ID: 1083879426

View in Genome Browser
Species Human (GRCh38)
Location 11:65540744-65540766
Sequence CCTGCGAGGAAGGTGCGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 264}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083879402_1083879426 25 Left 1083879402 11:65540696-65540718 CCATCCCCGGGCGGGGCCTACAG 0: 1
1: 0
2: 2
3: 14
4: 121
Right 1083879426 11:65540744-65540766 CCTGCGAGGAAGGTGCGGGCGGG 0: 1
1: 0
2: 3
3: 29
4: 264
1083879406_1083879426 20 Left 1083879406 11:65540701-65540723 CCCGGGCGGGGCCTACAGGAGGG 0: 1
1: 0
2: 1
3: 39
4: 248
Right 1083879426 11:65540744-65540766 CCTGCGAGGAAGGTGCGGGCGGG 0: 1
1: 0
2: 3
3: 29
4: 264
1083879408_1083879426 19 Left 1083879408 11:65540702-65540724 CCGGGCGGGGCCTACAGGAGGGG 0: 1
1: 0
2: 0
3: 19
4: 188
Right 1083879426 11:65540744-65540766 CCTGCGAGGAAGGTGCGGGCGGG 0: 1
1: 0
2: 3
3: 29
4: 264
1083879404_1083879426 21 Left 1083879404 11:65540700-65540722 CCCCGGGCGGGGCCTACAGGAGG 0: 1
1: 0
2: 3
3: 31
4: 433
Right 1083879426 11:65540744-65540766 CCTGCGAGGAAGGTGCGGGCGGG 0: 1
1: 0
2: 3
3: 29
4: 264
1083879419_1083879426 -9 Left 1083879419 11:65540730-65540752 CCTACAGGGCGGGGCCTGCGAGG 0: 1
1: 0
2: 0
3: 18
4: 166
Right 1083879426 11:65540744-65540766 CCTGCGAGGAAGGTGCGGGCGGG 0: 1
1: 0
2: 3
3: 29
4: 264
1083879413_1083879426 9 Left 1083879413 11:65540712-65540734 CCTACAGGAGGGGCGGGGCCTAC 0: 1
1: 0
2: 0
3: 16
4: 153
Right 1083879426 11:65540744-65540766 CCTGCGAGGAAGGTGCGGGCGGG 0: 1
1: 0
2: 3
3: 29
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083879426 Original CRISPR CCTGCGAGGAAGGTGCGGGC GGG Intronic
900226293 1:1535032-1535054 CCTGGGGGGCAGGTGGGGGCAGG - Intergenic
900367669 1:2317876-2317898 CCTGCGCTGAGGGCGCGGGCCGG - Intergenic
900387642 1:2417781-2417803 CCTGGGAGGAGGGGACGGGCAGG + Intergenic
901061793 1:6475138-6475160 CCTGGGAGGATGGTGGGGGTGGG + Exonic
901317058 1:8316580-8316602 CCTGGGAAGGAGGTGAGGGCTGG - Intergenic
901430534 1:9211386-9211408 CCTGGGAGGAAGGGGTGGGAGGG - Intergenic
901739854 1:11334915-11334937 CCGGTGAGGATGCTGCGGGCAGG + Intergenic
902219464 1:14955670-14955692 CCTGTTAGGAAGGTGCACGCAGG + Intronic
903483433 1:23671201-23671223 CCTGGCAGCAAGGTGAGGGCCGG + Intergenic
904470591 1:30733714-30733736 CCTGCCAGGGAGGGGCGGGAGGG + Exonic
906196883 1:43935176-43935198 CCGGAGAGGAAGCTGAGGGCTGG - Intronic
907509646 1:54948662-54948684 CCTGCGAGCCAGGTGAGGGCTGG + Intergenic
907527643 1:55063194-55063216 CCTGGGTGGGAGGTGCGGGGTGG + Intronic
910200068 1:84690310-84690332 CCCGCCAGGGAGGGGCGGGCGGG - Intronic
910285353 1:85547759-85547781 CCTGTGAGGAAGATGCTGACTGG + Intronic
910825680 1:91404754-91404776 CCCGCGGGGAAGGTGGGGACGGG - Intronic
912716883 1:111989547-111989569 CGCGCGAGGAAGCTGCGGCCGGG + Intergenic
