ID: 1083865145

View in Genome Browser
Species Human (GRCh38)
Location 11:65449582-65449604
Sequence TGTGTACTTTGGGAGCATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083865145_1083865148 -8 Left 1083865145 11:65449582-65449604 CCTCAATGCTCCCAAAGTACACA No data
Right 1083865148 11:65449597-65449619 AGTACACATGTCTCTTCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083865145 Original CRISPR TGTGTACTTTGGGAGCATTG AGG (reversed) Intergenic
No off target data available for this crispr