ID: 1083881114

View in Genome Browser
Species Human (GRCh38)
Location 11:65548711-65548733
Sequence CAGGCTGCATGGCAGGAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 896
Summary {0: 1, 1: 0, 2: 4, 3: 77, 4: 814}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083881114_1083881125 26 Left 1083881114 11:65548711-65548733 CCTCACTCCTGCCATGCAGCCTG 0: 1
1: 0
2: 4
3: 77
4: 814
Right 1083881125 11:65548760-65548782 CCCAAACTCACCTGGCCAGTGGG 0: 1
1: 0
2: 5
3: 25
4: 239
1083881114_1083881121 18 Left 1083881114 11:65548711-65548733 CCTCACTCCTGCCATGCAGCCTG 0: 1
1: 0
2: 4
3: 77
4: 814
Right 1083881121 11:65548752-65548774 TGCTCTGCCCCAAACTCACCTGG 0: 1
1: 0
2: 1
3: 21
4: 249
1083881114_1083881123 25 Left 1083881114 11:65548711-65548733 CCTCACTCCTGCCATGCAGCCTG 0: 1
1: 0
2: 4
3: 77
4: 814
Right 1083881123 11:65548759-65548781 CCCCAAACTCACCTGGCCAGTGG 0: 1
1: 0
2: 3
3: 28
4: 356

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083881114 Original CRISPR CAGGCTGCATGGCAGGAGTG AGG (reversed) Intronic
900279827 1:1859595-1859617 GAGACTGATTGGCAGGAGTGGGG + Intronic
900507745 1:3038208-3038230 CAGGCTGCTGGGCAGGAAGGGGG - Intergenic
900623518 1:3598056-3598078 CAGGCTGCAGGGCAGGCCCGGGG - Intronic
900836268 1:5006790-5006812 CAGGCCGCATGGCAGGAGGTAGG - Intergenic
900900403 1:5512100-5512122 CTGCCTGAATGGCAGGAGTGGGG - Intergenic
900994883 1:6115572-6115594 GAGGCTACATGGCAGGAATGTGG + Intronic
901722825 1:11213880-11213902 AAGCCTGCATGGGAGAAGTGAGG - Intronic
903227322 1:21901343-21901365 GAGGGTGCATGGTAGGGGTGAGG + Intronic
903579539 1:24360399-24360421 CAGGCTGGAGTGCAGTAGTGCGG - Intronic
903648131 1:24906866-24906888 CAGGCTGTGGGGCAGGGGTGGGG + Intronic
903743875 1:25573869-25573891 CAGGATGCATGCCAGGCGTCTGG + Intergenic
904179463 1:28655691-28655713 AAGGCAGGGTGGCAGGAGTGGGG + Intergenic
905140758 1:35842208-35842230 CAGGCTGCACAGCAGGTGAGTGG + Intronic
905233589 1:36530422-36530444 CTGGCGGCAGGGCAGGGGTGTGG - Intergenic
905277993 1:36831389-36831411 CCGTATGCATGGCAGGAGTGAGG - Intronic
905714351 1:40135267-40135289 CAGGCTGCAGTGCAGTGGTGTGG + Intergenic
905734153 1:40314796-40314818 CAGACTGCAGGGCAGGAGAACGG + Intronic
906213404 1:44024740-44024762 CTGGCTGCCTGGCTGGGGTGAGG - Intronic
906605392 1:47166333-47166355 CAAGCTGCAAGGCAGCAGTGAGG + Intergenic
906613515 1:47219746-47219768 CAGGCAGCATGGCAGGATGGAGG + Exonic
907012212 1:50974195-50974217 CAGGCTCTATGGGAGGAATGAGG + Exonic
908167248 1:61470646-61470668 CAGGCTGTGTGGAAGCAGTGGGG + Intergenic
908295029 1:62705113-62705135 CAAACTGCAAGGCAGCAGTGAGG - Intergenic
908691027 1:66780540-66780562 CAAACTGCAAGGCAGCAGTGAGG + Intergenic
908719733 1:67112654-67112676 CAGGCTGGAATGCAGCAGTGTGG - Intronic
910251102 1:85200603-85200625 CAGGATGGACGGCTGGAGTGGGG - Exonic
910398415 1:86814195-86814217 CAAACTGCAAGGCAGCAGTGAGG + Intergenic
910398756 1:86817559-86817581 CAAACTGCAAGGCAGCAGTGAGG - Intergenic
910709759 1:90167251-90167273 CAAACTGCAAGGCAGCAGTGAGG + Intergenic
910794054 1:91080290-91080312 CAGGCTGGAGTGCAGTAGTGCGG - Intergenic
911084897 1:93968194-93968216 CAGTCTGCCAGGCAGAAGTGTGG - Intergenic
911128993 1:94370018-94370040 CAGCCTGCAAGGCAGCAGTCTGG - Intergenic
911577505 1:99596074-99596096 CAGGCTGGAGGGCAGTAGAGCGG + Intergenic
911691085 1:100835542-100835564 CAGGAAGCATGGCTGGGGTGGGG - Intergenic
912251999 1:108021108-108021130 AAGGCAGAGTGGCAGGAGTGGGG + Intergenic
912451448 1:109770078-109770100 CTGGGCGCATGGCAGGAGGGCGG + Intronic
912612929 1:111066839-111066861 CAGGATGTATGACAGGGGTGTGG - Intergenic
913122778 1:115756908-115756930 CAGGCTCCCCGGCTGGAGTGCGG - Intronic
913183218 1:116342823-116342845 CAGGCTGGAGTGCAGTAGTGTGG - Intergenic
913467401 1:119156990-119157012 CAAGCTGCAAGGCGGCAGTGAGG - Intergenic
913526456 1:119698048-119698070 CAGGCTACAGGGCAGGAATGAGG - Intronic
914752581 1:150545632-150545654 GAAGCTGCAGGACAGGAGTGTGG - Intergenic
914797373 1:150931676-150931698 CAGGCTGGAGTGCAGTAGTGTGG - Intronic
914825738 1:151137122-151137144 CCAGCTGCATGCAAGGAGTGTGG + Intronic
914873966 1:151498677-151498699 GAGGCTGCCTGGGAAGAGTGTGG + Intergenic
915201892 1:154236241-154236263 CAGGCTGGAGTGCAGTAGTGCGG + Intronic
915298981 1:154941445-154941467 CAGGTTGCAGGGTAGGGGTGTGG - Intergenic
915314650 1:155021501-155021523 CAGAGGGCATGGCAGGAGAGTGG - Intronic
915814648 1:158953145-158953167 CAAACTGCAAGGCAGCAGTGAGG + Intronic
916209398 1:162347769-162347791 CAGGGAACATGGGAGGAGTGAGG - Intronic
916384325 1:164250095-164250117 CAGGATGTATGACAGGGGTGTGG - Intergenic
916692160 1:167200807-167200829 CAGGCTGGAGTGCAGTAGTGCGG - Intergenic
917342964 1:173999047-173999069 CAGGCTGCAGTGCAGTGGTGTGG - Intronic
917550295 1:176019814-176019836 CAGGCTGCAATGCAGTGGTGTGG - Intronic
918311506 1:183288637-183288659 CAGGCTCCATGACAGAAGAGAGG - Intronic
918398097 1:184136328-184136350 CAAACTGCAAGGCAGCAGTGAGG - Intergenic
918583807 1:186163130-186163152 CAAACTGCAAGGCAGCAGTGAGG - Intronic
919342293 1:196327693-196327715 CAGCCTGGGCGGCAGGAGTGAGG - Intronic
919811075 1:201409125-201409147 CAGGCTGGAGGGAAGAAGTGGGG + Exonic
919817582 1:201451184-201451206 CTGGCTGCATGACGGGAGTCTGG - Intergenic
920335386 1:205241792-205241814 CAGCCTGCACAGCAGCAGTGGGG + Exonic
920441656 1:205984904-205984926 CATGCTGCAGGGAAGGAGAGGGG - Intronic
920632202 1:207663362-207663384 CAAACTGCAAGGCAGCAGTGAGG - Intronic
920698941 1:208203299-208203321 GAGCCTGCATGGAAGGGGTGGGG - Intronic
921024745 1:211267634-211267656 CAGGCTGGAGTGCAGTAGTGTGG + Intronic
921135377 1:212255027-212255049 AAAACAGCATGGCAGGAGTGTGG + Intergenic
921993091 1:221388779-221388801 CAAACTGCAAGGCAGCAGTGAGG - Intergenic
922295132 1:224243414-224243436 CAGGCTGGAGGGCAGTGGTGCGG - Intronic
922383862 1:225061232-225061254 CAAACTGCAAGGCAGCAGTGAGG - Intronic
922533004 1:226358634-226358656 GAGGCTGAATGGCAGAAGTGAGG + Intergenic
922781018 1:228252301-228252323 AAGGCAGGGTGGCAGGAGTGGGG + Intronic
923041970 1:230325954-230325976 CAGCCTAGATGGGAGGAGTGAGG - Intronic
924197610 1:241624327-241624349 CAGTCTGCATGGCTGGAGCATGG - Intronic
924285450 1:242481482-242481504 CAAACTGCAAGGCAGCAGTGAGG + Intronic
1063067845 10:2626907-2626929 CAGGCTTCTTGGCAGGATGGTGG - Intergenic
1063554664 10:7066682-7066704 CAGGCTGCATGACCTCAGTGAGG + Intergenic
1064119922 10:12609720-12609742 CAGGCTGCACAGCAAGAGGGGGG - Intronic
1064190709 10:13203296-13203318 CTGGCTGCATGGAGGAAGTGAGG - Intronic
1064229787 10:13520047-13520069 CATGCTGCCTTGGAGGAGTGAGG - Intronic
1064262022 10:13793611-13793633 CAGGTGCCATGGCTGGAGTGGGG + Intronic
1064330273 10:14387388-14387410 CAGGCTGGAGTGCTGGAGTGCGG - Intronic
1064480618 10:15736870-15736892 CAGGCTGCAGTGCAGTGGTGCGG - Intergenic
1064633595 10:17341854-17341876 CAGGCTGGAGTGCAGTAGTGCGG - Intronic
1064934317 10:20663023-20663045 CAGGCTGGAGTGCAGTAGTGTGG + Intergenic
1065021771 10:21507742-21507764 CAGCCTCCATTGCAGAAGTGTGG + Intergenic
1065772119 10:29087301-29087323 CAGGCTGGAATGCAGTAGTGCGG - Intergenic
1065840999 10:29700984-29701006 CAGGCGGCAGGGCTGGAGCGTGG - Intronic
1065866815 10:29921552-29921574 TGGGCTGCATGGCAGGTGAGTGG + Intergenic
1066158624 10:32704727-32704749 CAAACTGCAAGGCAGCAGTGAGG - Intronic
1066167000 10:32798950-32798972 AAGGCAGGGTGGCAGGAGTGGGG + Intronic
1066169460 10:32826598-32826620 AAGGCAGGGTGGCAGGAGTGGGG - Intronic
1066274295 10:33853464-33853486 CAAACTGCAAGGCAGCAGTGAGG - Intergenic
1066595964 10:37050223-37050245 CAAACTGCAAGGCAGCAGTGAGG - Intergenic
1066953680 10:42145714-42145736 CAAACTGCAAGGCAGCAGTGAGG - Intergenic
1067159605 10:43813213-43813235 CAGCATGGATGGCTGGAGTGTGG + Intergenic
1067235622 10:44446177-44446199 CAGGCTGCACGGCAGGAGGTGGG - Intergenic
1067955676 10:50788157-50788179 CAAACTGCAAGGCAGCAGTGAGG - Intronic
1068759631 10:60693293-60693315 CAAACTGCAAGGCAGCAGTGAGG + Intronic
1069602503 10:69717035-69717057 CAGGCCGAATGGCAGGAGGAGGG - Intergenic
1069839282 10:71329041-71329063 CAGGCTGCATGGCAGGGACTTGG - Intronic
