ID: 1083876908

View in Genome Browser
Species Human (GRCh38)
Location 11:65529079-65529101
Sequence CCGTGTGTGGGGAAGACAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 190}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083876908 Original CRISPR CCGTGTGTGGGGAAGACAGC GGG Intronic
902078959 1:13808082-13808104 GCCTGTGTGGGGCACACAGCAGG + Intronic
902121428 1:14169345-14169367 CTGGATGTGGGAAAGACAGCTGG - Intergenic
903502173 1:23806864-23806886 TGGTGGGTGGGGAAGACAGATGG - Intronic
905468645 1:38175365-38175387 CAGTGTGTGAGGAAGAAAACAGG - Intergenic
905546896 1:38807354-38807376 CCTTGTAGGTGGAAGACAGCAGG - Intergenic
907222190 1:52915087-52915109 CAGGGTGTGGGGAAGAGAGATGG + Intronic
907456689 1:54580897-54580919 TCATGTTGGGGGAAGACAGCGGG + Intronic
907474819 1:54698648-54698670 CCGTGGGTGGGGAGGCCAGTGGG + Intronic
910111807 1:83691477-83691499 GCCGGTGTGGGGAAGGCAGCAGG + Intergenic
915243707 1:154541725-154541747 CCCTGTCTGGGGAAGGCTGCTGG + Intronic
915323796 1:155070333-155070355 CGGGGTGTGGGGGAGACGGCGGG + Intergenic
916039742 1:160951801-160951823 CCATGTTTGGGGAAGACCACAGG - Intronic
916479491 1:165202231-165202253 GAGTTGGTGGGGAAGACAGCGGG - Exonic
918321576 1:183370064-183370086 CCGTGTGTTGGGAATGCAGGAGG - Intronic
919791333 1:201292690-201292712 CTGTCTGTGGGGAAGAGAGTTGG - Intronic
1062971343 10:1651587-1651609 CTGTATGTGGGAAAGACAGCTGG - Intronic
1068016923 10:51528667-51528689 CGGGGTGGGGGGAAGACAGGGGG + Intronic
1072044823 10:91644127-91644149 CTGTGGGTTGTGAAGACAGCGGG - Intergenic
1072447151 10:95509118-95509140 CAGTGTGTGGGGGACCCAGCTGG - Intronic
1074157299 10:110810248-110810270 CCTTGTGTGGGGAAGACAAAAGG - Intronic
1074298408 10:112211676-112211698 CTGTGTGTGAGGCACACAGCGGG - Intronic
1074907370 10:117876970-117876992 CAGTGGGTGGAGAAGATAGCTGG - Intergenic
1075404213 10:122183754-122183776 CCGTGAGTGGGGAGGGCAGTTGG + Intronic
1076731264 10:132440337-132440359 CCGTGTGCTGGGAAGACAGTGGG - Intergenic
1076731282 10:132440404-132440426 CCGTGTGCTGGGAAGACAGTGGG - Intergenic
1076731300 10:132440471-132440493 CCGTGTGCTGGGAAGACAGTGGG - Intergenic
1076731353 10:132440637-132440659 CCGTGTGCTGGGAAGACAGTGGG - Intergenic
1077325990 11:1964337-1964359 CCGTGTGTGGGGTTGACAGCAGG + Intronic
1082770885 11:57206666-57206688 CCGTGTCTGGAGACGACATCGGG - Intergenic
1083366917 11:62146935-62146957 CCATGTGTGTGGAAGAGAGACGG + Intronic
1083758127 11:64802184-64802206 CCGTGTGTGGGAAAAGCAGCAGG + Intronic
1083876908 11:65529079-65529101 CCGTGTGTGGGGAAGACAGCGGG + Intronic
1084275260 11:68047994-68048016 CCGTGGGTGGTGAAGGCAGCTGG + Intronic
