 2:144376949-144376971 GTGCAGGTCTAGTGGCCAGGAGG + Intergenic
940285271 2:152027485-152027507 GTGTGAGTCAGGAGGGGAGGTGG - Intronic
944333939 2:198506417-198506439 GTGGGGGACTGGAGGGGAGGTGG + Intronic
946422559 2:219572695-219572717 GCATGGGTTTGCAGGCCAGGCGG + Intronic
946530576 2:220565805-220565827 GTGTTGGTCTGGAAGCCAAGAGG + Intergenic
946586116 2:221189688-221189710 GTGTGTGTTTGGGGGGCAGGGGG - Intergenic
947670961 2:231935031-231935053 GGCAGGGCCTGGAGGCCAGGCGG + Intergenic
947914562 2:233823000-233823022 GTGTGAGCCTGCTGGCCAGGTGG + Exonic
948051911 2:234984991-234985013 TTGTCTTTCTGGAGGCCAGGAGG + Intronic
948684928 2:239664412-239664434 GTGGGGGTCTGGGGGCCTGGGGG + Intergenic
948831839 2:240602079-240602101 GGGTGGGTCTGTAGGCCCTGTGG + Intronic
949019743 2:241734525-241734547 GGCTGGGCCTGGAGGGCAGGCGG + Intergenic
949054751 2:241921768-241921790 CTCTGGGACAGGAGGCCAGGGGG + Intergenic
949054845 2:241922089-241922111 CTCTGGGACAGGAGGCCAGGGGG + Intergenic
1169141808 20:3230848-3230870 GTGGGGGTGCGGAGGTCAGGTGG + Intronic
1170316289 20:15044470-15044492 GAGTGGGTCTGGAGGGCAAATGG - Intronic
1170454160 20:16517033-16517055 GTGTGGGTGTTGTGGCCAGAGGG - Intronic
1170786030 20:19468458-19468480 GTATGGGTATAGAGACCAGGAGG + Intronic
1171042278 20:21776557-21776579 GTGTGGGTCTGGAAGGCAGAAGG + Intergenic
1171385082 20:24764438-24764460 CTGTGGGCTTGGAGGTCAGGCGG + Intergenic
1172122409 20:32606240-32606262 GTGTGGCTTTGGAGCTCAGGGGG - Intronic
1172766751 20:37355224-37355246 GTGGGGGTGGGGAGGGCAGGAGG - Intronic
1172995141 20:39064834-39064856 GAGGGGGTGGGGAGGCCAGGTGG - Intergenic
1173803513 20:45909889-45909911 GAGTGGGTCAGGAGGGCTGGAGG - Intronic
1173904916 20:46619555-46619577 CTGTGAGTCTGGGGGCCATGGGG - Intronic
1175246336 20:57584455-57584477 GTGTGGGTCTGAGGGTCAGAGGG + Intergenic
1175727032 20:61325552-61325574 GTGGGGGTCTGTGGGGCAGGGGG + Intronic
1175812069 20:61863818-61863840 GGGTGACTTTGGAGGCCAGGTGG - Intronic
1175947513 20:62565714-62565736 AAGGGGGTCTGCAGGCCAGGTGG + Intronic
1176138581 20:63535750-63535772 GGGGGGGGCGGGAGGCCAGGTGG - Intronic
1176145165 20:63562238-63562260 GGGTGGGGCTGGGGGCCAGAGGG + Intronic
1178390299 21:32192483-32192505 GTGTGGCTTTGGTGGCCTGGGGG - Intergenic
1179657703 21:42855383-42855405 TTGTGGGTCTGCCAGCCAGGTGG - Intronic
1180190638 21:46160987-46161009 GGGTGGGCGTGGAGGCCCGGGGG + Intergenic
1180245657 21:46545767-46545789 GTGTGCGCCTGCTGGCCAGGGGG - Intronic
1180762570 22:18221135-18221157 GTGTGGCCCTGGCAGCCAGGTGG + Intergenic
1180773097 22:18403473-18403495 GTGTGGCCCTGGCAGCCAGGTGG - Intergenic
1180804453 22:18653022-18653044 GTGTGGCCCTGGCAGCCAGGTGG - Intergenic
1180806298 22:18716388-18716410 GTGTGGCCCTGGCAGCCAGGTGG + Intergenic
