ID: 1083877467

View in Genome Browser
Species Human (GRCh38)
Location 11:65531841-65531863
Sequence CTGCCAAGGAGCCCTGTATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 143}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083877467_1083877472 3 Left 1083877467 11:65531841-65531863 CCACATACAGGGCTCCTTGGCAG 0: 1
1: 0
2: 1
3: 7
4: 143
Right 1083877472 11:65531867-65531889 TGGGAATGGCCAGCTTGCCCAGG 0: 1
1: 0
2: 0
3: 20
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083877467 Original CRISPR CTGCCAAGGAGCCCTGTATG TGG (reversed) Intronic
900342534 1:2195603-2195625 CAGCCAGGGAGCCCTGCAGGAGG - Intronic
901450364 1:9332965-9332987 CAGCCACGGAGCCCAGGATGGGG - Intronic
904046622 1:27613036-27613058 CTGCCCAGCATCCCTGTACGAGG - Exonic
904609173 1:31715651-31715673 CTGCCACGGAGCCCTGGAGTGGG + Intergenic
905027271 1:34859492-34859514 GTGCCGAGAAGCCCTGTCTGCGG + Intronic
905238420 1:36566165-36566187 CTGCCAGTGAGCCCTAGATGGGG - Intergenic
905948041 1:41920135-41920157 CTGCCAAAGGGCCCTGGAAGAGG - Intronic
906252377 1:44320520-44320542 CTTCCCAGGAGCGATGTATGAGG - Intronic
909611325 1:77554536-77554558 AAGGCAAAGAGCCCTGTATGAGG - Intronic
909662369 1:78098233-78098255 CTGCCAAACAGCTATGTATGTGG - Intronic
910669808 1:89761806-89761828 ATGCCAAGGGTCCCTGTCTGTGG - Intronic
911864521 1:103000641-103000663 CTTCCAAGTAACCATGTATGAGG - Intronic
913565462 1:120069084-120069106 CTGCCGAGGAGGCGTGTAAGGGG + Intronic
915978961 1:160408448-160408470 CTGGCCAGGAGCCCAGTCTGTGG + Intronic
919558338 1:199089545-199089567 CTGCCAAAGAGCTTTCTATGAGG - Intergenic
923401346 1:233618179-233618201 ATGCTAAGGTGCCCTGTTTGGGG + Intronic
1064374135 10:14780275-14780297 CTTCCAAGTAGTCCTGTTTGGGG - Intergenic
1068647149 10:59480505-59480527 TTCCCAAGGAGCCCTGTATTTGG + Intergenic
1070819044 10:79344078-79344100 CTCCCAGGTAGCCCTGTGTGTGG - Intergenic
1071789304 10:88937484-88937506 CCACCCAGGACCCCTGTATGTGG - Intronic
1075286899 10:121194968-121194990 CTGCCCAGGAGCCAAGAATGCGG - Intergenic
1077493410 11:2872731-2872753 CTTCCAGAGAGCACTGTATGGGG - Intergenic
1077862301 11:6193904-6193926 CTGCTTAAGAGCCCTGTATATGG - Intergenic
1081857277 11:46311899-46311921 CCTCCAAGGAGCGCTGTGTGAGG + Intronic
1083877467 11:65531841-65531863 CTGCCAAGGAGCCCTGTATGTGG - Intronic
1084474351 11:69380491-69380513 GTGCCAGGGAGGCCTGTGTGGGG + Intergenic
1085153236 11:74268834-74268856 CGGCAAAGAAGCCGTGTATGGGG - Intronic
1085390423 11:76179327-76179349 CTTCAGAGGAGCCCTGTGTGAGG + Intergenic
1086452739 11:86933165-86933187 CTGCCAAGGAGCCATTGCTGTGG + Intronic
1086841819 11:91695022-91695044 GTGCTAGGGAGCCCTGTCTGGGG + Intergenic
1093108616 12:15120917-15120939 ATGCAAAGAAGCCCTCTATGAGG - Intronic
1095050077 12:37547057-37547079 CTGGCAAGCATCCCTGAATGTGG + Intergenic