1085281880 11:75336331-75336353 CAGGGTGTGGGGAGGACATCAGG - Intronic
1085715004 11:78864693-78864715 CCATGTGTGGGGAATTCAGATGG - Intronic
1086820998 11:91436030-91436052 CAGGGTCTGGGGAATACAGCGGG - Intergenic
1089465022 11:118679514-118679536 AGGGGTGTGGGGAAGGCAGCAGG - Intronic
1089588516 11:119525000-119525022 CAGTGTGGAGGGAAGGCAGCTGG - Intergenic
1089602361 11:119623770-119623792 GGGAGAGTGGGGAAGACAGCTGG + Intronic
1089704615 11:120268932-120268954 GAGTCTGTGGGGAGGACAGCTGG - Intronic
1089935566 11:122360519-122360541 CTGTGTGTGAGGAAGAAATCAGG - Intergenic
1090803554 11:130189003-130189025 CAGTGTGTGGGGCAGGAAGCGGG + Intronic
1090934844 11:131332441-131332463 CAATGTGCTGGGAAGACAGCTGG + Intergenic
1091057389 11:132431517-132431539 CTCTGTGTGGGGAAGGCAACCGG + Intronic
1202808970 11_KI270721v1_random:19516-19538 CCGTGTGTGGGGTTGACAGCAGG + Intergenic
1092070945 12:5630964-5630986 CCATGTCAGGGGAAGACAGCTGG - Intronic
1092938047 12:13382273-13382295 CTAGATGTGGGGAAGACAGCAGG - Intronic
1092997557 12:13964219-13964241 CCGTGTCTGGGCCAGATAGCTGG + Intronic
1097892852 12:64795290-64795312 CCGAGTGGGGTGAAGAGAGCTGG + Intronic
1104170545 12:126276097-126276119 CTGTATCTGGGGAAGACTGCAGG + Intergenic
1104609323 12:130215528-130215550 AGGTGTGTGGGGCAGACAGAGGG - Intergenic
1106411884 13:29516355-29516377 GCGAGTGTGGGGAAGAGAGAGGG + Intronic
1110394201 13:75011118-75011140 CTGTGTGGGGGGCACACAGCGGG - Intergenic
1111909820 13:94298540-94298562 CCGTGGGTGCTGGAGACAGCTGG - Intronic
1115784142 14:36805329-36805351 CAGTCTGTGGTGATGACAGCAGG + Intronic
1117980075 14:61334143-61334165 CAGTGTGTGGTGGAGGCAGCAGG + Intronic
1118619480 14:67601323-67601345 TGGTGTGTGGGGAAAACAGTTGG + Intergenic
1120049518 14:79849040-79849062 CTGGGTGTGGGGAAGAGAGTTGG - Intronic
1122558436 14:102593439-102593461 CCGTCCGTGGGGAGAACAGCAGG + Intronic
1124552025 15:30690345-30690367 CTGTGTGTGGGGCACACAGAAGG + Intronic
1124679218 15:31715327-31715349 CTGTGTGTGGGGCACACAGAAGG - Intronic
1125713324 15:41804592-41804614 GGGTGTGTGAGGAAGAAAGCGGG - Intronic
1128146659 15:65335784-65335806 CCACGTGTGGGAAAGACAGAGGG - Intronic
1130656087 15:85793134-85793156 CCGTGTGGGCAGAAGAGAGCAGG - Intronic
1131386144 15:92009525-92009547 TCGTGTGTCAGGAAGACAGCAGG + Intronic
1132265006 15:100462011-100462033 ACGTGTGTTAGGAAGAGAGCTGG - Intronic
1132302929 15:100787685-100787707 GGGTGTGTGGGGAAGGCAGCAGG - Intergenic
1138621584 16:58215675-58215697 CAGTGGGTGGGGATGACAGCAGG - Intergenic
1139955386 16:70690687-70690709 CCCTGGGAGGGGCAGACAGCTGG - Intronic
