ID: 1083881824

View in Genome Browser
Species Human (GRCh38)
Location 11:65552748-65552770
Sequence GGTTGACTGCAGGAGGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 234}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083881824 Original CRISPR GGTTGACTGCAGGAGGAACA AGG (reversed) Intronic
900712771 1:4124973-4124995 GAATGACAGCAGGAGGCACAGGG - Intergenic
900958657 1:5905435-5905457 GGAGGACTGCAGGAGCACCATGG + Exonic
901627172 1:10630929-10630951 TGCTGACCGCAGGAGGATCAGGG + Intergenic
902873403 1:19327222-19327244 GGTGGACTTCCGGAGGAACTGGG - Exonic
902897495 1:19488981-19489003 GGAAGACTGTAGGAGGAGCAGGG + Intergenic
903778002 1:25805520-25805542 GGTAGACTGCAGGATGAGGAGGG + Intronic
905034246 1:34906908-34906930 GAGTGACAGCAGGAGGGACAGGG + Intronic
905107242 1:35571518-35571540 GGTTGAGGGAGGGAGGAACAGGG + Intergenic
906524157 1:46484955-46484977 GGCTGACTGCAGGAAGGCCAAGG - Intergenic
907115488 1:51964612-51964634 GGAAGACTGCAGGAAGAACAGGG - Intronic
909856052 1:80533208-80533230 GGCTGACGGCAGGGGGACCAGGG + Intergenic
913398641 1:118402911-118402933 GGCTGACTGAAGAAGAAACAGGG + Intergenic
914785663 1:150827308-150827330 GATTGACTGCAGATGGCACAAGG - Intronic
915333817 1:155129273-155129295 TGTTGACTGGAGGAGGAGGAGGG + Intronic
915585895 1:156843751-156843773 GGCTGACTGCAAGAGGAAAATGG - Intronic
919811281 1:201410396-201410418 GGGTGACTGGAGGAAGAACGTGG - Exonic
921625186 1:217372091-217372113 GCTTTATTGCAGAAGGAACATGG - Intergenic
922089267 1:222380050-222380072 GGTTGACTAAAACAGGAACAGGG - Intergenic
922969301 1:229721263-229721285 GGTGGACTGTATGAGGAAAAGGG + Intergenic
1063332043 10:5169369-5169391 GATTGATTGCAGGAGCAACACGG + Intergenic
1063675723 10:8139508-8139530 TTTTGACTGAAGGAGGAATATGG - Intergenic
1064156460 10:12907018-12907040 GGAAGACTTCAGGAGGAACCAGG - Intronic
1067414766 10:46094878-46094900 TGTTGTCTGCAGGAGAAGCAAGG + Intergenic
1069878619 10:71578162-71578184 GAGTGAAGGCAGGAGGAACAGGG + Intronic
1070648947 10:78221267-78221289 TGTTGACAGCAGCAGTAACAAGG + Intergenic
1071746130 10:88421440-88421462 GAGTGACTGCATGAGGGACAAGG - Intronic
1072451401 10:95542035-95542057 GGTTGGAGGCAGAAGGAACATGG - Intronic
1073154071 10:101332701-101332723 GGTTGAGGGCAGGAGGGGCAAGG - Intergenic
1074477288 10:113784665-113784687 ATCTGACTGCAGGTGGAACAGGG + Intergenic
1075447539 10:122524185-122524207 TGTTGTCTGCAGGAGTAACTGGG + Intergenic
1076509115 10:130999639-130999661 GGATGGATGCAGGAGAAACAGGG - Intergenic
1077017945 11:405169-405191 GGGTGACTGGAGTAGGAACAGGG + Intergenic
1077846122 11:6026819-6026841 GGTTCAATGCAGGAGGAATAAGG + Exonic