1095416518 12:41983189-41983211 ATTCCAACGAGCACTGTATGAGG + Intergenic
1102010829 12:109617381-109617403 CTCCCAAGGAGCTCTGTTTCAGG - Intergenic
1104128671 12:125872041-125872063 AGGCCATGGAGCCCTGGATGGGG + Intergenic
1106355934 13:28983186-28983208 CTGCCAGGGACCTCTGTGTGAGG - Intronic
1107133496 13:36920286-36920308 CGGCCAGGGAGCCCTGCTTGCGG + Intronic
1116872716 14:50083575-50083597 GTTCCAAAGAGCCCTGAATGCGG - Intergenic
1119021032 14:71115039-71115061 CTGGCAATGAGCTCTGCATGAGG + Exonic
1122863485 14:104593192-104593214 CAGCCAAGGGGCCCTGTGCGAGG + Exonic
1128081142 15:64857615-64857637 CTCCTAAGGAACCCTGTATCTGG - Intronic
1129672061 15:77612953-77612975 CTGCCGAGGGGCCCTCCATGGGG - Intergenic
1129745981 15:78021510-78021532 CTGCAGAGGAGACCTGCATGAGG + Intronic
1129883793 15:79025053-79025075 CTGCCCAGGTGCCCAGTGTGGGG + Intronic
1130486132 15:84399316-84399338 TTGCCAAGGAGCACTGGCTGCGG - Intergenic
1131132466 15:89909084-89909106 CTGAAAAGGAGCCCTGGGTGAGG + Intronic
1131952920 15:97701319-97701341 CTCCCAGGGAACCCTATATGTGG + Intergenic
1132365777 15:101255347-101255369 TTTCCAAGGACCCCTGTTTGAGG - Intergenic
1134807356 16:17137348-17137370 CAGCCAAGGTGCCCTTGATGTGG - Intronic
1138659669 16:58509676-58509698 CTGCCAGGGAAGCCTGTCTGGGG + Intronic
1138861080 16:60758408-60758430 ATGCCAAAGAGCCATGTATTGGG - Intergenic
1141263010 16:82470836-82470858 CTCCCAAAGAGCACTGTGTGTGG + Intergenic
1141285501 16:82668098-82668120 CTGCCAGGGAGACCTGCCTGGGG + Intronic
1142768758 17:2081600-2081622 CTGCCTTGGAGCCCAGGATGAGG + Intronic
1143388000 17:6543476-6543498 ATGCTCAGGAGCCCTGTCTGAGG + Intronic
1144930006 17:18851402-18851424 CTGCCACGGGGGCCTGTGTGTGG + Intronic
1146548477 17:33759707-33759729 TAGCCAAGGAGCACTGCATGGGG - Intronic
1147320832 17:39644988-39645010 CTAGCAAGGAACCCTGTCTGTGG + Intronic
1148873200 17:50670766-50670788 GGGCCATGGAACCCTGTATGGGG + Intronic
1150650206 17:67005261-67005283 CTGCCCAGGAGCCTTGGCTGGGG + Intronic
1151474429 17:74337793-74337815 CTGCCAGGGAGACCAGCATGGGG - Intronic
1151804509 17:76397173-76397195 CAGCCAAGGAGGCCTGTGTGGGG + Intronic
1152946706 17:83201850-83201872 CTGGCCAGGAGCCCAGGATGGGG - Intergenic
1153965029 18:10172065-10172087 CTGCTATAGAGCCCAGTATGAGG + Intergenic
1154164680 18:12005806-12005828 CTGCCAGTGAGCCCTGAAGGAGG - Intronic
1154344016 18:13527635-13527657 CTTCCAAGTAGCCATGCATGTGG - Intronic
1160843452 19:1156450-1156472 CTGCCAAGCAGCCGTGTGTGAGG - Intronic
1161603560 19:5201290-5201312 CTGGGAAGGTGCCTTGTATGGGG + Intronic
1163476697 19:17530693-17530715 CTGCCCAGGAGACCTGCTTGGGG - Intronic
1164514966 19:28926326-28926348 CTGACTAGGAGCCCTGTGTAGGG - Intergenic
1165897467 19:39151429-39151451 CTGCCAAGTGGCCCTGCGTGAGG - Intronic
926965036 2:18400566-18400588 CTGACAAGGAGCAAGGTATGGGG + Intergenic
