ID: 1083863282

View in Genome Browser
Species Human (GRCh38)
Location 11:65438028-65438050
Sequence GGGTACACAGAACTTCCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 143}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083863282_1083863285 -8 Left 1083863282 11:65438028-65438050 CCACTGGGAAGTTCTGTGTACCC 0: 1
1: 0
2: 2
3: 19
4: 143
Right 1083863285 11:65438043-65438065 GTGTACCCGGAATGTCGGAGTGG 0: 1
1: 0
2: 0
3: 0
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083863282 Original CRISPR GGGTACACAGAACTTCCCAG TGG (reversed) Intergenic
900305026 1:2001646-2001668 AGGAAAAAAGAACTTCCCAGTGG + Intronic
900726683 1:4220930-4220952 GGCTTCACAGAACTTCAAAGTGG + Intergenic
903350612 1:22714192-22714214 GGGTCCAACGTACTTCCCAGAGG + Intronic
905034559 1:34909128-34909150 AGCCTCACAGAACTTCCCAGGGG + Intronic
908087377 1:60650588-60650610 ACGTGCACAGAGCTTCCCAGAGG + Intergenic
908103456 1:60814740-60814762 TGGTACACAGAGGTTCCCAGGGG + Intergenic
913963340 1:143355290-143355312 GGGATCACAGAGCTCCCCAGTGG - Intergenic
913972200 1:143423825-143423847 GGGAAGACAGAACTCCTCAGCGG + Intergenic
914057696 1:144180876-144180898 GGGATCACAGAGCTCCCCAGTGG - Intergenic
914066581 1:144249438-144249460 GGGAAGACAGAACTCCTCAGCGG + Intergenic
914112572 1:144716916-144716938 GGGAAGACAGAACTCCTCAGCGG - Intergenic
914121450 1:144785490-144785512 GGGATCACAGAGCTCCCCAGTGG + Intergenic
917194207 1:172449008-172449030 GGGTAGTCAGAACCTCCCTGAGG + Intronic
917420393 1:174857106-174857128 GGGCAGACAGAACTTCCCTGGGG - Intronic
917976780 1:180244980-180245002 GGGCACACAGCACTGCCCTGTGG + Intronic
921050232 1:211505896-211505918 TTGTCCACAGAACTGCCCAGTGG + Intergenic
922604224 1:226879308-226879330 TGGTTCCCAGAACTTCCCTGTGG + Intronic
1064335780 10:14440070-14440092 GTGTACACAGAGTGTCCCAGTGG - Intronic
1067453676 10:46398010-46398032 GGGTACCCAGGTTTTCCCAGGGG - Intergenic
1067580653 10:47443514-47443536 GGGCACAGAGACCTTCCCAGTGG - Intergenic
1067583552 10:47461736-47461758 GGGTACCCAGGTTTTCCCAGGGG + Intronic
1067633555 10:47987084-47987106 GGGTACCCAGGTTTTCCCAGGGG + Intergenic
1069196257 10:65555073-65555095 GGGTACACTGAACATGCCTGGGG + Intergenic
1070335086 10:75448095-75448117 GGGGCCACAGGACTTCCCTGAGG + Intronic
1075596374 10:123732586-123732608 CGGTCCCCAGAACTTCCCATGGG - Intronic
1077307664 11:1875208-1875230 GGGAAGACAGAACTCCTCAGCGG - Intronic
1077535832 11:3123603-3123625 GGGTGCTCAGCACTTTCCAGCGG + Intronic
1078175892 11:8970206-8970228 GTGTACACAGAACTTTCTATTGG - Intergenic
1078428791 11:11271536-11271558 AGGTAGACAGAACTACCTAGGGG - Intronic
1079364726 11:19799421-19799443 GAGTAGACAGAACTACCCAGTGG + Intronic
1080560573 11:33458848-33458870 CTCTACACAGAGCTTCCCAGGGG - Intergenic
1080839398 11:35970328-35970350 GGGTACACAGACACTCACAGAGG + Intronic
1080897157 11:36456253-36456275 AGGTACACACAACCTCCCCGGGG - Intronic
1083863282 11:65438028-65438050 GGGTACACAGAACTTCCCAGTGG - Intergenic
1084944252 11:72630428-72630450 GGGTAGAGAGGACTTCCCAGAGG + Intronic