1069906794 10:71736659-71736681 GAGGCTGCAAGGCAGGGGTGAGG - Intronic
1069909136 10:71749244-71749266 GGGCCTGCATGGCAGGAGTGGGG - Exonic
1070001804 10:72384036-72384058 CAGGCTGGAGTGCAGTAGTGAGG + Intronic
1070129574 10:73647374-73647396 AAGGCTGCAGGGCAGGGGTGGGG - Exonic
1070692315 10:78536419-78536441 CAGGGTGCATGACAGGGGTCGGG - Intergenic
1070745703 10:78932435-78932457 CAGGCTGTTTGGAAGGAGGGAGG - Intergenic
1070855192 10:79603049-79603071 CAGGATGCATGACAGGGGTGTGG + Intergenic
1070890793 10:79941234-79941256 CAGGCTGGAAGGCAGGAGCATGG - Intronic
1071502392 10:86213105-86213127 CAGGCTCCAAGGCAGGAGGTGGG - Intronic
1072633515 10:97163346-97163368 CAGGGTGCAGGCCAGGAGGGCGG - Intronic
1073185401 10:101612637-101612659 GAGGCCTCATGGCAGGGGTGAGG - Intronic
1073234315 10:102000723-102000745 CAGGCTGGAGTGCAGTAGTGTGG - Intronic
1073773507 10:106761060-106761082 CAGGCTGCAGTGCAGTGGTGCGG - Intronic
1074884783 10:117685156-117685178 CAGCCTGGCAGGCAGGAGTGAGG - Intergenic
1075037818 10:119083807-119083829 CAGGCTGCAGTGCAGTGGTGTGG - Intergenic
1075271263 10:121053826-121053848 CAGGCTGAAGGGCGGGAGTAGGG - Intergenic
1075313974 10:121437552-121437574 CTGGCTGCAGGGCCGGAGAGAGG + Intergenic
1075400602 10:122158947-122158969 CACCCTGCATGGCTGGAGAGTGG + Intronic
1075751370 10:124774328-124774350 CAGGCTGGAGGGCTGGAGTGCGG - Intronic
1075770608 10:124931413-124931435 CAGGCTGGAGTGCAGTAGTGTGG + Intergenic
1075909671 10:126113220-126113242 CAGGCCGTATGGCTGGAGTCTGG + Intronic
1076655599 10:132021622-132021644 CAGGCTGCACGGCTGCTGTGTGG + Intergenic
1077010691 11:377884-377906 CAGGCTGGTGGGCAGGAGTGGGG + Intronic
1077327326 11:1969410-1969432 CAGGCTGCCCGGAAGGAGGGTGG - Intronic
1077344081 11:2038433-2038455 AAGGCTGCACGGCAGGAGGTGGG + Intergenic
1077643133 11:3900157-3900179 CAAACTGCAAGGCAGCAGTGAGG - Intronic
1078051050 11:7965120-7965142 CAGGCTGCATGGGAAGACTCAGG + Intronic
1078930808 11:15910869-15910891 GAGGGACCATGGCAGGAGTGAGG - Intergenic
1079113218 11:17619240-17619262 CAGCCTGGGTGACAGGAGTGAGG + Intronic
1079516183 11:21272325-21272347 CAAACTGCAAGGCAGCAGTGAGG + Intronic
1080076625 11:28157770-28157792 AAGGCTGGGTGGCAGGAGTGGGG - Intronic
1080093639 11:28378254-28378276 CAAACTGCAAGGCAGCAGTGAGG - Intergenic
1080178520 11:29394994-29395016 CCAGCTCCATGGAAGGAGTGAGG - Intergenic
1081502815 11:43682826-43682848 CAGGCTGGAGGGCAGTGGTGTGG + Intronic
1081520003 11:43872469-43872491 CAGGCTGGCAGGCTGGAGTGTGG - Intergenic
1081683002 11:45021963-45021985 CAGGGGGCAGGGCAGGAGGGAGG + Intergenic
1081797053 11:45827829-45827851 CAGGCATTATGGCAGGAGTTTGG - Intergenic
1082174489 11:49045909-49045931 CAAACTGCAAGGCAGCAGTGAGG - Intergenic
1082268990 11:50149250-50149272 CAAACTGCAAGGCAGCAGTGAGG + Intergenic
1082691719 11:56312894-56312916 CCAGCTGCCTGGCAGGAGTTTGG + Intergenic
1082705317 11:56487592-56487614 CAGGCTGGAGGGCAACAGTGCGG + Intergenic
1083006286 11:59349891-59349913 CAAACTGCAAGGCAGCAGTGAGG - Intergenic
1083498306 11:63078680-63078702 CAAACTGCAAGGCAGCAGTGAGG - Intergenic
1083530704 11:63419128-63419150 CAAACTGCAAGGCAGCAGTGAGG + Intergenic
1083881114 11:65548711-65548733 CAGGCTGCATGGCAGGAGTGAGG - Intronic
1084268656 11:68017654-68017676 CAGGCTTCTAAGCAGGAGTGAGG - Intronic
1084400285 11:68939370-68939392 CAGGCTGCCTGGCGGGAGAGCGG - Intronic
1084900646 11:72307631-72307653 CTGGCTAAATGGCAGGACTGTGG - Intronic
1084972111 11:72777666-72777688 CAGGCTGGAGGCCAGGAGGGAGG + Intronic
1085294522 11:75423662-75423684 GAGGCTTCAAGGCAGGAGAGCGG - Intronic
1085321928 11:75580230-75580252 AAGGCTGCAGGGTTGGAGTGGGG + Intergenic
1085730072 11:78990033-78990055 CAGCCTGGGTGACAGGAGTGAGG + Intronic
1086586969 11:88463562-88463584 CAAACTGCAAGGCAGCAGTGAGG - Intergenic
1086691288 11:89790179-89790201 CAAACTGCAAGGCAGCAGTGAGG + Intergenic
1086714517 11:90049476-90049498 CAAACTGCAAGGCAGCAGTGAGG - Intergenic
1086719118 11:90098656-90098678 CTGCATGCAGGGCAGGAGTGTGG + Intergenic
1086757920 11:90588057-90588079 CAGGCTGCCAGGCTGGAGTGAGG - Intergenic
1086924860 11:92629464-92629486 CAGGCTGCTAGGCTGGAGTATGG + Intronic
1087312010 11:96555998-96556020 CAAACTGCAAGGCAGCAGTGAGG + Intergenic
1087722652 11:101684126-101684148 CAAACTGCAAGGCAGCAGTGAGG - Intronic
1088191629 11:107234236-107234258 AAGGCAGGGTGGCAGGAGTGGGG + Intergenic
1088414305 11:109571787-109571809 CAAACTGCAAGGCAGCAGTGAGG + Intergenic
1088875594 11:113933653-113933675 AGGGCTGCATCGGAGGAGTGTGG - Intronic
1088920958 11:114259496-114259518 CAGGATGCGGGGCAGGAGAGGGG + Intronic
1089101453 11:115966005-115966027 CATGCTGCATGGCAGTAGACAGG - Intergenic
1089170819 11:116510355-116510377 CAGGCAGTAGGGCAAGAGTGTGG - Intergenic
1090458151 11:126867220-126867242 CAGGCTGTGTGATAGGAGTGTGG - Intronic
1090868969 11:130726236-130726258 CTGGCTGCAGGGCAGGATGGGGG - Intergenic
1091014737 11:132039711-132039733 CAGGCACCAAGGCAGGTGTGTGG + Intronic
1091371220 11:135060266-135060288 CTTGTTGCATGGCAAGAGTGAGG + Intergenic
1202810308 11_KI270721v1_random:24590-24612 CAGGCTGCCCGGAAGGAGGGTGG - Intergenic
1202827067 11_KI270721v1_random:93622-93644 AAGGCTGCACGGCAGGAGGTGGG + Intergenic
1091582523 12:1798009-1798031 CAGGCTCAATGGGTGGAGTGTGG - Intronic
1092126840 12:6080532-6080554 TAGGCTGCAGGGCAGGAGGGAGG + Intronic
1092344268 12:7702622-7702644 CAGGCTGGAGTGCAGTAGTGCGG + Intergenic
1092523342 12:9294690-9294712 CTGGCTGCCTGGCTGGAGAGAGG - Intergenic
1092543952 12:9437209-9437231 CTGGCTGCCTGGCTGGAGAGAGG + Intergenic
1092713584 12:11364748-11364770 CAGGCTGCAGTGCAGTGGTGCGG + Intronic
1092725933 12:11485655-11485677 CAGGCTGCATAGCGGGAGGTGGG - Intronic
1093404260 12:18785620-18785642 CAAACTGCAAGGCAGCAGTGAGG + Intergenic
1094271040 12:28615011-28615033 CAGGTTGCATGACAGAAATGAGG - Intergenic
1094333582 12:29323170-29323192 CAAACTGCAAGGCAGCAGTGAGG + Intronic
1094508995 12:31084841-31084863 CTGGCTGCCTGGCTGGAGAGAGG - Intronic
1094672812 12:32587425-32587447 CAGGCTGCCAGGCTGGAGTGCGG + Intronic
1094728496 12:33147494-33147516 CCAGCTGCAAGGCAGCAGTGAGG - Intergenic
1094803445 12:34065383-34065405 CAAACTGCAAGGCAGCAGTGAGG + Intergenic
1094805199 12:34083649-34083671 CAAACTGCAAGGCAGCAGTGAGG + Intergenic
1094873546 12:34614230-34614252 CAAGCTGCAAGGCAGCAGTGAGG - Intergenic
1095065043 12:37762108-37762130 CAAACTGCAAGGCAGCAGTGAGG + Intergenic
1095191250 12:39260826-39260848 CAAACTGCAAGGCAGTAGTGAGG + Intergenic
1095231588 12:39746349-39746371 CAAACTGCAAGGCAGCAGTGAGG + Intronic
1095423418 12:42049213-42049235 CAAACTGCAAGGCAGCAGTGAGG - Intergenic
1095722948 12:45420972-45420994 CAGGCTGCATGGCACGATCTCGG - Intronic
1096276019 12:50208869-50208891 CAGGCTGGAATGCAGTAGTGCGG - Intronic
1096572927 12:52534021-52534043 CAGGCTGCAGGCCAGGAGCTGGG + Intergenic
1096824480 12:54264200-54264222 CAGGCTGCAGTGCAGTGGTGCGG + Intronic
1096868749 12:54580162-54580184 GAGGCAGCTTGGCAGGAGGGTGG + Exonic
1096931078 12:55210833-55210855 CAAACTGCAAGGCAGCAGTGAGG + Intergenic
1096996691 12:55842651-55842673 CAGGCTGAAGGTCAGGAGGGAGG + Intronic
1097018882 12:56006362-56006384 CAGACTGGAGTGCAGGAGTGCGG + Intronic
1097055065 12:56244181-56244203 CAGGGTGCAGGGCAGGAGTTGGG + Intronic
1098142352 12:67463011-67463033 CTGGATGCAGGGCAGGTGTGTGG + Intergenic
1098463947 12:70765428-70765450 CAAACTGCAAGGCAGCAGTGAGG + Intronic
1098831878 12:75373774-75373796 AAGGCAGGATGGCAGGAGTGGGG + Intronic
1099375677 12:81894212-81894234 AAGGCAGGGTGGCAGGAGTGGGG - Intergenic
1099677863 12:85785822-85785844 CAAACTGCAAGGCAGCAGTGAGG + Intergenic
1099810418 12:87575015-87575037 CAGGATGAATGGCAAGAGAGAGG - Intergenic
1099882118 12:88479858-88479880 CAGGCTGCAGTGCAGTGGTGTGG + Intergenic
1100474362 12:94922049-94922071 AATCCTGCATGGCAGGGGTGAGG - Intronic
1100926889 12:99558657-99558679 CAGGCTGCACTGCAAGTGTGTGG + Intronic
1101446296 12:104739003-104739025 CAGCCTGCTGGGCAGGGGTGAGG + Intronic
1102114991 12:110396141-110396163 CAGGCTGCACAGCAGGAGGTGGG - Intronic