1077849099 11:6057357-6057379 GATTGAGTGCAGGTGGCACAAGG + Intergenic
1078116887 11:8462557-8462579 GGTTAACTGAGGGAGAAACAGGG + Intronic
1078353105 11:10611545-10611567 GGTTGAATTCAGGAGGAAGGTGG - Intronic
1078645463 11:13137941-13137963 GGATGACTGCTATAGGAACATGG + Intergenic
1079483893 11:20913625-20913647 AGCTGACAGCAGGAGGTACAGGG + Intronic
1083230049 11:61311498-61311520 GGTCGAATAGAGGAGGAACATGG - Intronic
1083655404 11:64226828-64226850 GGCTGAGTGCAGGCGGAACTTGG - Exonic
1083791314 11:64988172-64988194 GGCTGACAGCAGGAAGAGCAGGG - Exonic
1083881824 11:65552748-65552770 GGTTGACTGCAGGAGGAACAAGG - Intronic
1084705033 11:70811101-70811123 GGTTGACTCCAGGGGGAGCAAGG + Intronic
1088146560 11:106687555-106687577 GCTTGTCTCCCGGAGGAACATGG + Exonic
1091551346 12:1537420-1537442 GGTTTACAGCATGAGCAACAAGG - Intronic
1092511073 12:9157314-9157336 GGCTGACTCCAGGCAGAACAGGG + Exonic
1096501202 12:52064708-52064730 GGTTGATTCCAGGAGGAAGTGGG - Intergenic
1098035998 12:66302585-66302607 GGTTGAGTTCAGGAGAAGCATGG + Exonic
1101781628 12:107843627-107843649 GTTTGGCTCCAGGAGGAAGAAGG - Intergenic
1102031817 12:109744084-109744106 GGGTCCCTGCAGGAGGAAGATGG - Exonic
1102212228 12:111135985-111136007 GGTTGACTGAAGGAGGAGTGAGG + Intronic
1102599416 12:114017851-114017873 GATTGTCTCCAGGAGGAACTGGG - Intergenic
1117126773 14:52637329-52637351 GCTTCAGTGCAGGATGAACAGGG - Exonic
1117653732 14:57932980-57933002 GGTTGATTTCAGCAGGAAAATGG - Intronic
1121337578 14:93086651-93086673 GGGGGACAGCAGGAGGCACAGGG + Intronic
1122334711 14:100963970-100963992 GGCTGTCTGCAGTAGGAGCATGG + Intergenic
1122383165 14:101324686-101324708 GGCTGACTGGAGGAGGAAGCTGG - Intergenic
1122762575 14:104040467-104040489 GGGTGACTCCAGGAGGGACAAGG - Intronic
1123072064 14:105646796-105646818 GGTGGGAGGCAGGAGGAACAGGG - Intergenic
1123091795 14:105745260-105745282 GGTGGGGTGCAGGAGGAGCAGGG - Intergenic
1123097464 14:105773295-105773317 GGTGGAAAGCAGGAGGAGCAAGG - Intergenic
1126069658 15:44854837-44854859 GGTTGGCTGGAGGAGGGAAAAGG - Intergenic
1126088873 15:45034325-45034347 GGTTGGCTGGAGGAGGGAAAAGG + Intronic
1127364004 15:58270143-58270165 GGGACACTGCAGGAGGAAAAGGG + Intronic
1128609425 15:69062122-69062144 GATTGGCTGAAGGAGGAAGATGG - Intronic
1128918804 15:71592282-71592304 GCTTCACTGCTGGTGGAACATGG - Intronic
1129472733 15:75764331-75764353 GGTTGACTGCAGCCGGCACCAGG + Intergenic
1130843494 15:87723467-87723489 GGATGAATGCTGGAAGAACAAGG + Intergenic
1132144624 15:99421569-99421591 GGTTGACTGGGGGAGGGAGAGGG + Intergenic
1132284535 15:100652603-100652625 GCTTAACTGAAGGAGTAACAGGG + Intergenic
