ID: 1083865148

View in Genome Browser
Species Human (GRCh38)
Location 11:65449597-65449619
Sequence AGTACACATGTCTCTTCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083865143_1083865148 0 Left 1083865143 11:65449574-65449596 CCAATCCACCTCAATGCTCCCAA No data
Right 1083865148 11:65449597-65449619 AGTACACATGTCTCTTCTCAAGG No data
1083865144_1083865148 -5 Left 1083865144 11:65449579-65449601 CCACCTCAATGCTCCCAAAGTAC No data
Right 1083865148 11:65449597-65449619 AGTACACATGTCTCTTCTCAAGG No data
1083865145_1083865148 -8 Left 1083865145 11:65449582-65449604 CCTCAATGCTCCCAAAGTACACA No data
Right 1083865148 11:65449597-65449619 AGTACACATGTCTCTTCTCAAGG No data
1083865142_1083865148 9 Left 1083865142 11:65449565-65449587 CCTAGCTGGCCAATCCACCTCAA No data
Right 1083865148 11:65449597-65449619 AGTACACATGTCTCTTCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083865148 Original CRISPR AGTACACATGTCTCTTCTCA AGG Intergenic
No off target data available for this crispr