1180871205 22:19148333-19148355 GTGTGGGAGTGGAGCCAAGGTGG + Intergenic
1180878820 22:19189127-19189149 GTGTGGATCATGAGGTCAGGAGG - Intronic
1180975476 22:19845575-19845597 GGGTGGTTCCTGAGGCCAGGAGG + Intronic
1181217244 22:21342169-21342191 GTGTGGCCCTGGCAGCCAGGTGG + Intergenic
1181419092 22:22785607-22785629 GCAGGGGTGTGGAGGCCAGGGGG - Intronic
1181640042 22:24191507-24191529 GTGGGAGGCTGGAGGGCAGGGGG - Intergenic
1182141739 22:27965476-27965498 GGGTGGGTCTGGGGGACAGAAGG - Intergenic
1182803880 22:33054233-33054255 CTGTGAGTCTGGAGTCGAGGAGG - Intronic
1182825344 22:33260190-33260212 GGGTGGGTCAGGAGGCAGGGGGG - Intronic
1183280872 22:36931740-36931762 TTGTGGGTCTGCCGGCCAGGTGG + Intronic
1183352866 22:37343692-37343714 GGGTGGGTCTGGGAGCCAAGGGG - Intergenic
1183647571 22:39135271-39135293 GGGTGCATCTGCAGGCCAGGTGG - Intronic
1184376595 22:44117367-44117389 GTGGGGGTCTGTGGGCCATGGGG + Intronic
1184490195 22:44803962-44803984 AGGTGGGTCTGGTGGCCTGGGGG - Intronic
1184521454 22:44996645-44996667 GTGTGTGTGTGTAGGACAGGTGG - Intronic
1184609077 22:45590925-45590947 GTTTGGGTCGGGGGCCCAGGAGG + Intronic
1185039629 22:48497611-48497633 GGGCGGGGCTGGAGGCCTGGGGG + Intronic
1185039672 22:48497728-48497750 GGGCGGGGCTGGAGGCCTGGGGG + Intronic
1185039715 22:48497845-48497867 GGGCGGGGCTGGAGGCCTGGGGG + Intronic
1203234930 22_KI270731v1_random:144455-144477 GTGTGGCCCTGGCAGCCAGGTGG - Intergenic
949562803 3:5218302-5218324 TTGTGGGGCTGGATGCCAGAAGG + Exonic
950281324 3:11710470-11710492 GTCTAGATGTGGAGGCCAGGGGG + Intronic
950574625 3:13824629-13824651 GCATGGGCCTGGGGGCCAGGAGG - Intronic
950738832 3:15033419-15033441 GTGTGGTTCTGTGGGTCAGGTGG + Intronic
951336845 3:21433876-21433898 GTGTGTGTCTGGAGCTCATGTGG - Intronic
953767082 3:45751741-45751763 GGGTGGCACTGCAGGCCAGGAGG - Intergenic
954370107 3:50165824-50165846 GTCAGGGACTGGAGCCCAGGAGG - Intronic
954462414 3:50634875-50634897 ATGTGGATATGGAGGCCATGGGG + Intronic
954753392 3:52826271-52826293 GTGAGGGTCCTGGGGCCAGGTGG - Intronic
954909635 3:54092935-54092957 GTGTGAGTCAGAAGTCCAGGTGG - Intergenic
955353969 3:58215284-58215306 GATGGGGTCAGGAGGCCAGGAGG - Intergenic
956780426 3:72599071-72599093 GGGTGGGTAAGGAGACCAGGGGG + Intergenic
956857256 3:73287308-73287330 TTGTGGGGCTGGAGGAGAGGAGG + Intergenic
960373878 3:116874640-116874662 ATGAGGGGCTGGAGGGCAGGAGG + Intronic
960528638 3:118738787-118738809 GTTTGGGCCTGGAGGCAATGAGG + Intergenic
960540889 3:118861348-118861370 GTGGTGGACTGGGGGCCAGGTGG - Intergenic
961479983 3:127173415-127173437 GTCTGGGTCTGGGTGGCAGGGGG - Intergenic
961811901 3:129526898-129526920 GTAGGGGGCTGGAGCCCAGGTGG + Intergenic
962089722 3:132230491-132230513 ATGTGGGGGTGGAGGCCGGGAGG - Intronic