913074220 1:115327811-115327833 CCTGCTTGGGAGGTGGGGGCAGG + Intronic
914984553 1:152444697-152444719 CCTCCGAGGACAGTGCGGGTGGG + Intergenic
916104350 1:161420010-161420032 CCTGGGTGGAAGGTGTGGCCTGG + Intergenic
919781849 1:201226134-201226156 CCTGAGAGGGAGGAGCAGGCAGG + Intronic
922744386 1:228036015-228036037 CCTGGGAGGAAGGAGCCCGCCGG + Intronic
922785146 1:228278944-228278966 TCTTCGTGGAAGGTGCAGGCAGG + Exonic
1062838706 10:652902-652924 GCTGCGAGGTAGCTGTGGGCGGG - Intronic
1063374686 10:5547078-5547100 CCTTCTGGGCAGGTGCGGGCTGG + Intergenic
1065024274 10:21526210-21526232 CCTGCGAGGGAGGGGAGGGACGG + Intergenic
1066187577 10:33025168-33025190 CCTGAAAGGTAGGTGAGGGCTGG - Intergenic
1066402588 10:35090253-35090275 CCGGCGAGGAAGGTGGGCGGAGG + Exonic
1067229062 10:44394397-44394419 CCCCCCAGGAAGGTGCTGGCTGG - Intergenic
1067546356 10:47195228-47195250 CCTGCGATCAAGGTGTCGGCGGG - Intergenic
1071061169 10:81571487-81571509 ACTACGGGGAAGGTGTGGGCAGG - Intergenic
1072508013 10:96089861-96089883 CCTGGGAGGAAGGGGCGGGCCGG - Intergenic
1073109086 10:101050250-101050272 CCTGTGAGGAGGGAGCTGGCTGG + Intergenic
1073137220 10:101226764-101226786 GAGGCGAGGAAGGAGCGGGCCGG + Exonic
1073376356 10:103038722-103038744 CCTGCTAGGGAGGTCTGGGCCGG + Intronic
1073381840 10:103083871-103083893 CCTGGGAGGAAGGTCGGAGCAGG + Exonic
1073860428 10:107732280-107732302 GGTGGGAGGAAGGTGCGGGTGGG + Intergenic
1076369146 10:129940686-129940708 CCTGCTAGGAAGTAGGGGGCTGG + Intronic
1076629015 10:131841704-131841726 CCAGGGAGGAAGGCGGGGGCTGG - Intergenic
1076855377 10:133113356-133113378 GCTGCGAGGCAGGTGAAGGCGGG - Intronic
1077097013 11:803350-803372 ACTGTGAGGAAGGTGAGGGCGGG + Exonic
1078748028 11:14133915-14133937 CAGGCCAGGAAGGTGCGGCCTGG + Intronic
1081600412 11:44488683-44488705 CCTGGGAGGAAGGATCTGGCAGG + Intergenic
1081872503 11:46389806-46389828 CCTGCGAGGAACGTGTGGGCGGG + Intergenic
1083293648 11:61703542-61703564 CCTGGGAGGCTGGTGAGGGCAGG + Intronic
1083879426 11:65540744-65540766 CCTGCGAGGAAGGTGCGGGCGGG + Intronic
1084115958 11:67043088-67043110 CCTCCCAGGAAGTTGTGGGCAGG - Intronic
1084519632 11:69655483-69655505 CCTGGGAGGAAGGTGGGGTGTGG + Intronic
1087705153 11:101481697-101481719 CCTGCGAGGAGGATGAGGCCTGG - Intronic
1089058417 11:115606672-115606694 CCTGCGCAGAAGGTTCGGGCCGG + Intergenic
1089496310 11:118910193-118910215 CCTGAGGGCAAGGTGCGGGAGGG - Exonic
1095672405 12:44876354-44876376 CCGGGGAGGGAGGGGCGGGCCGG + Intronic
1097186984 12:57201379-57201401 CCTCCGAAGAAGTTGCTGGCAGG + Intronic
1097540769 12:60939282-60939304 CCTGGGAGGAAGATGTAGGCTGG - Intergenic
1102063378 12:109952350-109952372 CATGCTAGGATGGTGCGGGTGGG - Intronic
1102454925 12:113065432-113065454 CCAGCCCGGAAGGCGCGGGCGGG - Intronic
1102915636 12:116750038-116750060 CCAGGGAGGAAGGAGGGGGCCGG + Exonic