1102243994 12:111343424-111343446 CAGGAAGCTTGGCAGGGGTGTGG - Intronic
1102348595 12:112175521-112175543 CAGTCTCCAAGTCAGGAGTGTGG + Intronic
1102437252 12:112934399-112934421 CAGGCTGGAGTGCAGCAGTGTGG - Intergenic
1102512048 12:113422423-113422445 CAGGCTGGAGGGCAGGAGCTGGG + Exonic
1102554912 12:113720561-113720583 GAGGCTGCAGGGGAGGACTGGGG - Intergenic
1102884200 12:116509013-116509035 CAGGCTTCCTGGAAGGAGGGAGG - Intergenic
1103004505 12:117409967-117409989 CAGGCTGGAAGGCAGGGGTAGGG - Intronic
1103217009 12:119209309-119209331 CAGGCTGAAGGGCAGTGGTGCGG + Intronic
1103437383 12:120937344-120937366 CAGGCTGCTAGGCAGGGGAGTGG - Intergenic
1104007776 12:124906117-124906139 CAGGTTGAATGGGAGGAGTTTGG - Intergenic
1104693875 12:130848597-130848619 CAGGCTGGAGTGCAGTAGTGCGG - Intergenic
1104763869 12:131314000-131314022 AAGGCGGCAGGGAAGGAGTGGGG + Intergenic
1104874808 12:132026471-132026493 GAGGCTGCAAGGCTGGAGTGGGG + Intronic
1104913535 12:132251951-132251973 CAGGCAGCCTGGCAGGCGGGGGG - Intronic
1104944547 12:132409766-132409788 CGGGGTCCCTGGCAGGAGTGTGG + Intergenic
1105420011 13:20243680-20243702 CAAACTGCAAGGCAGCAGTGAGG + Intergenic
1105471235 13:20696672-20696694 CAGGCTGCAGTGCAGTGGTGCGG - Intergenic
1105680492 13:22722427-22722449 CAGGCTGGATTGCAGTGGTGCGG + Intergenic
1105740402 13:23317148-23317170 CAGGCTGCAGTGCAGTGGTGTGG - Intronic
1105743025 13:23348630-23348652 CAGACTGCAGGGCAGGGGTGAGG + Intronic
1106646303 13:31638144-31638166 CAAACTGCAAGGCAGCAGTGTGG - Intergenic
1107462398 13:40616728-40616750 GAGGCTGCATGCAAGGGGTGTGG + Intronic
1107871239 13:44748648-44748670 CAGGAAGAATGGCAGGACTGAGG + Intergenic
1108394699 13:49980943-49980965 CAGGCTGCAGTGCAGTGGTGTGG + Intergenic
1108437130 13:50411561-50411583 AAGACTGCATGGCTGGTGTGAGG + Intronic
1110459865 13:75733349-75733371 CAAACTGCAAGGCAGCAGTGAGG - Intronic
1111044426 13:82796240-82796262 AAGACAGCATAGCAGGAGTGGGG - Intergenic
1111273543 13:85917503-85917525 CAAACTGCAAGGCAGCAGTGAGG - Intergenic
1112612564 13:100969917-100969939 CAAACTGCAAGGCAGCAGTGAGG - Intergenic
1113639845 13:111949481-111949503 CATGCAGCATGGCTGGAGGGTGG - Intergenic
1113672213 13:112182988-112183010 GAGCCTGCATGGCAGCCGTGCGG - Intergenic
1113922999 13:113924812-113924834 CAGGCTGCAGTGCAGTGGTGTGG + Intergenic
1113938155 13:114005925-114005947 CATCCAGCAGGGCAGGAGTGGGG - Intronic
1113938216 13:114006109-114006131 CATCCAGCAGGGCAGGAGTGGGG - Intronic
1113938250 13:114006219-114006241 CATCCGGCAGGGCAGGAGTGGGG - Intronic
1113938311 13:114006405-114006427 CATCCGGCAGGGCAGGAGTGGGG - Intronic
1113938371 13:114006591-114006613 CATCCGGCAGGGCAGGAGTGGGG - Intronic
1113938420 13:114006739-114006761 CATCCAGCAGGGCAGGAGTGGGG - Intronic
1113938454 13:114006849-114006871 CATCCGGCAGGGCAGGAGTGGGG - Intronic
1113938489 13:114006959-114006981 CATCCGGCAGGGCAGGAGTGGGG - Intronic
1113938524 13:114007071-114007093 CATCCGGCAGGGCAGGAGTGGGG - Intronic
1114132121 14:19803020-19803042 CAGGCTGGAGGGCAGTGGTGCGG + Intronic
1114736679 14:25049866-25049888 CAGGCTGCACGGTAGGACCGGGG - Exonic
1114749159 14:25183830-25183852 CAAGCTGCAAGGCAGCAGTGAGG + Intergenic
1115064758 14:29244452-29244474 CAGGCTGGAGTGCAGAAGTGTGG - Intergenic
1115130721 14:30049515-30049537 AAGGCAGGGTGGCAGGAGTGGGG - Intronic
1115169770 14:30491650-30491672 CAGGCTGGAATGCAGGGGTGTGG + Intergenic
1115412195 14:33088460-33088482 CGAACTGCAAGGCAGGAGTGAGG + Intronic
1115855368 14:37624664-37624686 CAGGCTGGAGTGCAGTAGTGTGG + Intronic
1116090026 14:40293375-40293397 CAGGGTGTGTGACAGGAGTGTGG + Intergenic
1116249080 14:42457883-42457905 AAGGCAGGATGGCAAGAGTGGGG - Intergenic
1117513164 14:56473004-56473026 CAGGCTGGATGGAAGGACTGTGG + Intergenic
1117656478 14:57961339-57961361 CAGGCTGCATTGCAGAGCTGAGG + Intronic
1117891550 14:60427196-60427218 CAAACTGCAAGGCAGCAGTGAGG - Intronic
1118053169 14:62051189-62051211 CAAACTGCAAGGCAGCAGTGAGG - Intronic
1118585412 14:67347954-67347976 CAGGCTGCAGTGCAGTGGTGTGG + Intronic
1119007096 14:70941849-70941871 CAAACTGCAAGGCAGCAGTGAGG - Intronic
1119195454 14:72714154-72714176 CAGGAGGCATGGCAGGAGGTGGG + Intronic
1119586954 14:75844952-75844974 GTGGCTAAATGGCAGGAGTGTGG - Intronic
1121214007 14:92233158-92233180 CAAACTGCAAGGCAGCAGTGAGG - Intergenic
1121312056 14:92940643-92940665 CAGGCTGCATCCCAGGGGTTAGG + Exonic
1121452098 14:94015432-94015454 CAGGAGGCCTGGCAAGAGTGTGG - Intergenic
1121510783 14:94511746-94511768 CAGGCAGCAAGCCAGGTGTGGGG + Intronic
1121733029 14:96199527-96199549 CAGGCTGGAGGGCAGTGGTGTGG - Intergenic
1121872330 14:97419571-97419593 CAGGCTGGAATGCAGTAGTGCGG + Intergenic
1122248162 14:100418822-100418844 CAGGTTGCCAGGCAGGGGTGTGG + Intronic
1122273413 14:100578463-100578485 AAGGATGCATGGGAGGACTGTGG - Intronic
1122504855 14:102226040-102226062 CTGGCTGCACCGCAGGTGTGGGG + Intronic
1122556972 14:102585738-102585760 CTGGCTGCAAGGCTGGAGTTAGG + Intergenic
1122642596 14:103169035-103169057 CAGGCTGCTGGGCTGGACTGTGG - Intergenic
1122740582 14:103869585-103869607 CAGCCTGTGTGGCAGGGGTGGGG + Intergenic
1122854752 14:104554713-104554735 CAGCCAGCATTGCAGGAGGGAGG - Intronic
1122897516 14:104767668-104767690 GAGGCAGCATCCCAGGAGTGGGG - Intronic
1123017906 14:105384334-105384356 GAGCCTGCATGCCAGGGGTGGGG - Exonic
1123575202 15:21658738-21658760 CAGGCTGGAGGGCAGTGGTGCGG + Intergenic
1123611819 15:22101227-22101249 CAGGCTGGAGGGCAGTGGTGCGG + Intergenic
1123861093 15:24467461-24467483 CAGGCTGGATTGCAGTGGTGCGG + Intergenic
1123949396 15:25256000-25256022 CAAACTGCAAGGCAGCAGTGAGG + Intergenic
1124435496 15:29645600-29645622 CAGGCTGCAGTGCAGTGGTGTGG + Intergenic
1124569996 15:30854324-30854346 CAAACTGCAAGGCAGCAGTGAGG - Intergenic
1125879013 15:43176101-43176123 CAAACTGCAAGGCAGCAGTGAGG + Intronic
1126065101 15:44820437-44820459 AAGGCAGCATGGCAGGAGCAAGG + Intergenic
1126094729 15:45080146-45080168 AAGGCAGCATGGCAGGAGCAAGG - Intergenic
1126270565 15:46812489-46812511 CAGGCCCTATGGAAGGAGTGAGG + Intergenic
1126283637 15:46986532-46986554 AAGGCAGGATGGCAGGAGTGGGG - Intergenic
1126338494 15:47613688-47613710 CAGGCTGGAGTGCTGGAGTGTGG + Intronic
1126478009 15:49087608-49087630 CAGGCTGGAGGGCAGTGGTGTGG + Intergenic
1126623212 15:50661018-50661040 CAGGCTGGAGTGCAGCAGTGTGG + Intronic
1126667368 15:51087380-51087402 CAGGCTCCAAATCAGGAGTGTGG + Intronic
1127963980 15:63910286-63910308 CAGGCTGTGTGGAGGGAGTGGGG + Intronic
1128281625 15:66399493-66399515 CAGGCTGCAGCGCAGTGGTGTGG + Intronic
1128677534 15:69622737-69622759 CAAACTGCAAGGCAGCAGTGAGG - Intergenic
1129086033 15:73093342-73093364 CAGCCTGCACTTCAGGAGTGGGG + Intronic
1129467737 15:75733313-75733335 GGGACTGCAGGGCAGGAGTGAGG - Intergenic
1129564632 15:76608742-76608764 CAAACTGCAAGGCAGCAGTGAGG - Intronic
1129719480 15:77870273-77870295 GGGACTGCAGGGCAGGAGTGAGG + Intergenic
1129901360 15:79153185-79153207 CAGGCTGGAGTGCAGTAGTGAGG - Intergenic
1129952054 15:79600644-79600666 CAGTCTGAAGGGCAGGCGTGGGG - Intergenic
1129979497 15:79854376-79854398 AAGGCTGCCTGACTGGAGTGTGG + Intronic
1130975151 15:88768231-88768253 GGGGCTGCATGGCAGGGGAGGGG + Intergenic
1132248353 15:100315165-100315187 CAGGCAGCGTGGCAGGTGGGCGG + Intronic
1132305703 15:100810613-100810635 AAGGCAGTATGGCAGGAGTGGGG + Intergenic
1132405749 15:101541143-101541165 CAGGGTGCATGGTGGGCGTGGGG - Intergenic
1202984070 15_KI270727v1_random:392982-393004 CAGGCTGGAGGGCAGTGGTGCGG + Intergenic
1132458797 16:39185-39207 CAGGCTCCCTAGCAGGACTGGGG - Intergenic
1132550386 16:551608-551630 CATGCCGCACGGCAGCAGTGAGG + Exonic
1132576132 16:665246-665268 GAGGCTGAAAGACAGGAGTGTGG - Intronic
1132576139 16:665296-665318 GAGGCTGAAAGACAGGAGTGTGG - Intronic
1132576146 16:665346-665368 GAGGCTGAAAGACAGGAGTGTGG - Intronic
1132834751 16:1947140-1947162 CAGGCTGCCTGGAGGCAGTGGGG - Intronic
1133232014 16:4371476-4371498 GAGGCAGGATGGCGGGAGTGGGG - Intronic
1133938945 16:10292425-10292447 CAAACTGCAAGGCAGCAGTGAGG - Intergenic
1133977553 16:10610567-10610589 CAGGCTGGATTGCAGTGGTGTGG + Intergenic