1140206544 16:72938142-72938164 CCGTGTGTGGGTACAGCAGCTGG + Intronic
1141370727 16:83483917-83483939 CCCTGTCTCTGGAAGACAGCAGG - Intronic
1141473787 16:84258219-84258241 CTGTGAGAGGGGAAGCCAGCTGG + Intergenic
1142814779 17:2416567-2416589 GCATGTGTGGGGAAGGAAGCAGG + Exonic
1143155987 17:4836352-4836374 CCATGTGTGGGGAGGCCAGATGG + Intronic
1143325171 17:6093873-6093895 CCTAGTGTGGGGAAAACACCAGG - Intronic
1143655553 17:8291485-8291507 CCTAGTGTGGGGAAGACCGGGGG + Exonic
1143777152 17:9206844-9206866 CCGTGCCTGGGGAGGAGAGCAGG - Intronic
1143813478 17:9491478-9491500 CCGGGTGTGGGGATGACAGGAGG + Intronic
1144590608 17:16520670-16520692 CAGTGTGCTGGGAAGACAACAGG + Intergenic
1144877888 17:18411837-18411859 CGGTGTGAGGGGAAGAAAACGGG - Intergenic
1145154341 17:20532588-20532610 CGGTGTGAGGGGAAGAAAACGGG + Intergenic
1146568325 17:33932174-33932196 CCTGGGGTGGGGAAGACACCAGG - Intronic
1146703256 17:34980659-34980681 CCCGGCGTGGGGAAGGCAGCGGG + Intronic
1146956463 17:36938902-36938924 CCGGGTTTGGGGAAGACCCCCGG - Intronic
1147647646 17:42043426-42043448 CTGTGTGTGGGGGAGGCAGGGGG - Intronic
1147650732 17:42060432-42060454 CAGGGTGTGGAGAGGACAGCGGG - Intronic
1147767437 17:42846141-42846163 CCGTGTGGGGGAAAGAGTGCTGG + Exonic
1147962622 17:44177293-44177315 CCGCTTCTGGGGAAGACAGAGGG + Intronic
1148148841 17:45384248-45384270 ACGTTTGTGGGAAAGACAGATGG + Intergenic
1149526033 17:57356359-57356381 CCTTGGGTGGGGACGTCAGCAGG + Intronic
1151309623 17:73285417-73285439 CCGTGTGTGAGGCGGACAGTGGG - Exonic
1151332459 17:73418792-73418814 CCGTGAGTGGAGAAACCAGCTGG - Intronic
1152631688 17:81413439-81413461 TGGTGTGGGGGGAAGACAGAAGG - Intronic
1155489981 18:26391234-26391256 CCACGTGTGTGGAATACAGCCGG + Exonic
1155786901 18:29913397-29913419 CTGTGGGTGGTGAAGATAGCTGG - Intergenic
1157228525 18:45891000-45891022 ATGTGTTTGGGGAAGACAGGAGG - Intronic
1157497682 18:48167965-48167987 CAGAGTGTGGGGAAGAGAGAAGG + Intronic
1158554674 18:58465573-58465595 CAGTAGGTGGGGAAGAGAGCAGG - Intergenic
1158661483 18:59392481-59392503 CAGTGTGTGAGGAACAGAGCTGG + Intergenic
1160798717 19:957282-957304 CCAGGTGCGGGGAAGCCAGCAGG + Intronic
1161295792 19:3519635-3519657 CCATGGTTGGGGAGGACAGCTGG - Intronic
1161479295 19:4502675-4502697 CGGTGTGTGGGTGACACAGCTGG - Exonic
1162343188 19:10104906-10104928 CCGAGTGTGTGGGAGACAGACGG - Intergenic
1165225750 19:34353301-34353323 CTGTGTGTTGGGAAGACATCAGG + Exonic
1165258701 19:34595822-34595844 CTGGGGGTGGGGAAGGCAGCAGG + Exonic
1167587833 19:50384761-50384783 CCCTGTCTCGGGAAGACAGACGG + Intronic