1103410796 12:120710381-120710403 CCGGCGGGGAAGGGGCGGGGAGG - Intergenic
1103937412 12:124483886-124483908 CCTGCCAGGAAGGTGCTCACAGG + Intronic
1103967777 12:124651160-124651182 GCTGAGAGGAAGGAGCTGGCTGG + Intergenic
1104820710 12:131675763-131675785 TCAGCGAGGCAGGTGTGGGCTGG + Intergenic
1104929264 12:132329499-132329521 GCGGCGGGGAAGGCGCGGGCGGG + Intergenic
1106013780 13:25848999-25849021 CCAGAGAGTAAGGTGGGGGCGGG + Intronic
1108478563 13:50843995-50844017 CCTTCGAAGGAGGTGGGGGCGGG - Intergenic
1108603148 13:52011890-52011912 CCTGCGGGGAAGGTGCCCGGCGG + Intergenic
1112990296 13:105505369-105505391 CATGGGAGAAAGGTGCGGGCTGG + Intergenic
1113603465 13:111587940-111587962 CCTGAGATCAAGGTGCTGGCAGG + Intergenic
1114042987 14:18695985-18696007 CCTGAGAAGAAGGAGCGAGCTGG + Intergenic
1114047278 14:18886425-18886447 CCTGAGAAGAAGGAGCGAGCTGG + Intergenic
1116820367 14:49621194-49621216 TCTGCACGGAAGGGGCGGGCGGG - Exonic
1119608410 14:76041068-76041090 CCAGAGAGGAAGGTGGGAGCAGG - Intronic
1119720662 14:76888102-76888124 CCTGATGGGAAGGTGAGGGCAGG + Intergenic
1120996127 14:90419943-90419965 GCTGGGTGGAAGGTGCTGGCTGG - Intergenic
1122301579 14:100734172-100734194 CCTGCGTGGATGATGAGGGCCGG + Exonic
1122348919 14:101076821-101076843 CCTGCCAGGCAGTTGCGGGGAGG - Intergenic
1122429838 14:101633349-101633371 CCTTCGGGGAAGATGCGGGAGGG + Intergenic
1122896299 14:104759049-104759071 TCTGAGAGGAAGGTGCTGGCAGG + Intronic
1124621939 15:31278874-31278896 GCTGTGAGGAAGGTGTGGGGCGG + Intergenic
1127224926 15:56918734-56918756 CCCGGGAGGAAGGGGCGGCCAGG + Exonic
1129738047 15:77976622-77976644 CCGGGGAGGAAGGTGGGAGCAGG + Intergenic
1129776944 15:78243220-78243242 CCAGCGTGGAAGGTGCAGCCTGG - Intronic
1129848029 15:78776987-78777009 CCGGGGAGGAAGGTGGGAGCAGG - Intronic
1130205306 15:81869972-81869994 GCTGCTTGAAAGGTGCGGGCAGG - Intergenic
1130559406 15:84946707-84946729 GCAGCGAGGGAGGTGAGGGCGGG - Intergenic
1131071983 15:89471722-89471744 CCTGGGATGAAGGGGAGGGCAGG + Exonic
1132508422 16:324326-324348 CCTGGGAGGAGGCTGGGGGCCGG + Intronic
1132763108 16:1520562-1520584 CCTGTGAGGTAGCCGCGGGCTGG + Intronic
1132931175 16:2459963-2459985 CCTGGGAGGCAGGAGTGGGCGGG + Intergenic
1133033145 16:3021092-3021114 CCTGTGAGGAATGCGCGGGGAGG + Intronic
1134054938 16:11164168-11164190 CCTCTGCGGTAGGTGCGGGCAGG + Intronic
1134091707 16:11395076-11395098 CTTGCCAGGCAGGTGGGGGCAGG + Intronic
1139471074 16:67178504-67178526 CCTGCGGGGAAGGCGAGGGGAGG + Exonic
1141522438 16:84590031-84590053 CCTGCAAGGAGGGAGAGGGCTGG - Intronic
1141830636 16:86508392-86508414 CGAGCCAGGAAGGTGGGGGCGGG + Intergenic
1142059925 16:88022696-88022718 CCTGGGATGAAGGTGTGGGCAGG + Intronic
1142220228 16:88850647-88850669 CCAGGGGAGAAGGTGCGGGCGGG + Intronic
