ID: 1083872364

View in Genome Browser
Species Human (GRCh38)
Location 11:65497010-65497032
Sequence CTCCCTCACCCCCGGGTCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083872364_1083872377 30 Left 1083872364 11:65497010-65497032 CCAAAGACCCGGGGGTGAGGGAG No data
Right 1083872377 11:65497063-65497085 GCTCCAAGCTTTGTGTGCCCTGG No data
1083872364_1083872371 -10 Left 1083872364 11:65497010-65497032 CCAAAGACCCGGGGGTGAGGGAG No data
Right 1083872371 11:65497023-65497045 GGTGAGGGAGCGGAGAGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083872364 Original CRISPR CTCCCTCACCCCCGGGTCTT TGG (reversed) Intergenic
No off target data available for this crispr