1134412909 16:14018108-14018130 GGTGGATTTCAGGAGGCACATGG - Intergenic
1136220736 16:28826448-28826470 GTTTGTGTGCAGGTGGAACATGG + Intronic
1138547085 16:57726311-57726333 GGTCGGCTGCAGGAGGAACCGGG + Intronic
1138898713 16:61242441-61242463 GGTTAAATCCAGGAGGAACCAGG + Intergenic
1140045306 16:71436706-71436728 GGGTGACTGTGGGAGGGACACGG + Intergenic
1140767059 16:78169750-78169772 CGTTGTTTGCAGGAGGAAAAGGG + Intronic
1141864688 16:86741974-86741996 GTTTGTCTGCTGGAGGAAGAGGG - Intergenic
1142378547 16:89719248-89719270 GGTTAGCTGCAGCCGGAACACGG + Intronic
1142468131 17:147506-147528 GTTTGACTGCCTGAAGAACAAGG - Exonic
1143163548 17:4886385-4886407 GGATGGGTGCAGGAGGAAGAGGG - Intronic
1143660611 17:8322370-8322392 CCCTGACTGCAGGAGGCACAGGG + Exonic
1143916614 17:10298412-10298434 GGGTGACAGCAAGAGGCACAGGG - Intronic
1146013904 17:29217417-29217439 GGTCAACTGCAGGAGGAAACTGG + Intergenic
1147248713 17:39139633-39139655 TGGTGAGTGCTGGAGGAACATGG - Exonic
1148196509 17:45717037-45717059 GGGAGACTGCAGGAAGAACTGGG + Intergenic
1149082415 17:52674940-52674962 GGCTGACTGCGGAAGTAACAAGG + Intergenic
1150496404 17:65611222-65611244 GGTTGGCTGCAGCTAGAACAGGG + Intronic
1151182213 17:72337490-72337512 GGATGACAGGAGGAGGAAGATGG - Intergenic
1151665302 17:75542286-75542308 CTTTGACTGCAGGAGGGAGAGGG - Intronic
1151830901 17:76549915-76549937 GGTTGACTGCAAGGGTAAGAAGG + Intronic
1153498235 18:5721863-5721885 GCTTTACTGAAGGAAGAACAGGG + Intergenic
1153776734 18:8461087-8461109 GGTAATCTCCAGGAGGAACACGG - Intergenic
1155257104 18:24008355-24008377 CCCTGACTGCAGGAGGAAGAAGG - Intronic
1156467139 18:37354718-37354740 GGGGGACTTCAGGAGGAAAAGGG + Intronic
1158783763 18:60683873-60683895 GATTGACTACAAGAGGCACAAGG + Intergenic
1161861385 19:6800988-6801010 GGTTAAATGCAGGAGGCACCTGG - Intronic
1162896322 19:13766531-13766553 CGTGGACTCCAGGAGGAACTGGG + Intronic
1162964478 19:14149423-14149445 GGTTGATGGCAGAAGGAAAATGG - Exonic
1163170882 19:15530286-15530308 TGTGGACTGCACGAGGAAGAAGG - Intronic
1163558831 19:18007337-18007359 GGATGACTGGAGCAGGCACAAGG + Intronic
1164829452 19:31309328-31309350 CCTTGCCTGAAGGAGGAACATGG + Intronic
1165249476 19:34517725-34517747 AGTTAACTGCAGCAGGAGCATGG - Intergenic
1165304085 19:34992764-34992786 GCTTGTCTTCAGGAGGAAGAGGG + Intergenic
1167396552 19:49233172-49233194 CTTTGACAGCAGGAGGAACTGGG + Intergenic
925220057 2:2131844-2131866 CGTTCTCTGCAGGAGGTACATGG + Intronic
925786513 2:7436379-7436401 GGTTCACTGCCGTGGGAACATGG - Intergenic
925941752 2:8827396-8827418 TGGTGACAGCAGGAGGAGCAGGG - Intronic
925975639 2:9140135-9140157 GGGTGACCCCAGGAGGGACAGGG + Intergenic