1142589710 17:997369-997391 CCTGCGTGGGAGGTGAGGCCGGG + Exonic
1142619245 17:1154474-1154496 GCTGGGAGGAAGGGGCTGGCCGG - Intronic
1142737245 17:1908710-1908732 CCGGCAGGGAAGGCGCGGGCGGG - Intergenic
1143388087 17:6543845-6543867 CCTCCAAGGAAGGGGTGGGCAGG + Intronic
1144739953 17:17576251-17576273 CCTTCGAGGAAAGTGTGGGAGGG - Intronic
1147254667 17:39174695-39174717 GCTGGGAGGAAGGGGCAGGCAGG + Exonic
1147369279 17:39980701-39980723 GCTTCGAGGAAGGAGCGGGGAGG - Intergenic
1147732051 17:42610086-42610108 ACTGGGGGGAAGGGGCGGGCAGG - Exonic
1148591042 17:48817029-48817051 CCTTCGAGGAGGGGGCCGGCAGG - Exonic
1148695723 17:49556877-49556899 TCTGGGTGGAAGGTGGGGGCAGG - Intergenic
1149650811 17:58275335-58275357 CCTGCGAAGAAGGAGAGGGAAGG + Intronic
1149656223 17:58310835-58310857 CCTGGGAGCAAGGTGCTGGAGGG + Exonic
1149867287 17:60157864-60157886 CCAGCGAGGCAGGAGGGGGCGGG + Intronic
1149992316 17:61389998-61390020 CCCCCGAGGAAGGAGCAGGCAGG - Intronic
1150624804 17:66835057-66835079 CCCGAGAGGGAGGGGCGGGCAGG - Intergenic
1151358791 17:73576127-73576149 CCTGGGAGGAAGGTGAGTGTGGG + Intronic
1151775418 17:76198055-76198077 CCAGAAAGGAAGGTGGGGGCAGG - Intronic
1152528939 17:80905770-80905792 ACTGCGAGGAGGGTGCAGGCTGG - Intronic
1152587997 17:81197601-81197623 CCTGGGGGCCAGGTGCGGGCTGG + Intronic
1152820550 17:82435667-82435689 CCTGCAAGGAAGGAGCAGGACGG - Exonic
1154412438 18:14148689-14148711 CCTGCAAGGAAAGTGCTGCCTGG + Intergenic
1155249030 18:23938187-23938209 CCTGAGAGGAAGCTGAAGGCGGG - Intronic
1157529649 18:48409913-48409935 CCTGCGCTGGGGGTGCGGGCGGG - Intronic
1158669389 18:59461335-59461357 ACTGCTGGGAAGGTGGGGGCTGG - Intronic
1160661822 19:304740-304762 CCTGCAGGGACGGTGCAGGCTGG - Intergenic
1161034997 19:2079610-2079632 TCTGAGACGAAGGTGTGGGCGGG - Intronic
1161145583 19:2676186-2676208 TCTGAGACGAAGGTGTGGGCAGG - Intronic
1161162977 19:2770857-2770879 TCTGAGATGAAGGTGCAGGCTGG - Intronic
1161314930 19:3613316-3613338 CCTCCGAGGAGGGCCCGGGCGGG + Exonic
1161397514 19:4052463-4052485 CAGGAGAGGAAGGTGCGGCCTGG - Intronic
1162019664 19:7862803-7862825 CGGGCAAGGGAGGTGCGGGCGGG - Intronic
1162858506 19:13488123-13488145 CCTGGGAGGGAGGTGCCAGCAGG + Intronic
1162908216 19:13835941-13835963 GCTGCTAGGAAGGTGCGGGCCGG + Intergenic
1163727243 19:18929634-18929656 CCTGCCAGGAAAGGGTGGGCAGG + Exonic
1164575840 19:29404871-29404893 CCTGGGAGGCAGGTCCGGCCTGG + Intergenic
1167441843 19:49513328-49513350 CCCGGGAGGAAGGGGCGGGCCGG + Intronic
1167575589 19:50316032-50316054 CCTGGGGGGAAGGGGCGGGGGGG + Exonic
925959652 2:9003442-9003464 CCCGGGAGGAGGGTGGGGGCTGG - Intronic
928177322 2:29043590-29043612 CCTGTCAGGTAGGTGAGGGCAGG - Intronic
930358069 2:50346196-50346218 CTTTGGAGGAATGTGCGGGCTGG + Intronic
931348664 2:61470298-61470320 CCTGCCGGGAAGGTGCGGGGAGG - Intronic