962343733 3:134605241-134605263 CTGTGGCCCTGGAAGCCAGGAGG - Intronic
962422449 3:135240423-135240445 GTGTGGGATTGGAGGCAAGAAGG + Intronic
963001799 3:140688331-140688353 AGGTGGGTCTGGAGGCCTGTGGG + Exonic
963407409 3:144884013-144884035 GTGTGAGTCTAGAGGACAGGTGG + Intergenic
963920121 3:150897357-150897379 GTGTGTGTGTGTAGGCCAAGGGG + Intronic
964853263 3:161117975-161117997 GTGGGGGTCTGGGGGGTAGGTGG + Intronic
965080498 3:164025439-164025461 CCGAGGGTCTGGAGGCCGGGAGG + Intergenic
968047262 3:195631348-195631370 GGGTGAGGCTGGTGGCCAGGGGG - Intergenic
968120326 3:196121449-196121471 GTGTAGGTCTGGTGGGTAGGGGG - Intergenic
968307351 3:197658576-197658598 GGGTGAGGCTGGTGGCCAGGGGG + Intergenic
968458301 4:710159-710181 CTGTGGGTTGGGAGACCAGGTGG + Intronic
969317689 4:6391759-6391781 GGGTGGGGCTGGAGGCCTGGAGG + Intronic
969435624 4:7187663-7187685 GTGTGGTTCTTGAAGCCAAGAGG + Intergenic
969491011 4:7499326-7499348 GTGTGATGCTGGAGGCCATGGGG + Intronic
969533525 4:7742036-7742058 CTTTGGGTCTGGGGGACAGGTGG - Exonic
969533586 4:7742252-7742274 GTGTGGGTGGGGTGGCCAGCAGG - Exonic
969622265 4:8284529-8284551 GTGTGGGCATGGAGGCCAGTGGG + Intronic
969622810 4:8287138-8287160 GTTTGGGCGTGGAGGCCAGGGGG + Intronic
969657577 4:8507078-8507100 GCCTGGGCCTGGAGGCCAGCAGG + Intergenic
969716078 4:8868822-8868844 GCGTGGGGCTGGATGCCAGGTGG - Intronic
969741873 4:9034368-9034390 GTGTGAGTTAGGTGGCCAGGTGG + Intergenic
970469462 4:16362237-16362259 TTATGGGTCTGGTGGCCAGTAGG + Intergenic
973893588 4:55391369-55391391 TTTTAGGTCTGGTGGCCAGGTGG + Intergenic
974508606 4:62808072-62808094 GTGTCCCTCTGGAGGCCTGGGGG + Intergenic
977728547 4:100325293-100325315 GTGTGGGTCTGGAAACTAAGAGG - Intergenic
980285720 4:130776519-130776541 TTATGGTTCTGTAGGCCAGGAGG - Intergenic
980861221 4:138501645-138501667 GTGTGTGTCTGGGGGTCAGGTGG - Intergenic
981238417 4:142445010-142445032 GTCAGGGTGTGGAGGCCAAGGGG + Intronic
981362458 4:143863179-143863201 GTGTGTGTCTGGGAGGCAGGAGG + Intergenic
981373184 4:143983941-143983963 GTGTGTGTCTGGGAGACAGGAGG + Intergenic
981382284 4:144087217-144087239 GTGTGTGTCTGGGAGGCAGGAGG + Intergenic
984850621 4:184149476-184149498 GTGTGGGATTGGAAACCAGGTGG + Intronic
984949298 4:184994816-184994838 GAGTGTGTCTGGAGGTCAGGAGG + Intergenic
985309855 4:188585840-188585862 GGCTGGCTCTGGAGGCCTGGAGG - Intergenic
985733935 5:1566383-1566405 GTGTGTGTCTGGAGGCCAGGTGG - Intergenic
986221861 5:5775543-5775565 GTGTGGGCCTGGAGGTAAGAGGG + Intergenic
986298747 5:6461842-6461864 GTGTGTGACTGGAGCCAAGGTGG - Intronic
987366347 5:17152475-17152497 CAGTTGCTCTGGAGGCCAGGCGG - Intronic
988519871 5:31936088-31936110 GTGGGGCTCTGGAGCTCAGGAGG + Intronic
990555053 5:56924694-56924716 GTTTGGGTGTGGAGCCAAGGTGG - Intronic