930112284 2:47688827-47688849 GAATGAGTGCAGGAGGAAAAGGG - Intergenic
931206146 2:60147712-60147734 GACTGGCTGCAGGTGGAACATGG + Intergenic
932124382 2:69130339-69130361 GCCTGACTGCAGTAGCAACAAGG + Intronic
932189224 2:69725049-69725071 GGCTGACTGCAGGAGTCAGAGGG - Intronic
932518414 2:72379620-72379642 CTTTGACTGCATTAGGAACAAGG + Intronic
932562007 2:72881416-72881438 GGAAGACTGCAGAAGGAGCAGGG - Intergenic
932755800 2:74408428-74408450 GGTGAACTGTAGGAGGAACATGG + Intergenic
933358393 2:81244591-81244613 GGTGGATTGGAGCAGGAACAAGG - Intergenic
933891113 2:86771000-86771022 GGTTACCTGCTGGAAGAACAAGG - Intronic
936081700 2:109436892-109436914 GGGTGCCTGCAGGAGGGGCAGGG + Exonic
936363204 2:111826337-111826359 GATTGACTACAAAAGGAACAAGG - Intronic
937096176 2:119236634-119236656 GGATGACTTTAGGAGGAAGAGGG + Intronic
940543551 2:155053667-155053689 GGGTGATGGCAGGGGGAACAGGG - Intergenic
940620579 2:156107995-156108017 GGATGGGTGAAGGAGGAACACGG + Intergenic
943634590 2:190291769-190291791 GATTGACTGGAGGAGGAATATGG - Intronic
944488700 2:200234617-200234639 GCTTGACTGGAGAAGGATCAGGG + Intergenic
945450128 2:209984839-209984861 GGTTCACTGCAGGAGGGGTAGGG - Exonic
946305986 2:218857363-218857385 GACTGAGTGCAGGAGGGACAAGG + Intergenic
946569860 2:221012540-221012562 AGTAGACTGTAGGAGAAACATGG + Intergenic
948738798 2:240029544-240029566 GATTTACTGCCTGAGGAACAAGG - Exonic
1168832387 20:853705-853727 GGGAGACTGGAGGAGTAACAAGG - Intronic
1171045918 20:21809358-21809380 GGATGGCTGCAGGAGGCACAGGG + Intergenic
1171284779 20:23928211-23928233 ACTTGCCTGCAGGAGGCACAAGG - Intergenic
1173873278 20:46354922-46354944 GAGTGGCTGCAGGTGGAACATGG + Exonic
1175538633 20:59733964-59733986 GGCAGACTGTAGGGGGAACAAGG - Intronic
1176309220 21:5140977-5140999 GTTTGACAGCTGGAGGACCAAGG - Exonic
1178744033 21:35230455-35230477 GAATGACTGCATGAGGAATAAGG + Intronic
1179731168 21:43368050-43368072 GGATGACTGGGGGAGGAACAGGG + Intergenic
1179786726 21:43734515-43734537 GGTGGACAGCAGGAGTCACACGG - Intronic
1179847841 21:44121056-44121078 GTTTGACAGCTGGAGGACCAAGG + Exonic
1180081489 21:45489724-45489746 GTTTGACTGCGTCAGGAACATGG + Intronic
1180578884 22:16810457-16810479 GGGTGATAGCAGGAGGAATAGGG - Intronic
1181953157 22:26569318-26569340 GGGTAACTGCAGGGGGAGCAAGG + Intronic
1182505926 22:30782308-30782330 GGTTGTCTGCAGGAGGTGGAAGG - Intronic
1183526792 22:38327797-38327819 GGTTGACTGCAGCACAAACAAGG - Intronic
1184246476 22:43238214-43238236 GGTTGAAGGAAGGAGGGACAGGG - Intronic
949687824 3:6598084-6598106 GGTTGCCTTCAGGAGCAAAATGG - Intergenic
949915666 3:8962417-8962439 TGATGACAGCAGGAAGAACAAGG + Intronic