931643434 2:64400996-64401018 CCTGCTAGGAAGGGGAGGTCTGG + Intergenic
931681273 2:64751408-64751430 CCAGAGGGGAAGGAGCGGGCGGG + Intergenic
932140764 2:69275669-69275691 CCTGTCAGGAAGGTGGGGGTTGG - Intergenic
932410646 2:71545434-71545456 CCAGCGAGGAAGGGAGGGGCTGG - Intronic
934692037 2:96369052-96369074 CCTGCAGAGGAGGTGCGGGCTGG + Exonic
938291673 2:130153935-130153957 CCTGCAAGGGAGGCGCGGGCAGG + Exonic
938464878 2:131519028-131519050 CCTGCAAGGGAGGCGTGGGCAGG - Intergenic
943692413 2:190881635-190881657 CGGGCGGGGAAGGCGCGGGCGGG - Intronic
946249119 2:218402272-218402294 CCTGGGAGGGAGGTGTGTGCTGG + Intronic
946399043 2:219459243-219459265 CCAGCCAGGAAGGAGGGGGCAGG - Intronic
948727313 2:239942924-239942946 CCTGCAAGGATGGTGGTGGCAGG + Intronic
948760372 2:240186513-240186535 CCTGGGAGGCTGTTGCGGGCTGG - Intergenic
948886509 2:240887717-240887739 CCTGGGATGAGGGTGAGGGCCGG + Intronic
1171439166 20:25147356-25147378 CCTGGGAGGCAGCTGCGGGGAGG - Intergenic
1172702671 20:36862843-36862865 GCTGCGCGGAGGGCGCGGGCTGG + Exonic
1173793504 20:45842973-45842995 CCTGCAAGGAAGGTCCAAGCAGG + Intronic
1174578247 20:51552963-51552985 CTTGCCAGGAAGGTGCGGGAGGG - Intronic
1175311131 20:58012217-58012239 TCTGAGATGAAGGTGTGGGCAGG - Intergenic
1175922097 20:62455021-62455043 CGTGCAAGGGAGGTGCGGGCAGG + Intergenic
1176117937 20:63441186-63441208 CCTGCGGGGGAGGTGAGGGCGGG + Intronic
1178665784 21:34545072-34545094 CCTGCCATCATGGTGCGGGCTGG + Intronic
1179213690 21:39348948-39348970 CCTGCGGGGAAGGCGCGTGCCGG + Exonic
1179494961 21:41766010-41766032 CCTGCTAGGTAGGTACAGGCAGG + Intronic
1179997431 21:44980468-44980490 CCTGAGAAGAAGGGGAGGGCCGG - Intergenic
1180064248 21:45404942-45404964 GCTGCGAGGACGGGGCGGGCCGG - Intergenic
1180465811 22:15609080-15609102 CCTGAGAAGAAGGAGCGAGCTGG + Intergenic
1180975682 22:19846809-19846831 CCTGAGATCAAGGTGTGGGCAGG - Exonic
1181111312 22:20604548-20604570 CCTGCAAGGGAGGCGAGGGCAGG + Intergenic
1181115903 22:20632397-20632419 GCTCCTAGGAAGGTGCGGGCTGG + Intergenic
1181419177 22:22785959-22785981 CCAGCGTGGGAGATGCGGGCTGG + Intronic
1181425320 22:22833686-22833708 TCTGAGAGGGAGGTGGGGGCAGG + Intronic
1181516452 22:23416423-23416445 CATGGGAGGAAGGTCCGGCCAGG + Intergenic
1182294900 22:29306973-29306995 CCTGCCCGGAGGGGGCGGGCGGG - Intronic
1183412155 22:37661155-37661177 CCTGCAAGGCAGGTGTGGGCAGG - Intronic
1183417152 22:37689011-37689033 CCTGGGAGGAAGGGGCGTGGGGG + Intronic
1183978466 22:41526502-41526524 CCTGCAAGGCAGGTGCAGGGAGG + Exonic
1184111768 22:42399664-42399686 CCTGCTGGGAAGGTGAAGGCTGG + Intronic
1184153148 22:42649812-42649834 CCGGCGAGGAGGCTCCGGGCGGG - Intergenic
1184729834 22:46366102-46366124 AGTGCGGGGAAGGTGCGGGGGGG + Intronic
1185225207 22:49648147-49648169 CCAGGGAGGTAGGTGCAGGCTGG - Intronic
