ID: 1083869372

View in Genome Browser
Species Human (GRCh38)
Location 11:65477501-65477523
Sequence TGCCTCCCCTGCCCCCGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083869372_1083869376 6 Left 1083869372 11:65477501-65477523 CCGGCGCGGGGGCAGGGGAGGCA No data
Right 1083869376 11:65477530-65477552 GACTCCCAGCGGCCCCTGCGCGG No data
1083869372_1083869375 -5 Left 1083869372 11:65477501-65477523 CCGGCGCGGGGGCAGGGGAGGCA No data
Right 1083869375 11:65477519-65477541 AGGCAGCGCGGGACTCCCAGCGG No data
1083869372_1083869377 7 Left 1083869372 11:65477501-65477523 CCGGCGCGGGGGCAGGGGAGGCA No data
Right 1083869377 11:65477531-65477553 ACTCCCAGCGGCCCCTGCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083869372 Original CRISPR TGCCTCCCCTGCCCCCGCGC CGG (reversed) Intergenic