1085732750 11:79013339-79013361 GGGCACACAGAGCTTCCCAGAGG - Intronic
1086504722 11:87493421-87493443 GGCTACACAGAAGTTCCTATAGG + Intergenic
1088856207 11:113756615-113756637 TGGTACTCAGAACTGCCCAGGGG + Intronic
1088956633 11:114619588-114619610 GGGTAACCAGTGCTTCCCAGTGG + Intergenic
1092167736 12:6353391-6353413 GGGTACACAACACTTCCCTGGGG - Intronic
1092997329 12:13962767-13962789 GTCCAGACAGAACTTCCCAGGGG + Intronic
1094500865 12:31019878-31019900 GAGCACACAGAAAATCCCAGTGG - Intergenic
1096893485 12:54795857-54795879 TGTAACACAGAAGTTCCCAGCGG - Intergenic
1096961265 12:55580319-55580341 GGGTAAACAAAATTTGCCAGGGG - Intergenic
1098321997 12:69255331-69255353 GGGTACACAAATATTCACAGGGG - Intronic
1098522704 12:71451553-71451575 GGTTACAGAAAGCTTCCCAGAGG - Intronic
1101397265 12:104359411-104359433 GGATACACAGAATTTCTCTGGGG - Intergenic
1102462672 12:113109734-113109756 GGGTACCTAGAACTGCCCAGAGG + Intronic
1102606796 12:114073950-114073972 AGGTAGCCACAACTTCCCAGGGG + Intergenic
1102823110 12:115924789-115924811 GGGTACACTGAACATCCCAGGGG - Intergenic
1103851878 12:123938651-123938673 GTCTAGAAAGAACTTCCCAGGGG - Intronic
1105431364 13:20340336-20340358 GGGCACACACCACCTCCCAGGGG - Intergenic
1107128268 13:36868166-36868188 GTGTACACAAAAATTGCCAGTGG + Intronic
1110646486 13:77891580-77891602 ACGTACATAGAATTTCCCAGTGG - Intergenic
1113701462 13:112392052-112392074 GAGTGCACAGAGCTTTCCAGTGG - Intronic
1114159142 14:20143738-20143760 GGAAACACAGAACCTCACAGTGG + Exonic
1114389348 14:22290102-22290124 GGGAATACAGAAGTCCCCAGGGG - Intergenic
1119378654 14:74214745-74214767 GGGTTCACAGAACTCACAAGTGG - Intergenic
1120835355 14:89034216-89034238 GGGTACACAGGCTTCCCCAGGGG + Intergenic
1122846388 14:104502012-104502034 GGGGACACAGAAATTCCAAGTGG - Intronic
1123582729 15:21731015-21731037 GGGTACTCAGAACTGCCAGGGGG - Intergenic
1123582913 15:21731759-21731781 GGGTGCACAGAACTGCCAGGAGG - Intergenic
1123619379 15:22173611-22173633 GGGTACTCAGAACTGCCAGGGGG - Intergenic
1123619563 15:22174355-22174377 GGGTGCACAGAACTGCCAGGAGG - Intergenic
1125294247 15:38185102-38185124 GGACACACAGAACTTCTCTGAGG + Intergenic
1127884251 15:63185487-63185509 GGGTACACACTGATTCCCAGAGG + Intergenic
1128997778 15:72309515-72309537 GGGTACAAGGAAGTCCCCAGGGG + Intronic
1129654758 15:77516721-77516743 ACTTAAACAGAACTTCCCAGGGG + Intergenic
1129711207 15:77820976-77820998 GGGTGCACTTTACTTCCCAGGGG - Intergenic
1129814304 15:78538610-78538632 GGGGACACAGAACCTCTCAGTGG + Intergenic
1133526970 16:6615218-6615240 TTATACAGAGAACTTCCCAGTGG + Intronic
1135864685 16:26090496-26090518 GGGTGCACAAAATTTCCCATGGG + Intronic
1136020992 16:27439913-27439935 GGGTACTGAGAACTGCCCCGTGG - Intronic
1139841856 16:69888196-69888218 GGGTACACAGCAGCTCCCAGCGG + Exonic
1142276420 16:89121174-89121196 GGGCACACAGCTCCTCCCAGGGG + Intronic
1142671409 17:1488999-1489021 GGGCACACAGATCTTGCCATGGG + Intronic
1142672445 17:1493362-1493384 GGGGAAACAGACCTTTCCAGAGG + Intergenic
1142765575 17:2062323-2062345 GGATACACAGGTCTTCCCTGGGG - Intronic