990788594 5:59451424-59451446 GTATGTGTCTGGAGCTCAGGAGG - Intronic
991373010 5:65939210-65939232 GGGTGGATCACGAGGCCAGGAGG + Intronic
996382728 5:122878271-122878293 GTGTGGTTCTGGAGACCCAGTGG + Intronic
997209412 5:132068676-132068698 GTCTGGGTCAAGATGCCAGGTGG - Intergenic
997361453 5:133297849-133297871 TTGTGGGACAGGATGCCAGGTGG + Intronic
999363511 5:151006216-151006238 GGGTGGGTTTGGAGAGCAGGAGG - Intergenic
1001681125 5:173557622-173557644 GTGTGTGTATGGGGGGCAGGGGG + Intergenic
1001777330 5:174338437-174338459 GTGTGGGTTGGGAGGCCCGCAGG - Intergenic
1001948226 5:175797488-175797510 GTGGGGGTCTGGAGGGAAGACGG - Intronic
1001949370 5:175805620-175805642 GGGTGGGTCTAGTGGTCAGGGGG + Intronic
1002426010 5:179176371-179176393 ATGTGGGTCTGGAGCCCTGCGGG - Intronic
1002566860 5:180117020-180117042 GTTGGGGTATGGAGGCCAAGTGG + Intronic
1002818023 6:696854-696876 GGGTGGATCATGAGGCCAGGAGG + Intergenic
1002968658 6:1992200-1992222 GTGTGAGTCTGGAGCTCAGCGGG - Intronic
1003168679 6:3703312-3703334 TTGTGGATGTGGGGGCCAGGTGG - Intergenic
1003366687 6:5481812-5481834 GAGTGGATCTGGAAGCAAGGGGG - Intronic
1003494550 6:6652725-6652747 GTGTGTGCTGGGAGGCCAGGAGG - Intronic
1004580486 6:16946485-16946507 GTGTGGCTAAGGAGGCAAGGTGG + Intergenic
1004610936 6:17238795-17238817 GTGTTGGCCTTGGGGCCAGGGGG - Intergenic
1004620509 6:17326703-17326725 CTGAGGGCCTGGAGGCCAGGAGG + Intergenic
1005601158 6:27427635-27427657 ATGTGGGTCTTGAGCTCAGGAGG - Intergenic
1005690146 6:28297024-28297046 GTGTGGGTCTGTAGGAAACGTGG - Intronic
1005996925 6:30937137-30937159 GTGGGGGTCTGGGGGGCTGGAGG + Intergenic
1006093495 6:31641982-31642004 TTGTGGGTGGGCAGGCCAGGTGG - Intronic
1006146744 6:31963933-31963955 GTGTGCGGAGGGAGGCCAGGAGG - Exonic
1006347219 6:33492406-33492428 TTGTGGGTCTGGTGGCCACAGGG - Intergenic
1006465965 6:34195165-34195187 GTGTGTGTCTGGGGGCCCAGCGG - Intergenic
1006596018 6:35192863-35192885 GGATGGGACTGGAGGCCAGGAGG - Intergenic
1007463691 6:42036532-42036554 GTGTGCGCCTGTAGACCAGGAGG - Intronic
1007746186 6:44044163-44044185 GAGTGGGACTGGAGGCCTGGAGG - Intergenic
1007909467 6:45499047-45499069 GTGTGGGTATGGAGGAGAGTGGG + Intronic
1008382032 6:50846823-50846845 CTATGGGTGTGGAGGCCAGAAGG - Exonic
1008427905 6:51380678-51380700 GTGTGGGACTGGTGGACAGAAGG + Intergenic
1013317138 6:108953981-108954003 GTGGCTGTCTGCAGGCCAGGAGG - Intronic
1013878216 6:114860617-114860639 GTGGGGGTGTGGAGGGTAGGGGG + Intergenic
1016569027 6:145492177-145492199 GTGTGGGTCTTGGGGCTAGCTGG + Intergenic
1016631093 6:146232659-146232681 TTGGGGGGCTGGAGGGCAGGTGG - Intronic
1016894867 6:149041760-149041782 GTGTGGGAATGGAGGCCTGGAGG - Intronic
1017356379 6:153514174-153514196 GTGGGGGGCTGGAGAGCAGGTGG - Intergenic