1134255144 16:12604209-12604231 CAAACTGCAAGGCAGCAGTGAGG + Intergenic
1134816945 16:17213661-17213683 CAGGCTGGAGTGCAGTAGTGAGG + Intronic
1134980948 16:18608451-18608473 CAAACTGCAAGGCAGCAGTGAGG + Intergenic
1135804934 16:25534270-25534292 CAGGCTGCACAGCAGGTGAGTGG - Intergenic
1135991342 16:27220615-27220637 CAGGATGCAGGACAGGAATGGGG - Exonic
1136098603 16:27976833-27976855 CAGGCTTCATGACGGGAGAGTGG - Intronic
1136219438 16:28818924-28818946 CAGGCTGGAGTGCAGCAGTGGGG - Intergenic
1136289691 16:29264187-29264209 GAGGGTGCATGGCAGGAGCAAGG - Intergenic
1136289717 16:29264280-29264302 GAGGGTGCATGGCAGGAGCACGG - Intergenic
1136634959 16:31514905-31514927 CAGGATGAGTGGCAGGGGTGAGG - Intergenic
1137360832 16:47813690-47813712 CAAACTGCAAGGCAGCAGTGAGG - Intergenic
1138418954 16:56886869-56886891 CAGCCTCCAGGGCAGGAGAGGGG + Intronic
1138544362 16:57706869-57706891 GAGGATGCATGGGAGGAGAGAGG - Intronic
1139250105 16:65487131-65487153 CAGGCTGAAGTGCTGGAGTGCGG - Intergenic
1139392551 16:66614178-66614200 CAGGCTGCACAGCAGGAGGTGGG - Intergenic
1140179099 16:72696097-72696119 CAAACTGCAAGGCAGCAGTGAGG - Intergenic
1140866748 16:79068764-79068786 CAGGCTGCAGGGCAGTGGTGAGG - Intronic
1141036590 16:80631410-80631432 CAGGGTACATGGCAGGAGAAGGG - Intronic
1141104858 16:81225159-81225181 ATGTCTGCATGGCAGGTGTGTGG - Intergenic
1141421737 16:83922144-83922166 CAGGCTCTGTGGCAGGGGTGGGG - Exonic
1141439775 16:84022468-84022490 CAGGCAGCAGGGCTGGGGTGTGG + Intronic
1141624289 16:85253262-85253284 CAGACTCCAGGGCAGGACTGGGG - Intergenic
1141702645 16:85649638-85649660 CAGGCTGCGCGCCAGGGGTGGGG - Intronic
1142752266 17:1996059-1996081 CAGGCTGCCTGGCAGGAGAAGGG + Intronic
1143109035 17:4543321-4543343 CAGGCTGCCTGGAAGCTGTGTGG + Intronic
1143193404 17:5057170-5057192 CAGGCTGGAGTGCAGTAGTGTGG + Intergenic
1143637731 17:8176064-8176086 CAGGCTGCAGGGCAGGCCTGGGG + Intronic
1143975454 17:10826103-10826125 CAGGCTTCATGGCAGGTGCCTGG - Intronic
1144096730 17:11906580-11906602 CAGGCTGGAGTGCAGTAGTGCGG - Intronic
1144624350 17:16837150-16837172 CAGGCTTCAGGGCAGGAGGAAGG + Intergenic
1144731813 17:17530611-17530633 CAGGCTGTGCGGCAGGAGGGAGG - Intronic
1144882077 17:18435570-18435592 CAGGCTTCAGGGCAGGAGGAAGG - Intergenic
1145150156 17:20508816-20508838 CAGGCTTCAGGGCAGGAGGAAGG + Intergenic
1146162087 17:30565461-30565483 CAGGCTTCAGGGCAGGAGGAAGG + Intergenic
1146297561 17:31661699-31661721 CAGGGGTCAAGGCAGGAGTGGGG + Intergenic
1147167676 17:38602101-38602123 TAGGCTGCTTGGCAGGAGTTGGG + Intronic
1147578486 17:41615871-41615893 CAGGCTTCAGGGCAGGAGGAAGG + Intronic
1147819702 17:43234414-43234436 GAGGCTCCAGGGCAGGAGCGCGG + Intergenic
1147951986 17:44112521-44112543 CTGGCTCCATGCCTGGAGTGGGG - Intronic
1148454108 17:47801686-47801708 CAGGCTGCATGGGAGGTGGTGGG + Intergenic
1148820732 17:50358173-50358195 GAGGCAGCTGGGCAGGAGTGTGG - Intronic
1149833275 17:59890286-59890308 CAGGCTGGAGGGCAGTGGTGCGG + Intronic
1150107189 17:62470896-62470918 CTGGCAGCATGCCAGGAATGGGG + Intronic
1151218005 17:72591188-72591210 CAGGCTGCAGGAGAGGGGTGAGG + Intergenic
1151386678 17:73759342-73759364 CAGGCTGAAGGGCAGGAGAGTGG - Intergenic
1151405852 17:73885622-73885644 AAGACTGCATAGCAGCAGTGGGG - Intergenic
1151975088 17:77480054-77480076 CAGGCTGCGTGGCCTGGGTGGGG + Intronic
1152097128 17:78278810-78278832 CAGGCTGGGTGGGAGGGGTGGGG - Intergenic
1152471631 17:80492767-80492789 CAGCCAGGAGGGCAGGAGTGAGG - Intergenic
1152522815 17:80869659-80869681 CAGACTGCGTGTCAGGAGGGAGG + Intronic
1152546094 17:81000744-81000766 CAGGCTGCCTGGCAGTCCTGGGG - Intronic
1152634171 17:81423632-81423654 CAGGGTGCCTGGCTGGAGTGGGG + Intronic
1152728134 17:81957736-81957758 CAGGGTGCATGGAAGGGGTGTGG - Intronic
1152799498 17:82324233-82324255 CAGTCTGCCTGTCAGGGGTGGGG - Intronic
1152874902 17:82781116-82781138 CAAGACGCATGGCAGGTGTGGGG + Intronic
1153342358 18:3988671-3988693 CGGGCTGCATCGCAGGTGAGTGG - Intronic
1153541833 18:6164103-6164125 CAAACTGCAAGGCAGCAGTGAGG + Intronic
1153913198 18:9721872-9721894 CATGCTGGTTGGGAGGAGTGTGG + Intronic
1153934032 18:9904899-9904921 GAGGCTGCAGGGAAGGAGAGGGG - Intergenic
1154248380 18:12720258-12720280 CAGGCTTCATGGCAGAAGGGAGG + Intronic
1154411252 18:14143379-14143401 GAGGCAGGATGGGAGGAGTGTGG - Intergenic
1155364957 18:25040479-25040501 CAGTCTGCATGGCAACAGTATGG + Intergenic
1155553907 18:26996593-26996615 GAGGCTGCAAGGCAGGAAGGCGG + Intronic
1155972847 18:32098028-32098050 CAGGCTGGATTGCAGTGGTGCGG + Intronic
1157131756 18:45013797-45013819 CAGACTTCATGTCAGGATTGGGG - Intronic
1157799893 18:50610511-50610533 GAGGCTGCAAGGCAGGAGGAGGG - Intronic
1159104783 18:63993742-63993764 CAGGCTGCATGGGGGAGGTGGGG + Intronic
1159991873 18:74918323-74918345 CAGGCTGTATGGCTGGTGAGTGG - Intronic
1160092489 18:75840262-75840284 AAGGCAGGGTGGCAGGAGTGGGG - Intergenic
1160332985 18:78012306-78012328 CAAACTGCATGGTTGGAGTGGGG + Intergenic
1160504745 18:79420682-79420704 CAGGCAGCATGGCTGCAGAGAGG + Intronic
1160724671 19:612772-612794 CAGGCTGGAGGGCAGTGGTGTGG + Intronic
1161208286 19:3053600-3053622 CAGGCTGCAGGGGAGGAGGAGGG + Exonic
1161380273 19:3961158-3961180 CAGGCTGCGAGACAGGCGTGGGG + Exonic
1162154917 19:8671159-8671181 GAGGCTGCTTGGCTGGGGTGGGG + Intergenic
1162316995 19:9945607-9945629 GAGGCTGCAAGGAGGGAGTGAGG + Intergenic
1162583582 19:11545517-11545539 GAAGCTGCATGTCAGGAGTCTGG + Intronic
1163234668 19:16023514-16023536 CCGGATGAAAGGCAGGAGTGTGG + Intergenic
1164331997 19:24268205-24268227 CAAACTGCAAGGCAGCAGTGAGG - Intergenic
1165309678 19:35022633-35022655 CAGGCTTCTGGGCAGGAGTGTGG - Intronic
1165421573 19:35724674-35724696 CAGGCTGCAGGGTAGGTTTGCGG - Exonic
1166059214 19:40314702-40314724 CAGCCTGCATGTAAGGAGTTGGG - Intergenic
1166183367 19:41123930-41123952 CAGGCTGCATGGGAGAGGTAGGG - Intronic
1166381346 19:42356844-42356866 GCGGCTGCATGGAAGGAGCGGGG - Exonic
1166518507 19:43464199-43464221 CAGGCTGAAAGGGAGGGGTGGGG + Intronic
1166541260 19:43607622-43607644 CATGCTGCATGCCCGGGGTGAGG - Exonic
1166820363 19:45575649-45575671 CAGGCTGGAGTGCAGGGGTGCGG + Intronic
1167674818 19:50877582-50877604 GGGGCTGCATGGCTGGAGTGAGG + Intronic
1168437983 19:56337301-56337323 CAAACTGCAAGGCAGCAGTGAGG - Intronic
1168726178 19:58583360-58583382 CTGGGGGCATGGCAGGAGTCCGG - Intergenic
925334121 2:3080516-3080538 CTGGCTCCCTGGCAGGAGTGGGG - Intergenic
925912202 2:8581328-8581350 CAGGCAGCACACCAGGAGTGCGG + Intergenic
925954023 2:8943512-8943534 CTGGCTGCATGGAAGCCGTGTGG + Intronic
926687190 2:15707190-15707212 TATGCTGCCTGGCAGGAGAGAGG + Intronic
927133101 2:20077089-20077111 CAGGCTGCAGGGAAGAAGTCAGG - Intergenic
927272611 2:21229254-21229276 CCTGCTGCCTGGCTGGAGTGAGG - Intergenic
927447012 2:23171946-23171968 CAAACTGCAAGGCAGCAGTGAGG + Intergenic
927966152 2:27270313-27270335 CTGGCTGCTTGGGAGGACTGGGG + Intronic
928001401 2:27525994-27526016 CAGGCTGCAGTGCAGTGGTGCGG + Intergenic
928266606 2:29817345-29817367 CATACTGCATGGTTGGAGTGGGG + Intronic
928794291 2:34997529-34997551 CAGGGTGCATGGTAGTGGTGTGG + Intergenic
929399394 2:41562641-41562663 CAGGCTGGAGTGCTGGAGTGCGG + Intergenic
929441452 2:41968405-41968427 CAGGTTGCAGGGCAGGACTCAGG - Intergenic
929803070 2:45120912-45120934 CATGCTGCATGGCTGGGCTGGGG + Intergenic
930571302 2:53089893-53089915 CAGGCTGGAGTGCAGTAGTGTGG - Intergenic
930797152 2:55405605-55405627 CAGTCTGCATGGCAGGTGAGCGG + Intronic
930911684 2:56636962-56636984 CAAACTGCAAGGCAGCAGTGAGG - Intergenic
931130141 2:59326715-59326737 CAAACTGCAAGGCAGCAGTGAGG + Intergenic
931194190 2:60035271-60035293 CAAACTGCAAGGCAGCAGTGAGG + Intergenic
931453988 2:62392747-62392769 CAGGCTGGAGTGCAGTAGTGTGG + Intergenic
931977056 2:67654471-67654493 CAAACTGCAAGGCAGCAGTGAGG + Intergenic
932091949 2:68813741-68813763 CAGGCTGGAAGGCAGGTGTGAGG + Intronic
932224808 2:70031135-70031157 CAGGAAGCAAGGAAGGAGTGGGG - Intergenic
932448381 2:71794462-71794484 GAGGCTGCAGGGCCAGAGTGGGG + Intergenic
932483438 2:72064381-72064403 CAAACTGCAAGGCAGCAGTGAGG + Intergenic