1168094621 19:54107637-54107659 CCCAGTGTGGGGAGGAAAGCTGG - Intronic
1168407018 19:56115802-56115824 CAGTGTGTTGTGGAGACAGCGGG + Intronic
928398434 2:30960870-30960892 AAGGGTGTGGGGAAGGCAGCTGG - Intronic
930233325 2:48864876-48864898 CAGGGTGTGGGGAGGACAGAAGG + Intergenic
930738481 2:54803825-54803847 CTGTGTGTGTGAAATACAGCTGG + Intronic
932283507 2:70514532-70514554 ACGAGAGTGGGGAAAACAGCTGG + Intronic
932460452 2:71878850-71878872 CTGTGTGTGGGGAGCACAGCTGG - Intergenic
933431024 2:82179253-82179275 CCGTATGTTAGGAATACAGCTGG + Intergenic
933647621 2:84825331-84825353 CCGTGTGTGAGGAAGGGAGGAGG + Intronic
936376553 2:111946090-111946112 GAGTGAGTGGGGAAGACAGAGGG + Intronic
936657540 2:114505720-114505742 CAGGGTGTGGGGCAGGCAGCTGG - Intronic
938163359 2:129005934-129005956 CGGTGTGAGGTGAAGCCAGCTGG + Intergenic
943392923 2:187292972-187292994 TGTTGTGTGGGGAAGACAGCTGG + Intergenic
944557052 2:200897619-200897641 CCATGTGTCAGGAAGAGAGCTGG + Intronic
948214028 2:236215546-236215568 TCGTCTCTGGGGAAGACCGCAGG - Intronic
948794964 2:240397770-240397792 CCGGGTGTGTGGGACACAGCAGG + Intergenic
948931072 2:241132720-241132742 CAGTGTGTGTGGAAGAGAGCAGG + Intronic
949027099 2:241771492-241771514 ACGTGTGTGGGGAGGAAGGCGGG + Intergenic
1169004610 20:2196012-2196034 CCCTATGTGGGGAACAGAGCTGG + Intergenic
1169040691 20:2492873-2492895 CCCTGTGTGTGGAGCACAGCTGG + Intronic
1169067308 20:2701356-2701378 CTGGGAGGGGGGAAGACAGCAGG - Intronic
1172362355 20:34322163-34322185 CTGTGTGTGGGTAAGTTAGCTGG + Intergenic
1175055588 20:56194552-56194574 GAGACTGTGGGGAAGACAGCAGG - Intergenic
1175159018 20:56994325-56994347 CTGGGTGGGTGGAAGACAGCTGG - Intergenic
1175958195 20:62622043-62622065 CTGAGAGTGGGGAGGACAGCTGG + Intergenic
1176137419 20:63530340-63530362 CCGTGCGTGGGTCAGACAGTGGG - Intronic
1176953889 21:15077549-15077571 CTGTGTATCTGGAAGACAGCAGG - Intergenic
1179346266 21:40560345-40560367 CCCTGTGTGGGGTGGAAAGCTGG + Intronic
1179511479 21:41876894-41876916 CTGTGTGTGGGGAATGGAGCTGG - Intronic
1179720845 21:43315378-43315400 GTGTGTGAGGGGAACACAGCAGG + Intergenic
1179791319 21:43757459-43757481 CCGTCCGTGGGGAAGGTAGCGGG - Exonic
1181158054 22:20937159-20937181 CTGTGTGTGGGTGAGAAAGCTGG - Intronic
1184383960 22:44163801-44163823 CCGTGTGTGGGAACGACTGTTGG + Intronic
1185173158 22:49305098-49305120 CCCTGTTTGCAGAAGACAGCAGG + Intergenic
949100656 3:140864-140886 CCTTGAGCAGGGAAGACAGCTGG + Intergenic
952257557 3:31708710-31708732 CAGTGTGTGGGAAGGACAGTAGG - Intronic
953749410 3:45597727-45597749 CCCTGGGAGAGGAAGACAGCTGG + Intronic