927274922 2:21254654-21254676 TTGCCAAGGAGGCCTTCATGCGG + Intergenic
930014203 2:46959327-46959349 CTGCCAAGGAGTGCTGAGTGTGG - Intronic
934707644 2:96495856-96495878 TTGACAAGGAGCTCTGTTTGTGG + Intergenic
936290549 2:111220490-111220512 GAGCCAAAGAGCCCTCTATGAGG + Intergenic
936818037 2:116484480-116484502 CTGCCAAGCAGCCAAGTAGGGGG + Intergenic
937258524 2:120571115-120571137 CTCACAAGGAGCCCTGGAAGTGG + Intergenic
937261398 2:120588633-120588655 CTGCCAATTAGCCCAGGATGGGG - Intergenic
944103965 2:196059513-196059535 GTGCCAAGAAGCACTGTAAGAGG + Intronic
946524890 2:220507732-220507754 CTGCCAAGGAACCCTAACTGGGG + Intergenic
947121449 2:226819224-226819246 CTGCCCAGGAGCATAGTATGTGG - Intergenic
947618533 2:231574112-231574134 CTGCCAACGAGGCCTCTTTGGGG - Intergenic
947837193 2:233184312-233184334 CTGAGAAGGAGCTCAGTATGTGG + Intronic
948709219 2:239815098-239815120 CTTTCAAGGAGCCCTGTCAGGGG + Intergenic
1169046267 20:2536684-2536706 CTGCCCAGGAACCCTGTGGGCGG - Intronic
1171108916 20:22462611-22462633 GTGGGAAGGAGACCTGTATGGGG - Intergenic
1171465723 20:25326381-25326403 CAGGTCAGGAGCCCTGTATGGGG - Intronic
1173868872 20:46329754-46329776 CAGCCAGGGAGCCCGGCATGGGG - Intergenic
1179007940 21:37531174-37531196 CTGCCAAGCAGCCCTGGACAGGG + Intergenic
1180868195 22:19131708-19131730 GTGCCAGGGAGCCCTGCATGAGG + Exonic
1181591616 22:23889086-23889108 CCTCCCAGGAGCCCTGTGTGTGG + Intronic
1183458672 22:37936525-37936547 CTACCAAAGAGCCCTGCAAGGGG - Intronic
1184208339 22:43019825-43019847 CTGCCCAGGTGCCCTGAATTGGG + Intergenic
1185263987 22:49888554-49888576 CTTCCCTGGAGCCCTGTCTGGGG - Exonic
953141118 3:40230337-40230359 CTGACAGGGAGCCCTGTATGTGG - Intronic
954285394 3:49615549-49615571 CTGCCCAGGAACCCTGGGTGTGG + Intronic
954430124 3:50466190-50466212 CTGCTCAGCAGCCCTGCATGGGG - Intronic
954452511 3:50579427-50579449 CAGCCCAGGAGTCCTGGATGGGG + Intronic
954629028 3:52038325-52038347 CTGCCAAGGAGCCCAGAGAGAGG + Intergenic
957933714 3:86915225-86915247 CTCCCAAGCTGCCCTGTGTGCGG - Intergenic
961393153 3:126568641-126568663 CTCCCCAGCAGCCTTGTATGTGG - Intergenic
972390360 4:38607621-38607643 CTGCAGAGGAGCCCTGGTTGGGG - Intergenic
972639036 4:40909043-40909065 CTGCAGAGGAGCCCAGTGTGGGG + Intronic
974092726 4:57329068-57329090 CTTCCAAGAAGCACTGTGTGAGG + Intergenic
974808995 4:66921224-66921246 CTGCAGAGGAGCCCAGTATCAGG - Intergenic
977919005 4:102623754-102623776 AAGCCAAGGAGCACAGTATGGGG - Intergenic
979361352 4:119769362-119769384 TTGCCAAGGATCCCTGTCTCTGG + Intergenic
985591846 5:769926-769948 CTCCCAAGGAGCCCTGACCGAGG + Intergenic
985609760 5:880878-880900 CTCCCAAGGAGCCCTGACCGAGG + Intronic
986383504 5:7208791-7208813 CTGCTCAGGAGCCCTGGATTGGG - Intergenic
990604932 5:57399432-57399454 CTGCCAAAAAGACCTGTAAGTGG - Intergenic