932633908 2:73371241-73371263 AAGCCAGCATGGCTGGAGTGGGG + Intergenic
933223439 2:79717453-79717475 CAGGCTGCATGAAAGCAGTCTGG + Intronic
933590286 2:84225147-84225169 CAAACTGCAAGGCAGCAGTGAGG + Intergenic
933618651 2:84511291-84511313 CAAACTGCAAGGCAGCAGTGAGG - Intergenic
933741240 2:85536092-85536114 CAGGCTGGAGTGCAGTAGTGCGG + Intergenic
933900881 2:86849263-86849285 AAGGCTGGATGGCTGGGGTGTGG + Intronic
934831062 2:97525821-97525843 CAAACTGCAAGGCAGCAGTGAGG + Intronic
935779661 2:106499968-106499990 AAGGCTGGATGGCTGGGGTGTGG - Intergenic
935891972 2:107688608-107688630 AAGGGTGACTGGCAGGAGTGGGG - Intergenic
936623898 2:114127689-114127711 CAGGCTGGAGGGCAGTGGTGTGG + Intergenic
936641251 2:114314940-114314962 AAGGCAGGGTGGCAGGAGTGGGG - Intergenic
937297470 2:120818218-120818240 AAGCCTGCAGGGCAGGGGTGTGG + Intronic
938054962 2:128208082-128208104 CAGGCCGCACAGCAGGAGCGGGG - Intergenic
939728820 2:145756560-145756582 CAGGCTGGAGTGCAGTAGTGAGG + Intergenic
940695165 2:156968061-156968083 CAAACTGCAAGGCAGCAGTGAGG - Intergenic
941454622 2:165700645-165700667 CAGGATGGATGTCAGGAGTGGGG + Intergenic
942301471 2:174566972-174566994 CAGGCTTCTTGCCTGGAGTGGGG - Intronic
943130678 2:183849930-183849952 CAAACTGCAAGGCAGCAGTGAGG + Intergenic
944612529 2:201426123-201426145 CAGGCTGCATAGCAGGAGGTGGG + Intronic
944672525 2:202006934-202006956 CAGGCTGGAGTGCAGCAGTGAGG - Intergenic
945460289 2:210100068-210100090 CAGGCTGCACAGCAGGAGGTGGG + Intronic
945677735 2:212876105-212876127 CAAACTGCAAGGCAGCAGTGAGG + Intergenic
946279961 2:218659565-218659587 CCGGCTTCAGGGCTGGAGTGGGG - Intronic
946445899 2:219739757-219739779 CAGGCTGCTGGGGAGTAGTGAGG + Intergenic
946572799 2:221042952-221042974 CAGGCTGCCTGGCAATACTGAGG - Intergenic
948577405 2:238963763-238963785 AAGCCGGCATGGCAGGACTGGGG - Intergenic
948766944 2:240227249-240227271 CAGGCTGCTGGGTAGGAGTGAGG + Intergenic
948973151 2:241444956-241444978 CAGCCTGGGTGACAGGAGTGAGG - Intronic
1170536382 20:17345127-17345149 AACCCTTCATGGCAGGAGTGTGG + Intronic
1171407099 20:24918802-24918824 AAGTGTGCAGGGCAGGAGTGAGG - Intergenic
1172009642 20:31839001-31839023 CAGGCTGCTTGGAGTGAGTGAGG + Intergenic
1172279036 20:33697875-33697897 CAGGCTGGAGTGCAGGGGTGTGG + Intergenic
1172358044 20:34293266-34293288 CATGCCACATGGGAGGAGTGTGG - Intronic
1172620096 20:36313091-36313113 CAGGCGGCAGGTCAGGGGTGAGG - Intronic
1172623307 20:36333597-36333619 AAGGCTGCATAGCATGGGTGAGG + Intronic
1172623559 20:36334845-36334867 CAGGCTGAGAGGCAGGACTGGGG - Intronic
1172810503 20:37644264-37644286 CAGACTGCAGGGCAGGAGGGAGG - Intergenic
1173665790 20:44762230-44762252 CAGGCTGCAGAGCAGGTGAGCGG - Intronic
1173947736 20:46965095-46965117 CTGCCTGCATCGCAGGAGTGTGG + Intronic
1174002746 20:47386682-47386704 CAGGCTGGAGTGCAGAAGTGTGG + Intergenic
1174928059 20:54782919-54782941 CAAACTGCAAGGCAGCAGTGAGG + Intergenic
1174993416 20:55538922-55538944 GATGCTGCAGGGAAGGAGTGAGG - Intergenic
1175067610 20:56303026-56303048 CAGGCTGGAGGGCAGTGGTGTGG - Intergenic
1175383453 20:58579206-58579228 CTGACTGCATGGCAGCAGCGGGG - Intergenic
1175963474 20:62648501-62648523 CCGGCTGCATGGGAGCCGTGTGG + Intronic
1176911385 21:14569248-14569270 CAGGCTGCACTGCAGTAGTGCGG - Intronic
1176962078 21:15170381-15170403 CAGGTTGTAAGCCAGGAGTGTGG - Intergenic
1178294946 21:31401864-31401886 CAGGCTGGAGGGCAGTAGTGCGG - Intronic
1178342087 21:31794236-31794258 ATGGCGGCATGGCAGGGGTGAGG + Intergenic
1178396679 21:32249310-32249332 CAGGCTGCATGTCTCGACTGAGG - Intergenic
1178517645 21:33262317-33262339 CAGGCTGGAGTGCAGTAGTGCGG - Intronic
1178967166 21:37131620-37131642 TAGTCAGCAGGGCAGGAGTGTGG + Intronic
1179043931 21:37829001-37829023 TAGGCTGCATGGCTGGATTTTGG - Intronic
1179072356 21:38083492-38083514 CAGGCTGCTTGGCTGGTGGGGGG - Intronic
1179383572 21:40921317-40921339 AAGGCAGTATAGCAGGAGTGGGG - Intergenic
1179570073 21:42273456-42273478 CAGGCGGCAGGGGCGGAGTGGGG - Intronic
1179924952 21:44529245-44529267 GATTCTCCATGGCAGGAGTGTGG + Intronic
1179944935 21:44666786-44666808 CAGGATGCCTGGCAGGAGCTGGG + Exonic
1180174390 21:46080665-46080687 CAGCCTGCAGGCCAGGAGTCTGG + Intergenic
1180175956 21:46089575-46089597 CTTGCTGCAAGGCTGGAGTGGGG - Intergenic
1180245840 21:46546705-46546727 CAGGCTGTGTGGAAGGAATGGGG - Intronic
1180640009 22:17290827-17290849 CCGCCTTCATGGTAGGAGTGGGG - Intergenic
1180670331 22:17548227-17548249 CAGTCTGCAGGGGAGGTGTGGGG - Exonic
1180917229 22:19497697-19497719 CAGGCTGAGCAGCAGGAGTGGGG - Intronic
1180967581 22:19798614-19798636 CAGGCTGCTGGGCAGGAGCTGGG - Intronic
1181459846 22:23079440-23079462 GAGGCAGCATGGCAGGAGTGGGG + Intronic
1182446512 22:30392806-30392828 CAGGCTGGACTGCAGAAGTGAGG + Intronic
1182548434 22:31088796-31088818 CAGACAGCAGGGCAGGGGTGGGG - Intronic
1182996452 22:34817198-34817220 CAAACTGCAAGGCAGCAGTGAGG + Intergenic
1183174528 22:36213044-36213066 CAGGCAGAAGGGCTGGAGTGGGG + Intergenic
1183500452 22:38175677-38175699 CAGGCTGCAGGGCGGAGGTGCGG - Intronic
1183546309 22:38456098-38456120 CAGGATCCAGGGCAGGAGCGGGG - Intergenic
1183782887 22:40009894-40009916 AAAGCTGAATGGCAGGAGAGGGG + Intronic
1184026435 22:41860833-41860855 CAGGCTGGAAGGCAGTGGTGGGG - Intronic
1184560357 22:45259567-45259589 GAGGCAGGAGGGCAGGAGTGAGG - Intergenic
1185175541 22:49324433-49324455 CAGGCTGCCTGGAAGCAGAGTGG - Intergenic
1185332852 22:50259395-50259417 GAGGCGGCCTGGCAGGACTGAGG + Intronic
1203331061 22_KI270738v1_random:89545-89567 CAAACTGCAAGGCAGCAGTGAGG + Intergenic
950421597 3:12902890-12902912 CAGGCTCCGTGGCAGCAGCGTGG - Intronic
950530974 3:13552207-13552229 CAGGCTGGAGGGCAGCTGTGGGG + Intronic
951144524 3:19211365-19211387 CAGGCTTCATGGAAGAGGTGGGG + Intronic
951244066 3:20319794-20319816 CAGACTGCATGTTAGGAGTAAGG - Intergenic
951595045 3:24309468-24309490 TAGGCTGAAGGGAAGGAGTGGGG - Intronic
952104155 3:30050311-30050333 CAAACTGCAAGGCAGCAGTGAGG + Intergenic
952377593 3:32780574-32780596 CAGGCTCCAGGGTGGGAGTGGGG + Intergenic
952571733 3:34725918-34725940 CAGGCAGAAAGGCAGGAGTGGGG - Intergenic
953226189 3:41023852-41023874 AAGGCTCCATGACAGGAGCGAGG - Intergenic
953820173 3:46201460-46201482 CAGGCAGCATGGCAGGGGGTTGG - Intronic
953929991 3:47001082-47001104 GAGGCTGCCTGGCGGGAGCGTGG + Exonic
954107185 3:48415689-48415711 CAGGGAGCGTGGCAGGCGTGGGG + Exonic
954639414 3:52089154-52089176 CAGGCTGCATGTCACGAAGGAGG + Intronic
954816606 3:53286946-53286968 CCTGCTGCAGGGCAGGACTGGGG + Exonic
954920770 3:54188979-54189001 CTGGATGTATTGCAGGAGTGAGG - Intronic
955405413 3:58622753-58622775 GAGGCTGCTGGGCAGGAGGGGGG + Intronic
955592308 3:60551158-60551180 CAGGCAGCAAGGCAGAGGTGAGG + Intronic
956472975 3:69588086-69588108 CAGGCTGCAATGCAGTGGTGCGG - Intergenic
957108580 3:75924179-75924201 CAGGCAGCATGGGAGCATTGTGG + Intronic
958494562 3:94828438-94828460 CAGGCTGGAGGACAGTAGTGTGG + Intergenic
958495232 3:94836430-94836452 CAAACTGCAAGGCAGCAGTGAGG + Intergenic
959464204 3:106665701-106665723 CAGACTGCAAGGCAGCAGTGAGG + Intergenic
959626334 3:108456372-108456394 CAGGGTGTATGGCAGGAGGCAGG - Intronic
960281334 3:115784314-115784336 CGGGCCGCAGGGCAGGAGGGAGG + Intergenic
960832360 3:121863418-121863440 CAAACTGCAAGGCAGCAGTGAGG - Intronic
961175633 3:124832837-124832859 CAGGTTTCAAGGCAGGAATGAGG + Intronic
961446067 3:126982446-126982468 CAGCCTGCATGGCAAGGCTGAGG - Intergenic
961710952 3:128827760-128827782 AAGGCAGGGTGGCAGGAGTGGGG + Intergenic
961833020 3:129634079-129634101 AAGACTGCATGGCTGGAGGGAGG + Intergenic
962025576 3:131543890-131543912 CAGGCTGCAGGCCAGAAGTCAGG - Intronic
962133086 3:132703622-132703644 CAGGCTGGAGGGCAGGGGTGTGG + Intronic
962729123 3:138263521-138263543 CAGGCTGAATGACAGGCGTAAGG - Intronic
962980571 3:140485674-140485696 CAAACTGCAAGGCAGCAGTGAGG - Intronic
963484407 3:145918303-145918325 CAAACTGCAAGGCAGCAGTGAGG + Intergenic
963485309 3:145928180-145928202 CAAACTGCAAGGCAGCAGTGAGG + Intergenic
964155904 3:153584393-153584415 CAAACTGCAAGGCAGCAGTGAGG + Intergenic