1018095702 6:160385544-160385566 TTGAGGGACTGGAGGCCACGGGG - Intronic
1018395865 6:163377692-163377714 GTGTGGGACTTGTGGCCATGTGG - Intergenic
1018767353 6:166944854-166944876 GTGTGGGCCTGGTGGGCAGAGGG - Intronic
1018911017 6:168101061-168101083 GTGTTGGACTGGAGGGGAGGTGG + Intergenic
1019164632 6:170089871-170089893 GTGTGAATCTGGAGCACAGGTGG - Intergenic
1019415392 7:924539-924561 GCGTGGACCTGGAGGGCAGGGGG - Intronic
1019558744 7:1645496-1645518 CTGTGGGCCCGGAGGCCAGCGGG - Intergenic
1019570952 7:1711901-1711923 GTCTCAGTCTGGAGGCCAGGGGG - Intronic
1019645168 7:2125034-2125056 GTGTGGGCCGGGAGCCCAGCAGG - Intronic
1019684491 7:2373406-2373428 GTGTGTGTGTGGTAGCCAGGAGG + Intronic
1019706618 7:2500014-2500036 GGGTGGGTGGGGTGGCCAGGGGG - Intergenic
1019925807 7:4191226-4191248 GGGAGGGCCTGGGGGCCAGGAGG - Intronic
1020968507 7:14903024-14903046 GTGGGAGTCTGGAGGACTGGGGG - Intronic
1021964728 7:25906170-25906192 ACGTGGGCCTGGAGGCTAGGAGG + Intergenic
1022042632 7:26595024-26595046 GGGAGGGTCAGGAGGCAAGGGGG - Intergenic
1023063207 7:36349514-36349536 GTGGGTGTGTGGAGGCAAGGAGG - Intronic
1023874643 7:44280280-44280302 GTGTGGGCCTGGTATCCAGGAGG + Intronic
1023922913 7:44643684-44643706 GTCTGAGTCTGGAGACCAGAAGG - Intronic
1023966288 7:44964728-44964750 GGGTGGGTGTGGATGACAGGAGG - Intronic
1023979865 7:45062845-45062867 GTATCGTTCTGGAGGCTAGGAGG + Intronic
1026018948 7:66693548-66693570 GTGAGGGCCTGGGAGCCAGGAGG - Intronic
1026665220 7:72336014-72336036 GGATGGGTCTGGCGCCCAGGTGG - Intronic
1026841064 7:73670117-73670139 GGCTGGGGCTGGGGGCCAGGAGG + Intronic
1026881449 7:73909128-73909150 GTGGGGGCCTGGGAGCCAGGAGG + Intergenic
1026952075 7:74354195-74354217 ATGAGAGTATGGAGGCCAGGAGG + Intronic
1028985261 7:97004202-97004224 GCGTGGGTCTGGAGACCGGAGGG + Intergenic
1029356064 7:100052640-100052662 GTATGAGTCTGGAGGTCAGCAGG + Intronic
1029423840 7:100484760-100484782 GTGTGTGTCTGGAGGTCTGTGGG + Intronic
1029492669 7:100880798-100880820 ATGTGGGTCTGGAGCACAGGCGG + Intronic
1029577273 7:101411795-101411817 GTGTGGTTCTGGTGGAAAGGAGG + Intronic
1030331866 7:108279625-108279647 GGGTGGGTGGGGAGGGCAGGGGG - Intronic
1032109069 7:129059920-129059942 GTGTGGGACTGAAGCCCAGGGGG + Intergenic
1032310956 7:130786766-130786788 GAGTGGCTCTGGGGTCCAGGTGG + Intergenic
1032495530 7:132359006-132359028 GTCTGGGTCTAGAGCCCAGGTGG - Intronic
1033480581 7:141736341-141736363 GTGGGGGGCTGGAGGGAAGGTGG - Intergenic
1033862558 7:145645260-145645282 GTGTTGGTCTAGAGGCCTAGGGG + Intergenic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1034460783 7:151196852-151196874 GTGTGGGTGTGTAGGCAAAGGGG - Intronic
1034517533 7:151592247-151592269 GTGTGGCTCTTGAGGACAGTGGG + Intronic