991220655 5:64211571-64211593 ATGCCAAGGAGGCCTGTTTTGGG + Intronic
991404150 5:66285430-66285452 CCTCCAAGGAGCCCCATATGAGG - Intergenic
997183488 5:131857887-131857909 CTGCCAATGTGGCCTGCATGAGG + Intronic
998485855 5:142501582-142501604 CTGACAAGGAGGCATGTATGGGG - Intergenic
1000392753 5:160742451-160742473 CTGCCTATGTGCCCAGTATGAGG - Intronic
1001540586 5:172534900-172534922 TTCCCAAGGATCCCTGTCTGCGG + Intergenic
1004445718 6:15695509-15695531 ATGCCAAGGTGCCCTGTTTTGGG + Intergenic
1006718659 6:36136150-36136172 CTGCCCAGGAGCACAGAATGTGG + Intronic
1007224411 6:40302850-40302872 TTGCCAATGAGCTCTGTGTGAGG + Intergenic
1018856511 6:167678921-167678943 ATGCTAAGGAGCCCTGGATTCGG - Intergenic
1022263884 7:28734073-28734095 CTGCAGAGAAGCCCTGCATGAGG + Intronic
1022746345 7:33176189-33176211 ATGCCAAAGAGTCCTGTTTGAGG + Intronic
1022825249 7:34004746-34004768 TTGCCAAAGGGCTCTGTATGAGG + Intronic
1023709207 7:42974087-42974109 ATGCCAAGTAGCCCTGAAAGAGG + Intergenic
1024137567 7:46426229-46426251 CTGCCAAGGAGGTTTGAATGAGG + Intergenic
1027766780 7:82353909-82353931 ATGCCAAGGTGCCCTATTTGGGG - Intronic
1030669739 7:112323043-112323065 TTGCCAAGGGGCTTTGTATGTGG + Intronic
1032225935 7:130031850-130031872 TTGCCAAGGAGCTCTGTGTGTGG - Intronic
1035522569 8:286985-287007 CTGCAAAGGGGCCCTGCGTGAGG + Intergenic
1035958928 8:4115678-4115700 CGACCAAGGTGCCCTGTAAGAGG + Intronic
1035969172 8:4228189-4228211 CAGCCAAGGAAACCTGGATGTGG - Intronic
1047015998 8:120724171-120724193 CTGCAAAGGAGCCCTGTTTCAGG + Intronic
1048489236 8:134876911-134876933 CCTCAAAGGAGCCCTGAATGAGG + Intergenic
1049162247 8:141104981-141105003 CTGCCATGGAGCCCTGGGGGTGG - Intergenic
1049416819 8:142499138-142499160 CTGCCAAGCTACCCTGTGTGTGG - Intronic
1050962747 9:11757445-11757467 CTGCCAGAGAGCCATGTAAGTGG - Intergenic
1057552916 9:96065244-96065266 CTGCCATGGAGCCATGTTGGTGG + Intergenic
1060105774 9:120872383-120872405 CCTCCAAGGAGCCTGGTATGTGG + Intronic
1060179304 9:121521821-121521843 CAGCTTAGGAACCCTGTATGGGG + Intergenic
1061625362 9:131838109-131838131 CTGCACAGCAGCCCTGCATGGGG - Intergenic
1061801435 9:133115289-133115311 CTCCCAAGGAGACCTGGCTGAGG + Intronic
1189614795 X:42771883-42771905 CTGTCTTGGAGCTCTGTATGGGG - Intergenic
1189876153 X:45438316-45438338 CTGCCAAGAAACCTTGTATCAGG + Intergenic
1190398282 X:50006697-50006719 CTGCCAAGGTGCATTGCATGTGG - Intronic
1193882280 X:86937499-86937521 GTGTCATGGAGACCTGTATGAGG - Intergenic
1194467918 X:94255896-94255918 CTGCCATGGGGCCATGTCTGGGG - Intergenic
1199383313 X:147194781-147194803 CTGCCAGTGTGCCCTGGATGTGG + Intergenic
1199514037 X:148655694-148655716 CTCCCAGGGAACCCTGAATGTGG - Intronic
1199610251 X:149606652-149606674 CTGCCAGGAAGCCCTGTGTTGGG - Intronic
1200740420 Y:6847689-6847711 CTGCACAGGAGCTCTGTGTGGGG + Intergenic