964260075 3:154825693-154825715 CAAACTGCAAGGCAGCAGTGAGG - Intergenic
964269565 3:154940416-154940438 AAGGCTGCTTGGCTGGAGTAGGG - Intergenic
964297706 3:155252174-155252196 CAGGCAGTGTAGCAGGAGTGGGG - Intergenic
964500220 3:157340445-157340467 CAAACTGCAAGGCAGCAGTGAGG + Intronic
964627916 3:158776766-158776788 AAGGCTGCAGGGCAGGCCTGGGG + Intronic
964726892 3:159822900-159822922 CAGGCTGTTTGGCAAGAGGGAGG + Intronic
965671018 3:171147844-171147866 GAGGCAGCATGGCAAGAGTCAGG - Intronic
965709512 3:171543215-171543237 CAGGCTGCAGGGCAGGAAAAAGG - Intergenic
966563737 3:181352434-181352456 CAGGCTGCACAGCAGGTGAGCGG - Intergenic
966723150 3:183084845-183084867 CAGGCTGGAGTGCAGCAGTGAGG - Intronic
966941489 3:184750674-184750696 CAGGCTGCATGGAGGGTGGGTGG + Intergenic
967075252 3:185995987-185996009 CAAGGTGCATGGCAGTCGTGGGG + Intergenic
967219143 3:187234665-187234687 CAGGCAGCCTGGCAGGATTTGGG + Exonic
967844902 3:194035596-194035618 CAGCCTGCAAGGCAGGCCTGTGG - Intergenic
968549816 4:1216465-1216487 CAGGCTGCAGGGGAGTGGTGTGG - Intronic
968661409 4:1800240-1800262 CAGGGTGGCTGGCAGGAGGGTGG + Intronic
969286963 4:6208605-6208627 CAGACTTCCTGGCAGGCGTGGGG - Intergenic
969603575 4:8190683-8190705 CAGGCTGGAGTGCAGTAGTGTGG + Intronic
969666958 4:8564062-8564084 CAGGCTGGAGGGCAGTGGTGTGG - Intronic
970109100 4:12617637-12617659 CTGGCTGACTGGCAGGAGTGTGG + Intergenic
970259841 4:14212816-14212838 CAAACTGCAAGGCAGCAGTGAGG - Intergenic
970322064 4:14884739-14884761 CAAGCCCCATGGCAGGAGAGTGG - Intergenic
970420440 4:15901081-15901103 GACACTGCATGGCAGGATTGAGG - Intergenic
970435055 4:16025378-16025400 CAGGCAGCAGAGCAGGAGTCAGG + Intronic
971061839 4:22979807-22979829 CAGGCTTCAGGCCAGTAGTGGGG - Intergenic
971242560 4:24901788-24901810 CTTGCTGCATGGCTGGAGGGTGG - Intronic
971312400 4:25536685-25536707 CAGGATGCATGAGTGGAGTGAGG - Intergenic
972376187 4:38473022-38473044 CAGGCTGCATAGCAGGGTAGAGG - Intergenic
974045694 4:56896621-56896643 CAGGCTGCAGTGCAGTGGTGCGG + Intergenic
974470205 4:62309668-62309690 CAATCTGCAAGGCAGCAGTGAGG + Intergenic
974493894 4:62602683-62602705 CAAACTGCAAGGCAGCAGTGAGG + Intergenic
974561824 4:63532929-63532951 CAAACTGCAAGGCAGCAGTGAGG + Intergenic
974743759 4:66042581-66042603 CAGGCTGGAGTGCAGTAGTGTGG - Intergenic
975348389 4:73319818-73319840 CAAACTGCAAGGCAGCAGTGGGG + Intergenic
975386692 4:73767257-73767279 AAGGCAGGGTGGCAGGAGTGGGG + Intergenic
975588268 4:75972974-75972996 CAGGCTGGAGGGCAGTGGTGTGG - Intronic
975887411 4:78982160-78982182 CAAACTGCAAGGCAGCAGTGAGG - Intergenic
976496895 4:85740262-85740284 CAGGCTGCAGTGCTGGAGTGCGG + Intronic
976711287 4:88074183-88074205 CAGGCTGGAGTGCAGGAGTGCGG + Intronic
976993204 4:91395976-91395998 CAGGCATCATGGCAGGAGCCAGG - Intronic
977204736 4:94155889-94155911 AAGGCAGGGTGGCAGGAGTGGGG - Intergenic
977620238 4:99127785-99127807 CAGGCTGCAGTGCAGTGGTGTGG - Intronic
977678222 4:99771040-99771062 CAAACTGCAAGGCAGCAGTGAGG - Intergenic
977765155 4:100788721-100788743 CAGGCTGCGAGGGGGGAGTGGGG + Intronic
977922657 4:102662498-102662520 CAGGCTGGAGTGCAGTAGTGCGG - Intronic
977974060 4:103243792-103243814 CAAACTGCAAGGCAGCAGTGAGG - Intergenic
978231727 4:106408164-106408186 CAAACTGCAAGGCAGCAGTGAGG - Intergenic
978899047 4:113926566-113926588 AAGGCAGGGTGGCAGGAGTGGGG + Intronic
979126296 4:116976717-116976739 AGGGCTGCATGGCAGGAGAAAGG + Intergenic
980006203 4:127544903-127544925 CAGGATGTATGACAGGAGTGTGG - Intergenic
980115806 4:128678071-128678093 CAGGCTGGAGTGCAGTAGTGCGG - Intergenic
980231531 4:130051915-130051937 CAAACTGCAAGGCAGCAGTGAGG - Intergenic
980873638 4:138638580-138638602 CAGCCTCTGTGGCAGGAGTGGGG - Intergenic
981283722 4:142991283-142991305 CAAACTGCAAGGCAGCAGTGAGG + Intergenic
981500494 4:145446127-145446149 CAGTCTGCAGTGCAGGAATGAGG + Intergenic
983963816 4:173786316-173786338 CAAACTGCAAGGCAGCAGTGAGG + Intergenic
984205375 4:176781597-176781619 CAGGATTCATGGCAGCTGTGTGG + Intronic
984357394 4:178680180-178680202 CAGGCTGGAGTGCAGTAGTGTGG - Intergenic
984471838 4:180186085-180186107 CAGGCTACAGTGCAGTAGTGTGG + Intergenic
984557217 4:181228798-181228820 CAAGCTGCATGGCAGGCTAGCGG + Intergenic
984869589 4:184314475-184314497 GAGGCTGCATTGCAGCAATGAGG + Intergenic
985138239 4:186811661-186811683 CAGGGTGGATGACAGGGGTGCGG + Intergenic
985286764 4:188344268-188344290 GAGGCTGGGTGGCAGGACTGGGG - Intergenic
985374677 4:189322620-189322642 CACGCGGAATGGCAGGAATGTGG - Intergenic
985530062 5:428990-429012 CAAGCTGCATGGCAGGAGGTGGG - Intronic
985532112 5:439889-439911 GAGGCTGCATGGCCGCAGTGAGG + Intergenic
985712694 5:1438724-1438746 CAGGCTCACTGGCGGGAGTGGGG + Intronic
986174026 5:5336815-5336837 CAGGATGGAGGGCAGGAGAGGGG + Intergenic
986221378 5:5771798-5771820 TACGCTGCATGGCTGGATTGAGG - Intergenic
986353303 5:6900663-6900685 ATGGCTGCAGGGCTGGAGTGCGG + Intergenic
987754035 5:22076990-22077012 CAGGCTGCCTACCAGGAGTCAGG - Intronic
987821500 5:22971379-22971401 GAAGCTTCATGGCAGAAGTGTGG + Intergenic
988541806 5:32116800-32116822 CAGGCTGCAGTGTAGTAGTGTGG - Intergenic
989278912 5:39619830-39619852 CAGGCTGGAGTGCTGGAGTGTGG + Intergenic
989616430 5:43341177-43341199 CAGACTGCAAGGCAGCAGTGAGG + Intergenic
989682040 5:44041312-44041334 CAAACTGCAAGGCAGCAGTGAGG + Intergenic
990095162 5:52102514-52102536 CAAGCTGCAAGGCAGCAGCGAGG - Intergenic
990182139 5:53173271-53173293 CATGCTCCAAGGCAGGAGTGGGG - Intergenic
990188130 5:53229851-53229873 CAAACTGCAAGGCAGCAGTGAGG - Intergenic
990237845 5:53787046-53787068 CAGTCTGCATGGCAGGAGAGAGG + Intergenic
990239572 5:53803194-53803216 CAAACTGCAAGGCAGCAGTGAGG + Intergenic
990375250 5:55163549-55163571 CAGGCTGGAGGGCAGTGGTGTGG + Intronic
990926167 5:61026236-61026258 CAGCCTGCAGGGGAGGAGGGGGG + Intronic
990937649 5:61167172-61167194 CAGGCTGCCAGGCTGGAGTGCGG - Intergenic
990954575 5:61330527-61330549 CAGGCTGCAAGGCAGGCGGGTGG + Intergenic
991057193 5:62334084-62334106 CAGTCTTCATGGCAGGTGGGAGG - Intronic
991628634 5:68631570-68631592 CAGCCAGCATGGCAGGTCTGGGG - Intergenic
991981634 5:72237628-72237650 CAGGCTTGATGGGAGGAGTCAGG + Intronic
992338705 5:75799902-75799924 CAAACTGCAAGGCAGCAGTGAGG - Intergenic
992865297 5:80951784-80951806 CAGTCTGAAGGGCAGGACTGTGG + Intergenic
992973135 5:82083253-82083275 CAAACTGCAAGGCAGCAGTGAGG + Intronic
993142365 5:84050736-84050758 CAAACTGCAAGGCAGCAGTGAGG + Intronic
993610291 5:90045246-90045268 CAAACTGCAAGGCAGCAGTGAGG - Intergenic
993652581 5:90539941-90539963 CGGGCTGGATTGCAGTAGTGCGG - Intronic
993671174 5:90763668-90763690 GAGGCAGCAGGGTAGGAGTGGGG - Intronic
993840913 5:92877212-92877234 GAGGCAGCAAGGCAGGGGTGAGG - Intergenic
993888289 5:93442463-93442485 CAAACTGCAAGGCAGCAGTGAGG + Intergenic
994424243 5:99563470-99563492 CAAACTGCAAGGCAGCAGTGAGG - Intergenic
994969673 5:106719460-106719482 CAAACTGCAAGGCAGCAGTGAGG - Intergenic
995845081 5:116484872-116484894 CAGGCTGCATGGCAGAGGATGGG + Intronic
996013070 5:118502486-118502508 CAAACTGCAAGGCAGCAGTGAGG - Intergenic
996130965 5:119780361-119780383 CAAACTGCAAGGCAGCAGTGAGG - Intergenic
996455858 5:123680275-123680297 CAAACTGCAAGGCAGCAGTGAGG - Intergenic
996713732 5:126569049-126569071 CAGGCTGCACAGCAGGAGGTAGG + Intronic
996846689 5:127906739-127906761 CAGGCTGCAGTGCAGTGGTGTGG - Intergenic
997913373 5:137898766-137898788 CAGGCTGGAGTGCTGGAGTGCGG + Intronic
997929835 5:138063082-138063104 CAGGCTGGAGGGCAGTGGTGTGG - Intergenic
998136581 5:139677276-139677298 CAGGCAGCAGGGGAGGAGTCAGG - Intronic
999064771 5:148673914-148673936 CAAGCTGCAAGGCAGCAGCGAGG - Intronic
999193082 5:149763152-149763174 GAGGCTGCAGGGCCAGAGTGGGG - Intronic
999264251 5:150256229-150256251 AAGGCTGCATGGCTGGAAAGTGG + Intronic
1000365770 5:160489640-160489662 CAGGCTGCAGTGCAGTGGTGTGG + Intergenic
1000399732 5:160813406-160813428 CAAACTGCAAGGCAGCAGTGAGG + Intronic
1001350917 5:170963734-170963756 CAGGCTGCACAGCAGGAGGTGGG - Intronic
1001492850 5:172168012-172168034 CTGGCTGAGTGGCAGGTGTGAGG + Intronic