950142126 3:10622675-10622697 GGTTGACTGTAAGAGGATCCAGG - Intronic
950184327 3:10935908-10935930 GGTTGTCTGGGGGTGGAACAGGG - Intronic
950840426 3:15963580-15963602 GCTTGACTGAAGGAGGGAAAGGG + Intergenic
951563341 3:23989272-23989294 GTCTGCCTGCAGGAGGACCAAGG + Intergenic
951578129 3:24134332-24134354 GGGTGACAGCAGGAGACACATGG - Intronic
953932274 3:47011408-47011430 GGCTGTGTGCAGGAGGAATATGG - Intergenic
959594460 3:108114256-108114278 GATTGACTGCAGGGGTATCAAGG + Intergenic
959672211 3:108991390-108991412 GGTTGAGTGCAGGATGAGAAAGG + Intronic
959922266 3:111881522-111881544 AGTTCACTGCAGTAGCAACAGGG + Intronic
961002721 3:123384820-123384842 GGTTGGCTCCAGGAATAACAAGG - Intronic
961044777 3:123700871-123700893 GGTTGGCTAGAGGAGGAAGACGG - Exonic
961959145 3:130835774-130835796 GGTTGAGTCCAGGAGAAACCAGG - Intergenic
964743579 3:159990720-159990742 GGTGGGCAGCAGGAGGGACAAGG - Intronic
965342311 3:167504897-167504919 GGGTGACAGCAGGAGCAAGAGGG - Intronic
965998929 3:174923082-174923104 GGTTGATTCCAGAAGGGACAGGG + Intronic
966709295 3:182953938-182953960 AGCTGAATGCAGGATGAACATGG + Intronic
967669266 3:192213020-192213042 GTTTTGCTGCAGGAAGAACATGG - Intronic
969955596 4:10887522-10887544 GGGTGACTGGAGGAAGAATAAGG + Intergenic
970025190 4:11616512-11616534 GGTTCACTGCAGTAGCACCAGGG - Intergenic
970799448 4:19954737-19954759 GTTAGACTTCAGGAGCAACAGGG + Intergenic
971000287 4:22315061-22315083 GGTTGACTGCAGGACTTCCAGGG - Intergenic
972982125 4:44717714-44717736 GGATGAATAGAGGAGGAACATGG - Intronic
974003971 4:56537474-56537496 GGGAGACTGAAGGAAGAACAAGG - Intronic
976974328 4:91148059-91148081 GGTTGACTAGAGTAGTAACATGG + Intronic
978128372 4:105162408-105162430 GCCTGACTGCAGGGGAAACATGG + Intronic
979962465 4:127036987-127037009 AGTTTGCTGCATGAGGAACAGGG - Intergenic
980107131 4:128598868-128598890 GGAGAACTGCAGGAAGAACAAGG + Intergenic
981112115 4:140947514-140947536 GGTTGTCTGCAATAGAAACATGG + Intronic
981327940 4:143473570-143473592 GGCTGGCTGGAGGAGTAACAGGG - Exonic
984504410 4:180598861-180598883 GCTTGACTGCAGGAATGACATGG - Intergenic
984591973 4:181627031-181627053 GTTTCCCTGCAGGAGAAACATGG + Intergenic
990325466 5:54671062-54671084 GTGTGAATCCAGGAGGAACATGG + Intergenic
997779441 5:136641808-136641830 GGTTCACTACAGGAGGAAATGGG + Intergenic
998540119 5:142973096-142973118 AGTTAACTGCAGGATGAAAATGG + Intronic
1000026284 5:157361873-157361895 GGTTTACTGCAGGAGAAAGGAGG + Intronic
1002053213 5:176583729-176583751 AGTTGTGTGCAGGAGGGACAGGG + Intronic
1002621378 5:180491039-180491061 GCCTGACTGCAGTAGAAACAAGG + Intergenic