1143126794 17:4646957-4646979 GGGTACACATAAGTGACCAGTGG - Intergenic
1144727777 17:17510535-17510557 GGGAAGAAAGAACTTTCCAGTGG - Intronic
1146292006 17:31614632-31614654 GCGAACACAGATATTCCCAGAGG + Intergenic
1147581682 17:41630766-41630788 GGCTCCCCAGAAGTTCCCAGGGG - Intergenic
1148367750 17:47069387-47069409 CACCACACAGAACTTCCCAGAGG - Intergenic
1148851023 17:50555404-50555426 GGGAAGAGGGAACTTCCCAGTGG + Intronic
1150716843 17:67579374-67579396 GAGTTCATGGAACTTCCCAGAGG + Intronic
1154002455 18:10494083-10494105 GGGTACACACTTCTGCCCAGAGG - Intergenic
1155177751 18:23315668-23315690 GGGTAGAGAGAATGTCCCAGTGG - Intronic
1158897310 18:61927248-61927270 GGCTTCTCAGCACTTCCCAGTGG - Intergenic
1161561051 19:4972613-4972635 GGGTTGACAGTGCTTCCCAGGGG - Intronic
1164424975 19:28133159-28133181 GGGTACCCTGAATTACCCAGGGG + Intergenic
1164490457 19:28707650-28707672 TTCTACACAGAGCTTCCCAGAGG - Intergenic
1164601880 19:29567857-29567879 GGGGACAGAGAACTTCCAGGTGG + Intergenic
1167305949 19:48709513-48709535 GGGTGCACAGAACTGGCAAGAGG - Intergenic
1202697179 1_KI270712v1_random:133549-133571 GGGATCACAGAGCTCCCCAGTGG - Intergenic
927716991 2:25359522-25359544 GTCCACACAGAATTTCCCAGGGG + Intergenic
931821432 2:65956074-65956096 GGGTTCACAGAGCTACCCAGTGG - Intergenic
933586929 2:84189167-84189189 AGGTACACAGAATTTCCCCTAGG - Intergenic
933749633 2:85595043-85595065 GGCTACACATGAATTCCCAGAGG - Intergenic
934176894 2:89584762-89584784 GGGAAGACAGAACTCCTCAGCGG + Intergenic
934278346 2:91590565-91590587 GGGATCACAGAGCTCCCCAGTGG - Intergenic
934287201 2:91659122-91659144 GGGAAGACAGAACTCCTCAGCGG + Intergenic
939846704 2:147255300-147255322 GGGTACCTAGAAATCCCCAGGGG - Intergenic
940436385 2:153660951-153660973 GTGTACACAGTACTTCACAGAGG + Intergenic
940448144 2:153803117-153803139 GGGAACACTGAGCTTACCAGTGG - Intergenic
944503672 2:200387956-200387978 GGGAACACAGATCTTCTCAGAGG + Intronic
947487905 2:230569363-230569385 GGGTTCACAGGACTTCCCTCAGG + Intergenic
947888917 2:233598461-233598483 GGGTCCAGAGGACTTCCCATGGG + Intergenic
1171416990 20:24988783-24988805 GTGACCACAGAACTTTCCAGTGG - Intronic
1173361331 20:42347012-42347034 AGGAACTCAGAACTTCCCAGGGG + Intronic
1174052857 20:47779371-47779393 GGGCCCACAGGACTTCCTAGTGG - Intronic
1174105119 20:48156399-48156421 GGGGTCACATAACTGCCCAGTGG + Intergenic
1175391816 20:58632267-58632289 GGGTACCCAGGACTTCCCGCAGG - Intergenic
1178106390 21:29323927-29323949 GGATACACAAACCTTCGCAGGGG - Intronic
1180877401 22:19181036-19181058 GGGCCCCCAGAGCTTCCCAGTGG + Intronic
1182787125 22:32917421-32917443 GGGTACCCAGTACTTCTCAGTGG - Intronic
949926655 3:9047348-9047370 GGGAACGCAGCACCTCCCAGAGG + Intronic
950516150 3:13466763-13466785 GGGACCACCGAAGTTCCCAGGGG + Intergenic
951428170 3:22573952-22573974 TGGTACACAGAACTTTCCATGGG - Intergenic
952644808 3:35642273-35642295 GACTGCACAGAACTCCCCAGTGG - Intronic
956766984 3:72492261-72492283 GGGGACACCAAATTTCCCAGGGG + Intergenic
959066677 3:101664000-101664022 CTGTACACAGTACTCCCCAGTGG + Intronic