1001568439 5:172715095-172715117 AGGGCTGCAGGGCAGGAATGTGG + Intergenic
1001641586 5:173247573-173247595 CAGGATGCAAGGCAGGATTCGGG - Intergenic
1001707752 5:173753947-173753969 CAGGTTGGGTTGCAGGAGTGTGG - Intergenic
1001940217 5:175734942-175734964 CAGGCTGCAGTGCAGTGGTGTGG - Intergenic
1001961928 5:175884655-175884677 GAGGGTGCATGGAAGGAGAGGGG - Intergenic
1002119069 5:176987604-176987626 CAGGCTGGAGGGCAGTGGTGTGG - Intronic
1002939970 6:1707533-1707555 CAGGCTGCCTGGGAGGAGGAAGG - Intronic
1002939990 6:1707595-1707617 CAGGCTGCCTGGGAGGAGGAAGG - Intronic
1002940010 6:1707657-1707679 CAGGCTGCCTGGGAGGAGGAAGG - Intronic
1003341764 6:5228319-5228341 CAGGCTGCAGTGCAGTAATGCGG + Intronic
1003724150 6:8740380-8740402 CAGGCTTCATGGAATGAGTTAGG - Intergenic
1004811632 6:19269651-19269673 ATGGCTGCATGGCTGGTGTGAGG - Intergenic
1004922623 6:20390934-20390956 CAGGCTACAGTGCAGTAGTGTGG + Intergenic
1005379094 6:25215817-25215839 CAGGCTGGAGGGCAGTGGTGTGG - Intergenic
1005492162 6:26357034-26357056 CAGGCTGCAGTGCAGTAGTGTGG + Intergenic
1005650575 6:27881404-27881426 CAGGCTGGAGGGCAGTGGTGTGG + Intergenic
1005844777 6:29768908-29768930 CCTGCTGCATCGTAGGAGTGAGG - Intergenic
1007900548 6:45407534-45407556 CAGGCTGGAGTGCAGTAGTGTGG + Intronic
1008329603 6:50229042-50229064 CAAACTGCAAGGCAGCAGTGAGG - Intergenic
1008412236 6:51193388-51193410 CAAACTGCAAGGCAGCAGTGAGG - Intergenic
1009361378 6:62818508-62818530 CAAACTGCAAGGCAGCAGTGAGG - Intergenic
1009410768 6:63362619-63362641 CAAACTGCAAGGCAGCAGTGAGG + Intergenic
1009662381 6:66631235-66631257 CAAACTGCAAGGCAGCAGTGAGG + Intergenic
1010093019 6:72006747-72006769 CAAGCTGCAAGGCAGCAGTGAGG + Intronic
1010476923 6:76299256-76299278 CAAACTGCAAGGCAGCAGTGAGG - Intergenic
1010484276 6:76390932-76390954 CAAACTGCAAGGCAGCAGTGAGG + Intergenic
1011118477 6:83923095-83923117 TAAGCTGCATGTCAGGAGTAGGG - Intronic
1011294910 6:85816347-85816369 CAAACTGCAAGGCAGCAGTGAGG + Intergenic
1011338169 6:86283852-86283874 CAAACTGCAAGGCAGCAGTGAGG - Intergenic
1011510371 6:88093741-88093763 CAGGATGTGTGACAGGAGTGTGG - Intergenic
1012087706 6:94851538-94851560 CAAACTGCAAGGCAGCAGTGAGG + Intergenic
1012907494 6:105085082-105085104 CAGGCTGGAGTGCAGCAGTGGGG + Intergenic
1013002619 6:106039219-106039241 CAGGCTGCATTGGAGGAGTGGGG + Intergenic
1013369155 6:109455220-109455242 GAGGGTGAATGGCAGCAGTGGGG + Intronic
1013388981 6:109664467-109664489 CAGGCTGGAGGGCAGTGGTGTGG + Intronic
1014141241 6:117945699-117945721 CAGGAAGCATGGCATCAGTGGGG - Intronic
1015040109 6:128706206-128706228 CAGGCTGGAGGGCAGTGGTGCGG - Intergenic
1015119939 6:129689870-129689892 AAGGCTGGATGCCAGGAGTGTGG - Intronic
1015164809 6:130192035-130192057 CCACATGCATGGCAGGAGTGTGG - Intronic
1017227782 6:152040838-152040860 AAGGCAGGGTGGCAGGAGTGGGG + Intronic
1018007148 6:159632725-159632747 CAGGCTGCAGTGCAGTGGTGTGG - Intergenic
1018163809 6:161074957-161074979 CAGCCTCCATGGCAACAGTGAGG - Intronic
1018364411 6:163103285-163103307 CTGGCTGGTTGGCAGCAGTGGGG + Intronic
1018458043 6:163970318-163970340 CAGACTGCATTGCACGAGGGTGG + Intergenic
1018853595 6:167659166-167659188 CTGGCTGCAGTGCCGGAGTGCGG + Intergenic
1018909409 6:168093417-168093439 CAGGCTGCTTGTCAGGTCTGGGG - Intergenic
1019043097 6:169122259-169122281 CAGGCTGCTGGGCTGGACTGTGG - Intergenic
1019206426 6:170365721-170365743 CAGGCAGCCTGGCAGGGGGGAGG - Intronic
1019383998 7:743328-743350 CAGGCTGGAGTGCAGGGGTGTGG - Intronic
1019666133 7:2253047-2253069 AAGGCTGGAGGGCAGGGGTGAGG - Exonic
1021149803 7:17135531-17135553 CAGCCTGCATGGAAGGAGTGGGG + Intergenic
1021375911 7:19906254-19906276 CAAACTGCAAGGCAGCAGTGAGG - Intergenic
1021674632 7:23067881-23067903 CAGGCCCCATGGCAGGCTTGTGG - Intergenic
1022548214 7:31209034-31209056 AAGGATGCCTGGCAGGAATGTGG + Intergenic
1022598874 7:31738109-31738131 TAGGCTGCGTGGCTGGAGGGAGG - Intergenic
1022619095 7:31964379-31964401 CAAACTGCAAGGCAGCAGTGAGG + Intronic
1022838415 7:34138567-34138589 CAGGCAAGATGCCAGGAGTGGGG + Intronic
1023121758 7:36916324-36916346 AAGGCTGCATCTCAGGAGTGTGG - Intronic
1023360262 7:39408189-39408211 CCAGCTCCCTGGCAGGAGTGAGG - Intronic
1023773600 7:43583019-43583041 CAGGGTGCAGGGCAGGCGCGGGG + Intronic
1023886599 7:44361329-44361351 AAGGATCCATGGCAGAAGTGTGG + Intergenic
1024231140 7:47364593-47364615 CAGCCTGCATGGCAGGCTTTTGG - Intronic
1024884316 7:54124393-54124415 AAGGCAGGGTGGCAGGAGTGGGG + Intergenic
1025190067 7:56889552-56889574 CAGGCAAAATGGCTGGAGTGGGG - Intergenic
1025601168 7:62998923-62998945 CAAACTGCAAGGCAGCAGTGAGG - Intergenic
1025681873 7:63687369-63687391 CAGGCAAAATGGCTGGAGTGGGG + Intergenic
1025712410 7:63925549-63925571 CTGGCTGCATGGCCGGCGTCTGG - Intergenic
1025832201 7:65062169-65062191 CAGGCTGCAGAGCAGGGATGGGG + Intergenic
1025919879 7:65901598-65901620 CAGGCTGCAGAGCAGGGATGGGG + Intronic
1026395832 7:69953306-69953328 TAGGCTAAATGGCAGGGGTGAGG - Intronic
1027685826 7:81278208-81278230 AAGGCAGGGTGGCAGGAGTGAGG - Intergenic
1027688137 7:81303934-81303956 CAGCCTGCATGGAAGGAGGTTGG - Intergenic
1027868839 7:83680426-83680448 CAGGCTGGAAGGCTGGAGTGTGG + Intergenic
1027981592 7:85231490-85231512 CAGGCTGGAGTGCAGTAGTGGGG + Intergenic
1028448051 7:90947330-90947352 CAGGTTGCCTGGCAAGTGTGGGG - Intronic
1028499828 7:91507145-91507167 CAAACTGCAAGGCAGCAGTGAGG + Intergenic
1029241596 7:99167130-99167152 CAGGCTCCGTGGCTGGAGCGAGG - Intergenic
1029550516 7:101234853-101234875 CCAGGTGCATGGGAGGAGTGGGG - Intronic
1029665951 7:101995190-101995212 CAGGCAGAATGGCTGGAGTGAGG - Intronic
1029669104 7:102016565-102016587 CAGGCTGGAGTGCAGGGGTGTGG - Intronic
1029676773 7:102075234-102075256 CAGACTGTAGGGCAGGAGTTTGG - Intronic
1029780100 7:102722964-102722986 CAAACTGCAAGGCAGCAGTGAGG + Intergenic
1030120726 7:106108147-106108169 CAGGCTGGAGTGCAGTAGTGTGG - Intronic
1032036238 7:128523445-128523467 CTGGCAGCATGCCAGGAATGGGG + Intergenic
1032061279 7:128727381-128727403 CAAGCTTCCTGGCAGGAATGAGG - Intronic
1032192156 7:129771505-129771527 CAGGCTGCAGGGGAGGCATGGGG - Intergenic
1032320563 7:130882817-130882839 CACACTGCATGTCAGAAGTGTGG - Intergenic
1033400726 7:141021532-141021554 CAGGGGGAAGGGCAGGAGTGGGG - Intergenic
1033484543 7:141775659-141775681 CAAACTGCAAGGCAGCAGTGAGG - Intronic
1034818378 7:154194539-154194561 CTGGCTGCCTGGGAGGAGCGAGG - Intronic
1034844984 7:154436244-154436266 GTGGCTACATGTCAGGAGTGAGG - Intronic
1035335305 7:158124236-158124258 AAGGCAGCATAGCGGGAGTGGGG - Intronic
1035410201 7:158633793-158633815 CAGGCTGAAGTGCAGCAGTGAGG + Intronic
1035555705 8:565683-565705 GAGGCTGCCTGGCAGGACTCTGG - Intergenic
1035569284 8:661307-661329 CAGGCTCCAGGGCAGAACTGTGG - Intronic
1035788192 8:2279084-2279106 ACAGCTGCATGGCAGGAGGGTGG + Intergenic
1035804615 8:2442621-2442643 ACAGCTGCATGGCAGGAGGGTGG - Intergenic
1035930791 8:3777726-3777748 GAGGCTGCAGGTCTGGAGTGTGG - Intronic
1036415775 8:8546511-8546533 CAGGCTGGAGTGCAGGGGTGTGG - Intergenic
1036966287 8:13301711-13301733 CAGGCTGCACAGCAGGAGATGGG + Intronic
1037742490 8:21618574-21618596 CAGGCTGCACAGCAGGAGGTGGG + Intergenic
1038333835 8:26630627-26630649 CAGGCTGCATGGCTGTATTCAGG + Intronic
1038368331 8:26960929-26960951 CAGGCTGCACAGCAGGTGAGTGG + Intergenic
1038487462 8:27947054-27947076 CAGGCTGGAGTGCAGTAGTGTGG + Intronic
1038563254 8:28598459-28598481 CAGGCTGGAGGGCAGTGGTGTGG - Intergenic
1039256640 8:35726165-35726187 CTGGCTGCATGGCAGAATTCAGG - Exonic
1039334179 8:36571903-36571925 GAGGCTGAATTGTAGGAGTGAGG + Intergenic
1039476297 8:37841033-37841055 CAGGGGGCATGGCTGGGGTGGGG - Intronic
1039750550 8:40474376-40474398 CAGGCAGCAAGGCAGCAGTGTGG + Intergenic
1040086669 8:43350156-43350178 CAAACTGCAAGGCAGCAGTGAGG - Intergenic
1040591755 8:48799504-48799526 CAAACTGCAAGGCAGCAGTGAGG - Intergenic
1040756627 8:50783420-50783442 CAAACTGCAAGGCAGCAGTGAGG - Intronic
1040760258 8:50833055-50833077 CAGGCTTTATGGCTGCAGTGAGG - Intergenic
1041013460 8:53567636-53567658 CAGGCTGCAGTGCAGTGGTGTGG + Intergenic