1003469027 6:6411239-6411261 GGTTGAAAGCAGGAAGCACAGGG + Intergenic
1003914310 6:10771286-10771308 GGTGGATGGTAGGAGGAACAGGG + Intronic
1005165664 6:22917271-22917293 TGTTGAATGCAGGAGACACACGG - Intergenic
1006154372 6:32006349-32006371 GCTTGTCTGCAGGAGGAGCTGGG - Intergenic
1007301217 6:40869328-40869350 GGAGGGCTGCATGAGGAACATGG + Intergenic
1007605735 6:43116566-43116588 GCTTGAGTGGAGGAGGAAGAAGG + Intronic
1009313459 6:62187908-62187930 GATTGTCAGCAGTAGGAACATGG + Intronic
1011744692 6:90398139-90398161 GTGTGACTGCAGCAGGCACAGGG + Intergenic
1012265944 6:97143303-97143325 GGCTGAGTGTAGGATGAACATGG + Exonic
1012912261 6:105131859-105131881 GGATTACAGCAGTAGGAACAGGG - Intronic
1014639136 6:123887585-123887607 GGTTGAGAGCATGAGCAACAGGG - Intronic
1015462872 6:133512959-133512981 GGTTGACTGGATGAGGAAGTTGG + Exonic
1015649857 6:135444512-135444534 GGGTGAGTGAAGGAGGGACAAGG - Intronic
1016083005 6:139878491-139878513 GCTTGACTTCAGAAGGAAGACGG - Intergenic
1018232961 6:161693403-161693425 GGTTGACTACAGGTGGACCAAGG + Intronic
1018558279 6:165072900-165072922 GGTTGACCCCAGGGGGCACAGGG + Intergenic
1018812604 6:167308557-167308579 GGTGGGGTGCAGGAGGAACCAGG + Intronic
1018832361 6:167452914-167452936 GGAGGGCTGCAGGAGGAACAGGG + Intergenic
1020278049 7:6636781-6636803 GGTTGAGTGCAGGAGGAGACTGG - Intergenic
1022944848 7:35272201-35272223 GGTTGACTGCAGGAGGCATATGG - Intergenic
1027132250 7:75599331-75599353 GGTTGGCTGGAGGAGGAGAAAGG - Intronic
1029608106 7:101611730-101611752 GGCTGAGTGCAGGAAGAATAAGG + Intergenic
1029950765 7:104583010-104583032 GCTTGACTGAAGGGGGAACATGG - Intronic
1030271455 7:107673100-107673122 GCTTGACTAGATGAGGAACATGG + Intronic
1030630903 7:111894625-111894647 GGCTGACTCCAGGAGCCACAAGG + Intronic
1032810722 7:135413608-135413630 AGATGCCTGCAGGAGGAAGAGGG + Exonic
1033239332 7:139664107-139664129 GTTTGACTTCAGGAGAAACCTGG - Intronic
1034278435 7:149834879-149834901 GGCTCTTTGCAGGAGGAACAGGG - Intergenic
1034315439 7:150126817-150126839 GGTTGTCTGCAGGACTAACAAGG + Intergenic
1034384967 7:150733363-150733385 GGTTGACTGGAGGTGGAGAAGGG - Intronic
1034536294 7:151727926-151727948 GCATGACTGCAGGAGGAGGAAGG - Intronic
1034791451 7:153973977-153973999 GGTTGTCTGCAGGACTAACAAGG - Intronic
1035551722 8:533116-533138 GGTTGAGACCAGGAAGAACAAGG - Intronic
1035831237 8:2696896-2696918 CCTTGACTGGAGGAGGACCAAGG - Intergenic
1037993423 8:23336549-23336571 GCTGGACTGTAGGAAGAACACGG + Intronic
1038598479 8:28913064-28913086 GGGTGACTATAGGAGGAAAAGGG - Intronic
1039089667 8:33814414-33814436 GGTTATCTGCAGGAGTAACTGGG + Intergenic
1043494346 8:80783652-80783674 GGTTGAGGGAAGGGGGAACATGG - Intronic