1185313905 22:50170647-50170669 CCGGCGAGGGGGGCGCGGGCGGG - Intergenic
950117063 3:10457952-10457974 CCTGGTAGGAAGGTAAGGGCTGG - Intronic
952974781 3:38684449-38684471 CCTGAGATGAAGGTGGGAGCAGG + Intergenic
953526072 3:43691073-43691095 CCCGCGCGGAGGGTGCGCGCCGG - Intronic
953636721 3:44670730-44670752 CCTGTGAGGAAGGAGCAGGATGG + Intergenic
953899943 3:46834165-46834187 CCTGCGAGGGACGAGGGGGCAGG + Intergenic
954295740 3:49673848-49673870 CCTGCGAGGAATGTGGAGCCGGG - Intergenic
954390261 3:50264896-50264918 CCTGGGAGGAATGTGCAGGAGGG + Intergenic
954553288 3:51499730-51499752 CCGGCGAGGAGGGGGCGGGCCGG - Intronic
954848861 3:53583363-53583385 CCTGCCAGCAAGCTGAGGGCTGG + Intronic
956699666 3:71947910-71947932 CCAGCCAGGCAGGTGCGGGCTGG + Intergenic
961762759 3:129183765-129183787 CCGACGCGGAAGGTGAGGGCTGG - Exonic
967807513 3:193728837-193728859 CCTGGGATGAGGGTGCGGGATGG - Intergenic
967886443 3:194336782-194336804 CCTGGGAGAAAGGCTCGGGCAGG + Intergenic
967922114 3:194621307-194621329 TCTGAGAGCAAGGTGCCGGCAGG - Intronic
968905278 4:3447972-3447994 CCTGCGGGGAAGGTGCTGCCGGG - Exonic
968963436 4:3757451-3757473 CCCGCGTGGAAAGTGTGGGCAGG - Intergenic
969280774 4:6169497-6169519 TCTGAGATGAAGGTGTGGGCAGG - Intronic
969538432 4:7770796-7770818 CCTGCGTGGAGGGTGGTGGCAGG - Intronic
969940439 4:10726012-10726034 GCTGTGAGCAAGGTGTGGGCAGG + Intergenic
970824327 4:20253788-20253810 CCGGCGAGGAAGGAGGCGGCGGG + Exonic
971824519 4:31604060-31604082 CATGGGAGAAAGGTGAGGGCTGG + Intergenic
973885646 4:55318305-55318327 CCTGAGAGCAAGGTGCTGGCTGG + Intergenic
975394318 4:73857213-73857235 CATGGGAGGAAGATGTGGGCTGG - Intergenic
975475711 4:74821165-74821187 CCTGGGAAGAAGGTGAGAGCAGG - Intergenic
976675507 4:87697929-87697951 CCTGGGTGGAAGGTGGGGGTGGG - Intergenic
978174036 4:105708432-105708454 CCTCCGAGGGAGTTGCGGGCCGG - Intronic
982173492 4:152683655-152683677 CCAGCTAGGAAGGTGCAGGGAGG + Intergenic
984585598 4:181560755-181560777 CCAGCCAGGAAGGTCCGGGAAGG + Intergenic
984734430 4:183097791-183097813 CCTGCGAGGAAGTCGCGTGAAGG - Intergenic
984887348 4:184461881-184461903 CCTGCGAGGAAGGTCCCTGTAGG - Intronic
986210943 5:5671768-5671790 CCTGGGAGGAGGGTGGGGGCAGG - Intergenic
987507542 5:18793110-18793132 TGTGAGAGGAAGATGCGGGCAGG - Intergenic
989774086 5:45181982-45182004 CCTGGTGGGAAGGTGGGGGCTGG - Intergenic
995750905 5:115452299-115452321 GGTGCCTGGAAGGTGCGGGCAGG - Intergenic
996457251 5:123698965-123698987 CCTGTCAGGGAGGTGAGGGCAGG - Intergenic
997582632 5:135027353-135027375 CCTGCCAGGAGCGTTCGGGCAGG - Intergenic
997815218 5:137010417-137010439 CTTGCGAGGAAGGGAGGGGCAGG + Intronic
999768006 5:154755481-154755503 CTTGCGAGGAACGGGCGGGGGGG + Intronic
1001191551 5:169637203-169637225 CCGGCGAGGGAGGAGAGGGCGGG + Intergenic