1035261733 7:157665980-157666002 GTCAGGGGCTGGGGGCCAGGGGG + Intronic
1035332665 7:158106463-158106485 GTGTGTGTGTGGAGGCAGGGAGG - Intronic
1035438538 7:158877978-158878000 ATGAGGCTGTGGAGGCCAGGAGG + Intronic
1035488647 7:159252802-159252824 GTGTGTGTCTGGAGCCCTGGGGG - Intergenic
1035748228 8:1976808-1976830 GGGTGGCTCAGGAGCCCAGGAGG + Intronic
1035863623 8:3057960-3057982 GCGAGGGTCTGCTGGCCAGGCGG - Intronic
1036247067 8:7126938-7126960 GAGTGAGTTTGGTGGCCAGGTGG + Intergenic
1037833151 8:22200979-22201001 GGGTGGGGCGGGAGGGCAGGCGG - Intronic
1038416575 8:27400796-27400818 GCGTGGGTCTGGAGCTCAGGAGG + Intronic
1038737278 8:30182395-30182417 GTGTGGCTCTGTAGGTCACGTGG + Intronic
1039058676 8:33556461-33556483 GTGTGTGTGTGGTGGGCAGGGGG + Intronic
1039064686 8:33598469-33598491 GTGTGTGTCTTGAGGGGAGGGGG + Intronic
1039407268 8:37324084-37324106 GCATGGGTGTGGAGGCCAAGAGG + Intergenic
1039435356 8:37556171-37556193 GTGTGGGTGTGGAGGGGAAGGGG - Intergenic
1039792409 8:40886373-40886395 GCGTGACTCTGGAGGCCTGGAGG - Intronic
1040475473 8:47773234-47773256 GTTTGGGTGTGGAGGACTGGCGG + Exonic
1040569269 8:48593198-48593220 ATGTGGATCTGGTGTCCAGGGGG + Intergenic
1040982425 8:53257253-53257275 AAGTGGGTCTGGAGGACAAGTGG + Intergenic
1042111492 8:65386001-65386023 GTTGGGGTGTGGAGGCCTGGGGG + Intergenic
1042428031 8:68672156-68672178 GTCTGGTTATGGAGGCAAGGGGG + Intronic
1044820469 8:96152824-96152846 GCCTGGGTCTGGAGGCCTGAGGG - Intronic
1045510386 8:102808404-102808426 AGTTGGGTCTGAAGGCCAGGAGG - Intergenic
1046819857 8:118622402-118622424 TGGTGGTTCAGGAGGCCAGGGGG - Intergenic
1048286719 8:133147371-133147393 GCCTGGGCCTGGAGGCCTGGGGG - Intergenic
1048681074 8:136842620-136842642 GTGTAGGTCTGGAGTCCTGGGGG - Intergenic
1048713244 8:137235371-137235393 GGGTGGGGCTGGAGGCAAAGGGG - Intergenic
1048846791 8:138609865-138609887 GAGTGGCTCTGCAGCCCAGGAGG - Intronic
1048927097 8:139281051-139281073 GTGTGGGTCTGGATTCAGGGTGG + Intergenic
1048999790 8:139817537-139817559 CTGTGGGGCAGGAGACCAGGAGG - Intronic
1049255492 8:141611569-141611591 GAGTGGGCTTGGAGGTCAGGAGG - Intergenic
1049356901 8:142193460-142193482 GTCTGGAGCCGGAGGCCAGGTGG - Intergenic
1049369104 8:142255014-142255036 TTGAGGATCTTGAGGCCAGGTGG + Intronic
1049380817 8:142314960-142314982 GTGGGGGTCTGCAGGCCAGGTGG - Intronic
1049456093 8:142690103-142690125 GTGTGTGTGTGGAGGGGAGGCGG + Intergenic
1049491227 8:142904159-142904181 GTGTCAGTCTGGAGGCCTGGGGG - Intronic
1049687770 8:143945821-143945843 GTGTGGGGCTGGAGAGCAGGAGG - Intronic
1049752015 8:144289409-144289431 GTGTGGTCCTGGAGGCCACATGG - Intronic
1050970142 9:11860209-11860231 GTGTGGAACTGGATCCCAGGAGG + Intergenic
1051911294 9:22155406-22155428 GTGTGGCCCTGGAGACCACGAGG + Intergenic