954861319 3:53693211-53693233 GTCTGTGGGGGGAAGACAGCTGG - Intronic
956286198 3:67613173-67613195 CAGTCTCTGGGGAAGAGAGCGGG - Intronic
956334046 3:68143657-68143679 CCTTGGGTGGGGAAGAGAGTGGG + Intronic
956771431 3:72529318-72529340 GCGTGCTTGGGGAGGACAGCCGG + Intergenic
958502993 3:94938027-94938049 CGGCGGGTGGGGAAGGCAGCCGG + Intergenic
961409839 3:126712177-126712199 CTGTGTGTGAGAATGACAGCAGG + Intronic
961530182 3:127535929-127535951 CTGAGTGTGGGGAAGACAGGAGG - Intergenic
961833254 3:129635777-129635799 TCGTGTGTGTGGACGACAGAAGG + Intergenic
962246836 3:133802483-133802505 TGGTGTATGGGGAAGACAGTGGG - Intronic
967362462 3:188647249-188647271 CCCTGTGTGAGGACCACAGCTGG - Intronic
968084989 3:195870202-195870224 CAGTCTGTGGGGGAGAGAGCTGG + Exonic
968448270 4:663378-663400 ACGCTTGTGGGGAAGACAACTGG + Intronic
970210326 4:13703280-13703302 CAGTGTGTGGGGAAGGCTGGTGG - Intergenic
976775133 4:88698804-88698826 CAGTGAGTGGGGAAGAAGGCGGG - Intronic
977188090 4:93965900-93965922 CAGAGGGTGGGGAAGACAGGGGG - Intergenic
980582366 4:134771702-134771724 TGGTGTGTGTGGAAGACAGAGGG - Intergenic
982728994 4:158935375-158935397 TGGTCTGTGGGGAAGACAGGAGG - Intronic
984186452 4:176549314-176549336 AAGTGTGTGAGGAAGAAAGCAGG - Intergenic
985620456 5:952270-952292 CCGTGTGTGGAGGAGACACCAGG - Intergenic
988696146 5:33624348-33624370 CCATCTGTGGGGAAGAGAGGTGG + Exonic
989454417 5:41626010-41626032 GGATGAGTGGGGAAGACAGCAGG - Intergenic
989584602 5:43064865-43064887 CCGTGATTGGGCAAGACTGCTGG - Intergenic
989728770 5:44622630-44622652 CCATGTTTGGAGATGACAGCTGG - Intergenic
992083446 5:73256807-73256829 GCTTTTGTGGGGAAAACAGCAGG + Intergenic
996221442 5:120937156-120937178 CAGTGAGAGGTGAAGACAGCTGG + Intergenic
997843160 5:137260893-137260915 GCGTGTCTGGGGCAGAGAGCAGG + Intronic
998500576 5:142628988-142629010 CCTGGGGTGGGGAAGACAGAAGG + Intronic
998729923 5:145062923-145062945 CTGTGTGTGGGGAGGGCAGTGGG + Intergenic
999264257 5:150256274-150256296 CGGTGGGTGGGGAAGAAGGCAGG - Intronic
999414180 5:151380514-151380536 TCGTGTGTTGGAAAGACAGTGGG + Intergenic
1004267988 6:14165912-14165934 CCTGGTGTGGAGAAAACAGCTGG - Intergenic
1006303097 6:33204471-33204493 CCGGGTGTGGAGAAGACAAGGGG - Intergenic
1006602027 6:35232679-35232701 AGGTCTGTGGGGAAGACAGGAGG + Intronic
1010293425 6:74167147-74167169 CTGTGTGTGGAGAAGACATTTGG + Intergenic
1013524131 6:110958882-110958904 CTGTGTGTGGGGAAGGGAGTTGG + Intronic
1018394955 6:163370968-163370990 CCCTGTGTGGGCAGGACAGGAGG - Intergenic
1018441987 6:163821945-163821967 CCGTGGGTGGGAGTGACAGCTGG + Intergenic