1001603462 5:172944013-172944035 CCTGGGAGGAAGTTGCTGGTGGG + Intronic
1001960689 5:175878886-175878908 CCTACGAGGAAGGGGTGGGAAGG - Exonic
1002924018 6:1594627-1594649 CCTGCGAGGTGGGTCCCGGCTGG - Intergenic
1003179958 6:3782881-3782903 CCTGGGAGGAGGGTGGGGGTGGG - Intergenic
1004188899 6:13447175-13447197 TCTGAGATGAAGGTGTGGGCAGG + Intronic
1005459504 6:26055176-26055198 CCTGGGAGGAGAGTGCGTGCAGG - Intergenic
1005498164 6:26406872-26406894 ACTGCTAGGAAGGTGTGGGCAGG + Intronic
1007211674 6:40197450-40197472 ACTGTGAGGGAGGTGCTGGCAGG + Intergenic
1007247882 6:40475419-40475441 CAGGCGAGGAAGGTGTGGGGAGG + Intronic
1007363070 6:41372485-41372507 GCTCTGGGGAAGGTGCGGGCTGG - Intergenic
1007422543 6:41728423-41728445 CTTGCCAGGACGGTGCTGGCTGG - Intronic
1007581544 6:42963107-42963129 ATTGCGAGCATGGTGCGGGCAGG + Exonic
1013225212 6:108115789-108115811 CCTGCGAGAAAGGTGTGACCCGG + Intronic
1013366380 6:109441012-109441034 CCTGCGAAGAAGGAACGGTCTGG + Exonic
1017511869 6:155121851-155121873 CCTGCGAGGAGGGCGGGGGCTGG - Intronic
1017787458 6:157768323-157768345 CCTGGGAGGAGAGTGAGGGCCGG - Intronic
1018017871 6:159727776-159727798 CCGGCGGGTAAGGGGCGGGCAGG + Intronic
1018248998 6:161849530-161849552 AGTGTGAGGAAGGTGGGGGCAGG - Intronic
1019339141 7:500252-500274 TCTGCGAGGCAGGAGCGGACGGG + Intronic
1019524147 7:1473207-1473229 CCTGGGAGGAAGACGCTGGCAGG + Intronic
1020096911 7:5374481-5374503 CCTGCTGGGAAGGGGCCGGCAGG + Exonic
1023837123 7:44074647-44074669 CCTCCGAGGAAGGTGAGGCTAGG + Intronic
1023952435 7:44857295-44857317 CCTCTGAGGAAGGAGCCGGCTGG - Intergenic
1024062017 7:45704936-45704958 GCAGGGAGGAAGGTGGGGGCTGG - Intronic
1024993702 7:55255139-55255161 CCTGCGGGGCCGGTGCGTGCGGG - Intronic
1030427719 7:109400660-109400682 CCTGCAATCAAGGTGTGGGCTGG - Intergenic
1031040554 7:116834504-116834526 CCTGGGGTGAAGGTGCAGGCAGG + Intronic
1032078222 7:128846152-128846174 CCTACGAGGAGGGTGAGGGCCGG + Exonic
1033558069 7:142506375-142506397 CCTGGGAGGAGGGTGTTGGCTGG + Intergenic
1034142734 7:148837345-148837367 ACAGCGAGGAAGGTGCAGGAAGG + Intronic
1034468864 7:151245424-151245446 CCGGCGAGGAGGGGGCGTGCAGG - Intronic
1035125902 7:156607650-156607672 CCTCCGTGGCAGGTGCGGGGCGG - Intergenic
1035292869 7:157850723-157850745 CCTGCAGGGCAGGTGCAGGCTGG + Intronic
1035626205 8:1072549-1072571 CCTGGCAGGGAGGTGCGGCCTGG + Intergenic
1036211117 8:6842028-6842050 CATGCGAGGAGGGCGAGGGCTGG + Intergenic
1037550101 8:19962436-19962458 CCTGGGTTGAAGGTCCGGGCTGG - Intronic
1037788850 8:21919500-21919522 GGTGGGAGGAAGGAGCGGGCCGG - Intergenic
1037878601 8:22561733-22561755 CCTGGGTGGATGGTGGGGGCAGG - Intronic
1039466879 8:37790801-37790823 CTTGTGAGGGAGGTGGGGGCAGG + Intronic
1039903257 8:41767647-41767669 CCTGCGAAGGGGGTGCGCGCGGG + Intronic
1040599567 8:48870401-48870423 CCTGCGCGGGAGGGGCGGCCGGG + Intergenic