1052840751 9:33289474-33289496 GTGTGGGTCTGGGGGGTGGGGGG + Intergenic
1053473387 9:38363466-38363488 GGGTGGGTCTGTGAGCCAGGAGG + Intergenic
1054758363 9:68981476-68981498 GTGGGGGTGGGGAGGGCAGGAGG + Intronic
1055294646 9:74821685-74821707 GTTTGTGTGTGAAGGCCAGGAGG + Exonic
1057317576 9:93979608-93979630 GAGTGAGTATGGGGGCCAGGAGG - Intergenic
1057421417 9:94916014-94916036 GTGGCGGTGTGGAGGCCTGGAGG - Intronic
1057851480 9:98570131-98570153 GTGAGGGAGTGGAGGCAAGGAGG - Intronic
1058576858 9:106413030-106413052 GTGTGGGGCTGAAGCCCAGTCGG - Intergenic
1058719541 9:107751160-107751182 GTGTGTGTGTGGAGGCGGGGGGG + Intergenic
1059436558 9:114280593-114280615 GTATGTGGCTGGAGGCCACGGGG + Intronic
1060385955 9:123228457-123228479 GTGTGGGGTTGGGGGACAGGGGG + Intronic
1060697755 9:125723865-125723887 GTGTGACTTTGGAGGGCAGGGGG - Intergenic
1061003428 9:127915446-127915468 ATCTGGGTCAGCAGGCCAGGTGG + Intronic
1061395981 9:130343519-130343541 GGGAGGGTCGGGGGGCCAGGTGG - Intronic
1061413754 9:130434481-130434503 GGGAGGATCGGGAGGCCAGGAGG - Intergenic
1061588986 9:131585951-131585973 GGGTGGATCACGAGGCCAGGAGG + Intronic
1062208161 9:135348578-135348600 GGGAGGGCCTGGACGCCAGGTGG + Intergenic
1062231831 9:135486212-135486234 GTCTGGCTGTTGAGGCCAGGCGG - Exonic
1062271753 9:135713040-135713062 GACTGGGCCTTGAGGCCAGGAGG + Intronic
1062341075 9:136094298-136094320 CTGTGGGTCTGAAGGCCGCGAGG - Intronic
1062607074 9:137353198-137353220 GTGGAGGCTTGGAGGCCAGGAGG - Intronic
1062607089 9:137353252-137353274 GTGGAGGCTTGGAGGCCAGGAGG - Intronic
1187884710 X:23878758-23878780 GTGGGGGTCTGGGGGAAAGGTGG - Intronic
1188747376 X:33862751-33862773 GGGTGGGTGTGGAGGGGAGGTGG - Intergenic
1188963041 X:36516933-36516955 TTGTGGGACTGGAGGGGAGGTGG + Intergenic
1189379053 X:40488836-40488858 GTGTGGGCCTAGAGGACTGGGGG - Intergenic
1190567977 X:51750574-51750596 GTGAGGGTTTGAAGGTCAGGAGG + Intergenic
1191846233 X:65550083-65550105 GTGTAGATCTGGAGGCCAGGTGG + Intergenic
1192224528 X:69219231-69219253 CTGTGGGAAAGGAGGCCAGGAGG - Intergenic
1192326796 X:70139496-70139518 GTATGGGTCTGAAGGTCAGGAGG - Intronic
1192347215 X:70320675-70320697 GTGTGGGAGTGGAGGCCGAGGGG + Intronic
1192763159 X:74118035-74118057 GTGTCAGTCTGGAGGCCTGGGGG - Intergenic
1193425739 X:81338435-81338457 GTGTTGATCTGGAGGCCTGGGGG + Intergenic
1194388976 X:93292812-93292834 GCCTGGGGCTGGAGGACAGGTGG - Intergenic
1195766123 X:108298440-108298462 GAGAGGGCCCGGAGGCCAGGCGG - Intronic
1197770330 X:130085326-130085348 GTGTGTATTTGCAGGCCAGGAGG - Intronic
1199816573 X:151402869-151402891 GTCTGGTGCTGGAGGACAGGAGG + Intronic
1200051263 X:153433096-153433118 CTGTGTGGCTGGAGGCCAGTGGG + Intergenic
1201339468 Y:12917786-12917808 GTGTGGATCATGAGGTCAGGAGG - Intronic