1018483360 6:164214331-164214353 CTGTGTGTGTGGAAGGCAGTTGG + Intergenic
1021121223 7:16797950-16797972 CTGTGTTTGGGGAAGACATCTGG + Intronic
1021498474 7:21303091-21303113 CAGAGTGAGGGGAAGCCAGCAGG - Intergenic
1021761532 7:23906722-23906744 CCAAGTGTGTGGAAGGCAGCAGG + Intergenic
1024555983 7:50604084-50604106 CACTGTGGGGGGAAGACAGGAGG + Exonic
1026513053 7:71043442-71043464 CCATGTTTAGGGAAGACAGGAGG + Intergenic
1029359159 7:100075686-100075708 CTGTGGGTTGGGAAGTCAGCAGG - Intronic
1029473015 7:100766508-100766530 CCCTACCTGGGGAAGACAGCAGG - Exonic
1030616072 7:111739365-111739387 CAGAGTGTGGGGAAGACTGAGGG - Intronic
1030638896 7:111981767-111981789 CCGTTGGTGGGAAAGACAGCAGG - Intronic
1031102524 7:117499947-117499969 AGGTGAGAGGGGAAGACAGCAGG + Intronic
1033111634 7:138583669-138583691 CAGTGTGTGTGGAAGGCAGTGGG + Intronic
1034560310 7:151876043-151876065 CGGTGGGTGGGGAAAGCAGCGGG - Intronic
1035251165 7:157598187-157598209 CGCTGGGTGGGGAAGACAGAGGG - Intronic
1035296842 7:157872280-157872302 GCGTGTGTGGGGAGGACACTGGG - Intronic
1035296884 7:157872436-157872458 GCGTGTGTGGGGAGGACACTGGG - Intronic
1035725996 8:1824821-1824843 TGGGGTGTGGGGAAGACAGGTGG - Intronic
1039883042 8:41638574-41638596 CCGTGTCCTGGCAAGACAGCGGG + Intergenic
1046291803 8:112172086-112172108 CAGTGTGGGAGGAAGACAGCCGG + Intergenic
1047115743 8:121840120-121840142 CCATGTGTGGCCAAGACAGATGG - Intergenic
1047730990 8:127728110-127728132 CTGAGTGTGGGCCAGACAGCAGG + Intergenic
1056532212 9:87497871-87497893 CGGAGTGTGAGGAGGACAGCCGG + Exonic
1057147042 9:92765195-92765217 CTGAGTGTGGGGAAGGCCGCGGG - Intergenic
1057867893 9:98695832-98695854 TGGGGTGTGGGGGAGACAGCTGG - Intronic
1059329042 9:113523658-113523680 TCGTGGGAGGGGAAGCCAGCTGG + Intronic
1060842589 9:126805311-126805333 CCGTGTGGGCAGAAGACTGCGGG - Intronic
1061511920 9:131066922-131066944 GCACGTGTGGGGAACACAGCTGG - Intronic
1061938989 9:133874058-133874080 CCGGGGCTGGGGCAGACAGCTGG + Intronic
1185529455 X:806057-806079 CCTTGTGTGATGAAGACAGGCGG - Intergenic
1186413336 X:9362561-9362583 GCGTGTCTGGGGAATCCAGCTGG - Intergenic
1190582724 X:51903999-51904021 TGATGTGTGGGGAAGACACCAGG + Intergenic
1190929214 X:54934044-54934066 TGATGTGTGGGGAAGACACCAGG + Intronic
1192185504 X:68944265-68944287 CTGTGTGTGGGGATGAGTGCAGG + Intergenic
1195389130 X:104342766-104342788 CCGTGTCTGGGGAGGTCACCAGG + Intergenic
1198318808 X:135498016-135498038 CCGTGTGTTGGGGAGACAGCAGG + Intergenic
1198439354 X:136646829-136646851 GCGTGGGAGGGGAAGAAAGCAGG + Intergenic
1199979676 X:152914089-152914111 GGGGGTGTGGGGAAGACAGCTGG - Intergenic