1042115472 8:65426764-65426786 CAAACTGCAAGGCAGCAGTGAGG + Intergenic
1042926768 8:73975219-73975241 CAGGCTGGAGTGCAGTAGTGTGG + Intronic
1043455481 8:80408021-80408043 CAGGCTGGAGGGCAGTGGTGTGG - Intergenic
1043874768 8:85473206-85473228 CAGGCTGTATGGCAGCAATCGGG + Intronic
1044042293 8:87385540-87385562 CAAACTGCAAGGCAGCAGTGAGG + Intronic
1044045436 8:87425917-87425939 CAAACTGCAAGGCAGCAGTGAGG - Intronic
1044261871 8:90134495-90134517 CAGGCTGCACAGCAGGTGAGCGG - Intergenic
1044416460 8:91945581-91945603 CAGGCTGCAAAGCAGGAGGTAGG - Intergenic
1044479564 8:92669437-92669459 CAGGCTGGAAGGCTGGAGTGCGG + Intergenic
1044897517 8:96908342-96908364 CAAGATGCATTGCAGGAGAGTGG - Intronic
1045144673 8:99328041-99328063 CAGGCTGCATAGCAGGTTAGTGG + Intronic
1045433178 8:102133158-102133180 CAAACTGCAAGGCAGCAGTGAGG + Intergenic
1045939138 8:107717663-107717685 CAAACTGCAAGGCAGCAGTGAGG - Intergenic
1047303024 8:123630909-123630931 CAGACTTCATGGCATGAGAGGGG + Intergenic
1047541782 8:125774642-125774664 GAGGCTGAATGGCAGGAGGATGG - Intergenic
1047841659 8:128760256-128760278 CAAACTGCAAGGCAGCAGTGAGG + Intergenic
1048292665 8:133192391-133192413 CAGGCACCATGCCAGGCGTGAGG - Intronic
1048408841 8:134150796-134150818 CAGGGTGCCAGGCATGAGTGAGG - Intergenic
1048462610 8:134635089-134635111 CAGGCTGCACAGCAGGTGAGTGG - Intronic
1048838750 8:138546572-138546594 CAGCCTGCATGGCTGCTGTGAGG - Intergenic
1049151865 8:141040331-141040353 CCAGCTGGATGGCAGGAGTCGGG - Intergenic
1049262123 8:141645521-141645543 TAGGCTGCAGGGAGGGAGTGGGG - Intergenic
1049364785 8:142231949-142231971 CAGGCTCCGTCTCAGGAGTGTGG - Intronic
1049399307 8:142417786-142417808 CAGCCTGCCTGCCAGCAGTGGGG + Intergenic
1049428789 8:142549736-142549758 CAGGCTGCAGAGCAGGGCTGTGG - Intergenic
1049609061 8:143544449-143544471 CAGGCTGCCTGGAGGGAGAGAGG - Intergenic
1050633291 9:7582963-7582985 CAGGCTGGAGTGCAGGGGTGCGG + Intergenic
1050704855 9:8385467-8385489 CAGGCTGCAGTGCAGTGGTGTGG - Intronic
1050734388 9:8746947-8746969 CAGGAAGCAAGCCAGGAGTGTGG + Intronic
1051185489 9:14456594-14456616 GAGGCTGCATGTTATGAGTGAGG - Intergenic
1051295061 9:15586850-15586872 CAGGCTGGAGGGCAGTGGTGTGG + Intronic
1051689578 9:19696012-19696034 CAGGCTGCACAGCAGGAGGTGGG + Intronic
1051941307 9:22508585-22508607 CAAACTGCAAGGCAGCAGTGAGG - Intergenic
1052342286 9:27375638-27375660 CAGGATGCATGGGGTGAGTGTGG - Intronic
1052814021 9:33085837-33085859 CAAACTGCAAGGCAGCAGTGAGG + Intergenic
1053260009 9:36654398-36654420 CAGGCTGGAGTGCAGTAGTGTGG + Intronic
1053471898 9:38352539-38352561 CAGGATACAGGACAGGAGTGGGG - Intergenic
1053718000 9:40916192-40916214 CAAGCTGCAAGGCAGCAGCGAGG + Intergenic
1055899413 9:81217560-81217582 CAAACTGCAAGGCAGCAGTGAGG + Intergenic
1056092088 9:83215521-83215543 CAGGATGTGTGACAGGAGTGTGG - Intergenic
1056792156 9:89632988-89633010 CAGGCTGCCTGGGAGGAGTAGGG + Intergenic
1057208289 9:93185757-93185779 CAGGATGCATACCAGGTGTGCGG + Intronic
1057213856 9:93217687-93217709 CAGGCTGCTTGGCAGGGGAGTGG - Intronic
1057829666 9:98396789-98396811 CAGGCTGTGTGGCCGGGGTGCGG - Intronic
1058223954 9:102337609-102337631 CAGACTGCAAGGCAGCAGTGAGG + Intergenic
1058904475 9:109470649-109470671 CAGGCTGCAGAGCAGTGGTGCGG - Intronic
1059230996 9:112721527-112721549 CAGGCTGGAGTGCAGTAGTGTGG + Intergenic
1060310070 9:122451921-122451943 CAGGCTGGAGTGCAGTAGTGCGG + Intergenic
1060702447 9:125769024-125769046 TAGGCTGCATGCCAAGTGTGAGG - Intronic
1061001332 9:127904627-127904649 CAGGCTGCAAGCCAGGCCTGGGG + Intronic
1061147710 9:128809369-128809391 CAGACTGGCTGGCAGGAGTCAGG + Exonic
1061610823 9:131744531-131744553 CAGGATTCATGTCAGGATTGAGG - Intergenic
1061626333 9:131842716-131842738 GGGGCTGGAGGGCAGGAGTGTGG + Intergenic
1061890611 9:133617213-133617235 CAGGCAGCATGGCAGGCACGGGG + Intergenic
1061908491 9:133710891-133710913 CAGGCTGCTTGGCAGGGGTCTGG + Intronic
1062307818 9:135919650-135919672 CAGACAGCATGGGTGGAGTGAGG - Intergenic
1062343547 9:136104338-136104360 CAGGCTGCAGGGGTGGAGGGGGG - Intergenic
1062401395 9:136374249-136374271 CAGGATGCATGTGAGGACTGAGG + Intergenic
1185646975 X:1622865-1622887 CAGGCTGGAGGGCAGTGGTGCGG - Intronic
1186106886 X:6216826-6216848 CAGGCTGCAATGCAGTAGTGAGG + Intronic
1186202951 X:7172380-7172402 CAGGCTAAATGGCAGAAGAGGGG - Intergenic
1187130469 X:16497760-16497782 CAAACTGCAAGGCAGCAGTGAGG + Intergenic
1187372926 X:18725539-18725561 CAGACTGCAAGGCTGGAGGGAGG - Intronic
1187436880 X:19279083-19279105 CAAACTGCAAGGCAGCAGTGAGG - Intergenic
1187604895 X:20872114-20872136 AAGGCAGGGTGGCAGGAGTGGGG - Intergenic
1188298542 X:28480260-28480282 CAGGCTGGAGGGCAGTAGTGAGG - Intergenic
1188940835 X:36235341-36235363 CAGACTGCAAGGCAGCAGCGAGG - Intronic
1189805030 X:44727010-44727032 CAGGCTGGAGTGCAGTAGTGCGG - Intergenic
1189832515 X:44989123-44989145 CAAACTGCAAGGCAGCAGTGAGG - Intronic
1189939248 X:46104269-46104291 CAAACTGCAAGGCAGCAGTGAGG + Intergenic
1190776166 X:53553763-53553785 CAGGCTGCAGTGCAGTGGTGTGG - Intronic
1191016097 X:55811766-55811788 CAAACTGCAAGGCAGCAGTGAGG - Intergenic
1191065264 X:56341359-56341381 CAAACTGCAAGGCAGCAGTGAGG - Intergenic
1191719212 X:64215455-64215477 AAGGCAGGGTGGCAGGAGTGGGG + Intergenic
1191990162 X:67026586-67026608 CAAACTGCAAGGCAGCAGTGAGG + Intergenic
1192237375 X:69304548-69304570 CAGGCTGGAGTGCAGGGGTGGGG - Intergenic
1192243205 X:69351166-69351188 CAAACTGCAAGGCAGCAGTGAGG + Intergenic
1192335486 X:70216111-70216133 CAAACTGCAAGGCAGCAGTGAGG - Intergenic
1192543925 X:71997141-71997163 GAGGCTGAATGGGAGGACTGTGG + Intergenic
1193025415 X:76841046-76841068 CAGGCTGCAAGGCCGCAGCGAGG + Intergenic
1193029531 X:76882615-76882637 CAAACTGCAAGGCAGCAGTGAGG + Intergenic
1193030825 X:76896611-76896633 CAAACTGCAAGGCAGCAGTGAGG + Intergenic
1193050020 X:77089683-77089705 CAAACTGCAAGGCAGCAGTGAGG + Intergenic
1194859623 X:98980403-98980425 CAGGGTGTGTGGCAGGGGTGTGG - Intergenic
1195093769 X:101487370-101487392 CAGGAGGCATGGCAGCACTGTGG - Intronic
1195603148 X:106771472-106771494 CAAACTGCAAGGCAGCAGTGGGG - Intronic
1195835815 X:109113713-109113735 CAAACTGCAAGGCAGCAGTGAGG + Intergenic
1195895690 X:109744071-109744093 CAGGCTGGAGGGCAGTGGTGTGG - Intergenic
1196462194 X:115942851-115942873 CTGGATGCATGGGAGAAGTGTGG - Intergenic
1197471719 X:126871326-126871348 CAGGGATCAGGGCAGGAGTGGGG - Intergenic
1197984135 X:132249745-132249767 CACGCTGCAAGGCAGCAATGAGG - Intergenic
1198172145 X:134117588-134117610 CAAACTGCAAGGCAGCAGTGAGG + Intergenic
1198223419 X:134623652-134623674 CCAGCTGCATGGGAGGACTGAGG + Intronic
1198337305 X:135679342-135679364 CAGGCAGCATGCCAGGAGCTGGG + Intergenic
1198704693 X:139436105-139436127 CAAACTGCAAGGCAGCAGTGAGG + Intergenic
1198750477 X:139932719-139932741 CAGGCTCCCTGGCCCGAGTGCGG - Intronic
1198867019 X:141133919-141133941 GAGACTGGAGGGCAGGAGTGAGG + Intergenic
1199481737 X:148305435-148305457 CAAGCTGCAAGGCGGCAGTGAGG - Intergenic
1199991572 X:152990304-152990326 CAGGCTGCAGGAGAGGAGTTGGG - Exonic
1200717988 Y:6572182-6572204 CAGGCTGGAGTGCAGTAGTGCGG + Intergenic
1200879118 Y:8193879-8193901 CAAACTGCAAGGCAGCAGTGAGG + Intergenic
1201398079 Y:13571093-13571115 CAGATTGCAAGGCAGCAGTGAGG + Intergenic
1201426014 Y:13851653-13851675 CAAACTGCATGGCAGCAGTGCGG - Intergenic
1201690781 Y:16762463-16762485 CAAACTGCAAGGCAGCAGTGAGG + Intergenic
1201710397 Y:16985448-16985470 CAAACTGCAAGGCAGCAGTGAGG + Intergenic
1201920903 Y:19232533-19232555 CAAACTGCAAGGCAGCAGTGAGG - Intergenic
1202129656 Y:21598191-21598213 CAGGATGAAAGGCAGCAGTGAGG - Intergenic
1202174619 Y:22085900-22085922 CAGGCTGCAGTGCAGTGGTGTGG - Intronic
1202216743 Y:22500482-22500504 CAGGCTGCAGTGCAGTGGTGTGG + Intronic
1202326444 Y:23695588-23695610 CAGGCTGCAGTGCAGTGGTGTGG - Intergenic
1202357186 Y:24064054-24064076 CAAACTGCAAGGCAGCAGTGAGG + Intergenic
1202513591 Y:25606060-25606082 CAAACTGCAAGGCAGCAGTGAGG - Intergenic
1202544326 Y:25974466-25974488 CAGGCTGCAGTGCAGTGGTGTGG + Intergenic