ID: 1083861140

View in Genome Browser
Species Human (GRCh38)
Location 11:65420850-65420872
Sequence TCGCTTTTGAAGGCCATGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083861140_1083861148 29 Left 1083861140 11:65420850-65420872 CCCACCATGGCCTTCAAAAGCGA No data
Right 1083861148 11:65420902-65420924 ATCTACCATAGTTTGTTTCTGGG No data
1083861140_1083861147 28 Left 1083861140 11:65420850-65420872 CCCACCATGGCCTTCAAAAGCGA No data
Right 1083861147 11:65420901-65420923 AATCTACCATAGTTTGTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083861140 Original CRISPR TCGCTTTTGAAGGCCATGGT GGG (reversed) Intergenic
No off target data available for this crispr