1045972455 8:108094426-108094448 GGGTAACTTCTGGAGGAACAGGG + Intergenic
1046594215 8:116241396-116241418 GTTTGACTGCAGTTAGAACAAGG + Intergenic
1048176018 8:132153675-132153697 TGTTGACAGCAGGAGAAAGAGGG + Intronic
1048270209 8:133022234-133022256 GCTTGGCTGGAGGAGGAGCAGGG - Intronic
1048489840 8:134882572-134882594 GGGTGACTGCAGGAAGCACTTGG + Intergenic
1049244015 8:141551850-141551872 TGGTGCCTGCAGGAGGGACATGG - Intergenic
1049684984 8:143935740-143935762 GGAGGAGGGCAGGAGGAACAGGG - Intronic
1049978460 9:882298-882320 GGTCCACTGCAGGAGGAGAATGG - Intronic
1050690976 9:8225525-8225547 GGTTTGCTGAAGGAGGAAGATGG - Intergenic
1052736886 9:32351994-32352016 GGGAGACTGGAGGAGGAAGAGGG - Intergenic
1056746034 9:89303881-89303903 GATTGACTGCAGGAGCAACACGG - Intergenic
1057119831 9:92561275-92561297 GGGGGATTGCGGGAGGAACAGGG - Intronic
1057309631 9:93933900-93933922 GGTGGAATACAGGAGGGACAGGG - Intergenic
1057420951 9:94911984-94912006 GGTTGACTGGAAGGGGCACAGGG - Intronic
1058680062 9:107432858-107432880 GGTTGACTGTTGCAGAAACAGGG + Intergenic
1058694148 9:107545146-107545168 GGTAGGCTGGAGGAGGAAAAAGG - Intergenic
1059155189 9:111983282-111983304 GGTTTTCTGGAGGAGGAAGATGG + Intergenic
1060027912 9:120188489-120188511 AAATGACTGGAGGAGGAACAAGG - Intergenic
1062521963 9:136961667-136961689 TGTTTTCTGCAGGAGGAAGAAGG + Intergenic
1185644908 X:1609591-1609613 ATTTGGCTGCAGTAGGAACAGGG - Intergenic
1185644996 X:1609902-1609924 GTTTGGCTGCAGTAGGGACAGGG - Intergenic
1185645015 X:1609971-1609993 GCTTGGCTGGAGGAGGAGCAGGG - Intergenic
1185830657 X:3299689-3299711 GGTGGAAGGCAGGAGGTACAGGG + Intergenic
1186071863 X:5829734-5829756 GGTTGACTTTAGGAGGATAATGG + Intergenic
1186898299 X:14027383-14027405 GGATGTCTGCAGGTGGAAGAAGG - Intronic
1190108882 X:47577202-47577224 GGCTGAATGCAGGAGGAAAAAGG + Intronic
1192318043 X:70067103-70067125 GCTTGGCTGCAGGAGGGGCATGG + Intergenic
1194543563 X:95204731-95204753 AGTTATCTGCAGCAGGAACATGG - Intergenic
1194713390 X:97262580-97262602 GGATGACTGGATGAGGAAGAAGG + Intronic
1196970251 X:121100225-121100247 GGTTTACTGGATGAGGACCAGGG - Intergenic
1197155809 X:123269075-123269097 GGGTGAGTACATGAGGAACATGG - Intronic
1198229338 X:134674515-134674537 GGTTGAATGCTGTAGGAACCAGG - Intronic
1198570090 X:137945650-137945672 GGTTGATGGCAGGAGCTACAGGG + Intergenic
1199986757 X:152958376-152958398 GTTGAACTGCAGCAGGAACAAGG + Intronic
1201247275 Y:12017238-12017260 GGTGGACAGCCGGAGGTACAGGG - Intergenic
1201852240 Y:18498158-18498180 GGGTGACAGCAGGAGAAACAGGG + Intergenic
1201881081 Y:18822226-18822248 GGGTGACAGCAGGAGAAACAGGG - Intronic