1040828379 8:51648534-51648556 CCTGAAACGAAGGTGTGGGCAGG - Intronic
1045653944 8:104367694-104367716 CCAGCGAGGAACCTGCGGTCCGG + Intronic
1047247275 8:123156794-123156816 CCGGCGAGGGAGCTGCGGGATGG - Intergenic
1048993232 8:139773608-139773630 GCTGTGGGGAAGGTGCAGGCTGG - Intronic
1049154814 8:141059994-141060016 TCTGAGATGAAGGTGCCGGCAGG + Intergenic
1049243134 8:141548796-141548818 CCTGTGAGGACAGTGCTGGCGGG - Intergenic
1049285186 8:141770962-141770984 ACTGCGGGGAGGGTGGGGGCAGG - Intergenic
1049693854 8:143974204-143974226 CCGGCGCGGAAGGTGCTGGCTGG + Intronic
1049720092 8:144111703-144111725 GCTGCCAGGAGGGTGGGGGCTGG - Exonic
1049789666 8:144466831-144466853 CCTGGCCGGTAGGTGCGGGCTGG + Exonic
1049791554 8:144474801-144474823 CCTGCTAGGAGGGTCCGGGGAGG - Exonic
1051352902 9:16215164-16215186 CCTGGGAGCAAGGGCCGGGCAGG - Intronic
1056781878 9:89556461-89556483 CCGGCGTGGAAGGTACTGGCTGG + Intergenic
1057888864 9:98852915-98852937 CCAGGGAGGCAGGTGGGGGCAGG - Intergenic
1057954373 9:99396080-99396102 GCTGAGGGGAAGGTGCAGGCTGG - Intergenic
1059245325 9:112844833-112844855 CCTGTGGGGAAGGGGCGGGCAGG - Intronic
1060543044 9:124444357-124444379 CCTGGGAGGAAGGTGGGGTAGGG + Intergenic
1060664914 9:125427130-125427152 CCTGCGTGGGGCGTGCGGGCGGG + Intergenic
1061043738 9:128153484-128153506 CCTTCGAGGAAGGGGAGGGGCGG + Intergenic
1061661046 9:132130547-132130569 CCAGAGATGAAGGTGTGGGCAGG - Intergenic
1061893189 9:133633456-133633478 CCTCTGAGGAGGGTGAGGGCAGG + Intergenic
1061958087 9:133973981-133974003 CAGGCCAGGAAGGTGGGGGCTGG + Intronic
1062035403 9:134380500-134380522 CCTGGGAGGAGGCTGCAGGCTGG + Intronic
1062060299 9:134491913-134491935 CCTGAGAGGCAGGTGGAGGCAGG - Intergenic
1062083145 9:134635017-134635039 CATCCGACGAAGGTGAGGGCAGG - Intergenic
1062208170 9:135348638-135348660 CCTGCCAGGGAGGGGGGGGCGGG - Intergenic
1062319005 9:135981373-135981395 CCTGCGAGCAGGGTGGGGGAGGG - Intergenic
1062428263 9:136515970-136515992 TGTGCACGGAAGGTGCGGGCTGG - Exonic
1062696118 9:137877382-137877404 CCGGCGGGGACGGGGCGGGCCGG + Intergenic
1185550040 X:975657-975679 TCTGAGATGAAGGTGTGGGCAGG + Intergenic
1187700869 X:21963322-21963344 CCTGCCAGGAAGGTGTCTGCAGG - Intronic
1188581915 X:31724221-31724243 CCTGAGAGGAAGATACTGGCTGG + Intronic
1189362900 X:40366879-40366901 GCTGGGAGGAAAGTGCTGGCAGG + Intergenic
1192248897 X:69394861-69394883 CCTGCTAGGAAGATGTGTGCTGG + Intergenic
1192584143 X:72306731-72306753 CCGGCGCCGAAGCTGCGGGCGGG - Intronic
1200058058 X:153471771-153471793 CCTGGGAGGAGGGAGCGGGCAGG + Intronic
1200115893 X:153769593-153769615 CCTGAGAGGCAGGTGCGGCTGGG - Intronic
1200214079 X:154359721-154359743 CTTACGAGGAGGGTGCGTGCTGG - Exonic
1201627914 Y:16035447-16035469 TCTGAGATGAAGGTGTGGGCAGG + Intergenic