959698760 3:109278194-109278216 CAGTACACAGCATTTCCCAGAGG + Intergenic
960159376 3:114333469-114333491 GGCTAGACATAACTTCCCACTGG - Intergenic
963202940 3:142602786-142602808 GGGAACACAGAACCACTCAGGGG - Intronic
963745547 3:149120857-149120879 GCCTACTCAGAACATCCCAGTGG - Intergenic
967268490 3:187713345-187713367 GGGTACACAAATGTTACCAGTGG + Intronic
967702632 3:192611249-192611271 GGATACTCTGATCTTCCCAGAGG - Intronic
967993570 3:195150097-195150119 AGGTTCACAGAACTTATCAGTGG + Intronic
969032408 4:4225776-4225798 GGGATCACAGAGCTCCCCAGTGG + Intronic
972411503 4:38800131-38800153 GGTTACCCAGATCTTCCCATAGG - Intronic
981652744 4:147077795-147077817 GGGTTCAGAGAACTTCCAGGTGG + Intergenic
982652891 4:158109095-158109117 GGGTCAACAAAGCTTCCCAGAGG - Intergenic
983484512 4:168318157-168318179 GGGTGCACAGAAATTACCTGGGG + Intronic
986396509 5:7336055-7336077 GTGGACACAGAACTTCCCCAAGG + Intergenic
986414312 5:7512776-7512798 GGCTTCACAGAACTTCACATGGG - Intronic
987937772 5:24489885-24489907 GTGTATACAGAGATTCCCAGTGG - Intronic
990285994 5:54301078-54301100 GGCCAAAGAGAACTTCCCAGAGG - Intronic
990552335 5:56896212-56896234 GGGTATACAGAAGTTCTCTGTGG - Intergenic
992640686 5:78766212-78766234 GGGTAAACAAAACTTGCCTGAGG + Intronic
992911693 5:81401408-81401430 GGGCACCCAGCACCTCCCAGGGG - Intergenic
999147468 5:149405778-149405800 GGGGACACAGAGCCTGCCAGGGG + Intergenic
1005143841 6:22664823-22664845 GCCTACCCAGTACTTCCCAGGGG - Intergenic
1007491592 6:42227348-42227370 GGTTTCACAGTACTTCCAAGTGG + Exonic
1009667932 6:66706921-66706943 GGCTACACACACTTTCCCAGAGG + Intergenic
1009991567 6:70848869-70848891 TGGTAAACACAAGTTCCCAGTGG - Intronic
1011394030 6:86887347-86887369 GGAGGCACAGAACTTCACAGAGG + Intergenic
1013024524 6:106257608-106257630 GAGTTCACAGAACTACCAAGAGG - Intronic
1014755746 6:125300618-125300640 GGGTATACAGAAATGTCCAGAGG - Exonic
1017946773 6:159102402-159102424 GGGTACCCAGGTCTTCCCAGGGG - Intergenic
1018742885 6:166744082-166744104 TGGGAGACAGAACTTCCTAGGGG - Intronic
1027431178 7:78114379-78114401 GTGGGCACAGAATTTCCCAGTGG - Intronic
1028593171 7:92520201-92520223 GAGTACCCAGCACTTCCCTGTGG - Intronic
1034537750 7:151736313-151736335 GCGCAAACAGAACTTCGCAGGGG + Intronic
1043308353 8:78825390-78825412 TGTTACACAGAACATCCCTGAGG - Intergenic
1044318473 8:90776149-90776171 GGGCCCACAGACCTACCCAGTGG - Intronic
1046215566 8:111141289-111141311 GGTGACACAGCACTCCCCAGCGG + Intergenic
1048369473 8:133765073-133765095 GGGTATAAGGAACTTCCTAGGGG + Intergenic
1049014567 8:139910529-139910551 GGTAACACAGGTCTTCCCAGAGG - Intronic
1050890399 9:10818291-10818313 TGGTATAAAGAACTTCCCTGAGG + Intergenic
1055907348 9:81309891-81309913 AGGTACAGAGAACTTCCCCTTGG - Intergenic
1057978401 9:99631700-99631722 GAGTACTCAGAAATTCCCAGGGG - Intergenic
1061495926 9:130974145-130974167 AGGCACACAGAACTCCCCGGGGG + Intergenic
1189021483 X:37346430-37346452 TGGGCCACAGAACTTCCCTGGGG - Intergenic
1193213257 X:78833621-78833643 AGTTACTGAGAACTTCCCAGTGG - Intergenic
1199714319 X:150495531-150495553 GGCAACACAGAACATCCCTGTGG + Intronic