ID: 1083882496

View in Genome Browser
Species Human (GRCh38)
Location 11:65555445-65555467
Sequence GTGGAGACACTGAGCTAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 1, 2: 0, 3: 27, 4: 243}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083882496_1083882504 4 Left 1083882496 11:65555445-65555467 CCTTCCTAGCTCAGTGTCTCCAC 0: 1
1: 1
2: 0
3: 27
4: 243
Right 1083882504 11:65555472-65555494 AGGGAGGCTTTCCTCCTATCCGG 0: 1
1: 0
2: 0
3: 10
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083882496 Original CRISPR GTGGAGACACTGAGCTAGGA AGG (reversed) Intronic
900546440 1:3231825-3231847 GTGGAGAAGCTGAACCAGGAAGG - Intronic
900792348 1:4688910-4688932 GTGGAGAAACTGAGGCAGGGAGG + Intronic
901185193 1:7368350-7368372 GTGCAGACACTGGGCATGGATGG + Intronic
904799883 1:33084957-33084979 GTGTAGTCACTGTGCTAGGCAGG + Intronic
905015377 1:34774622-34774644 GTGGCGATGCTGAGCTAGAAGGG + Intronic
905226507 1:36482560-36482582 TTGGGGACACTGAGCTGGGCTGG - Intronic
905463249 1:38134838-38134860 GCAGAGACACTGAGCTTGCAGGG + Intergenic
906058749 1:42935033-42935055 GTGAAGAGACTGGGCTGGGAAGG - Intronic
906300614 1:44678719-44678741 GTGGGGACAGTGAGCCAGGCTGG + Intronic
907125658 1:52048399-52048421 GAGGATACAGTGAGCTATGATGG + Intronic
908582839 1:65535470-65535492 GTGGGGACACTGAGGCAGGAGGG - Intronic
910362618 1:86429210-86429232 GTGGAGACAGTGAGATGGGAAGG + Intronic
911056826 1:93715930-93715952 GTGGTGACAGGGAGCAAGGATGG + Intronic
912006501 1:104908375-104908397 GTGGAGTCACTGATCTAATATGG - Intergenic
912261754 1:108117933-108117955 TTGGAGAAACTGGACTAGGAAGG + Intergenic
916692216 1:167201337-167201359 GAGGATCCACTGAGCTGGGAAGG + Intergenic
916998374 1:170326963-170326985 GTGGAGACACTGAAGGAGGCAGG + Intergenic
919878544 1:201888094-201888116 GTGGAGACAGTGTTTTAGGATGG - Intergenic
919918953 1:202156915-202156937 GGGAGGACACTGTGCTAGGAGGG - Intronic
920945660 1:210526126-210526148 GTGGTGACACCGAGCTTGGAGGG + Intronic
921588492 1:216976511-216976533 ATGGAGACACTGGGTTATGAAGG - Intronic
922975335 1:229779269-229779291 GAGCAGACACTGAGCTAGGTGGG - Intergenic
924401572 1:243688588-243688610 GATGAAGCACTGAGCTAGGATGG + Intronic
1062851133 10:744176-744198 GTGGAGACACTGGGCTGGGTGGG + Intergenic
1062851193 10:744320-744342 GTGGAGACACTGGGCTGGGTGGG + Intergenic
1062851207 10:744356-744378 GTGGAGGCACTGGGCTGGGTGGG + Intergenic
1062851214 10:744374-744396 GTGGGGACACTGGGCTGGGTGGG + Intergenic
1062851221 10:744392-744414 GTGGGGACACTGGGCTGGGTGGG + Intergenic
1062851244 10:744446-744468 GTGGGGACACTGGGCTGGGTGGG + Intergenic
1063973108 10:11395336-11395358 ATGGGGACACGGTGCTAGGAGGG - Intergenic
1066182014 10:32971800-32971822 GTGGACTGACTGAGCCAGGACGG + Intronic
1068508219 10:57929823-57929845 GTAGAGACACTGACCTTGCATGG - Intergenic
1070045740 10:72834470-72834492 TAGGAAACACTGAGCTAAGAAGG - Intronic
1070758648 10:79009305-79009327 GTGTGGCCACTGAGCCAGGAGGG + Intergenic
1071140846 10:82507614-82507636 GGTCAGACACTGAGATAGGATGG - Intronic
1071946515 10:90652041-90652063 GTGAAGACAGTGAGGTAGAAGGG + Intergenic
1073126319 10:101152452-101152474 GTGGAGACTCCTAGCCAGGATGG - Intergenic
1073793857 10:106966704-106966726 GTGGAGAAACAGAGTCAGGAGGG - Intronic
1074034598 10:109725527-109725549 TTTGAGAAAATGAGCTAGGAGGG + Intergenic
1074676817 10:115860594-115860616 GCAGAAACACAGAGCTAGGAAGG + Intronic
1075257770 10:120939182-120939204 CTGGTGACACTGAGGCAGGAGGG - Intergenic
1075547086 10:123363147-123363169 GGGAAGACCCTGAGGTAGGAAGG + Intergenic
1075996236 10:126878477-126878499 GTGCAGACAGAGAGCCAGGATGG - Intergenic
1076888783 10:133274227-133274249 GTGCAGGCCCTGAGCGAGGAGGG + Exonic
1077370709 11:2180417-2180439 GTGGGGAGACTGAGCTTGGCCGG - Intergenic
1078509963 11:11977657-11977679 GTGGAGCCACTGAGCCTGGCCGG + Intronic
1078608189 11:12796076-12796098 GTGCAGAAACTGGGCCAGGAGGG + Intronic
1080338334 11:31225907-31225929 CAGGAAACACAGAGCTAGGAAGG + Intronic
1081160987 11:39748023-39748045 GGGAATCCACTGAGCTAGGATGG - Intergenic
1083882496 11:65555445-65555467 GTGGAGACACTGAGCTAGGAAGG - Intronic
1084174151 11:67415107-67415129 GTGGAGACCCTGGCCCAGGAGGG + Intronic
1085250700 11:75141778-75141800 GAGGCTACAGTGAGCTAGGATGG + Intronic
1085814456 11:79722054-79722076 GTGGAGACACCAAGTTGGGATGG - Intergenic
1086061433 11:82703578-82703600 GTGCAGACACTGAGCTAGGAGGG - Intergenic
1086794516 11:91083890-91083912 ATGGGGACCCTGGGCTAGGAAGG - Intergenic
1087140490 11:94760885-94760907 GAGGTTACAGTGAGCTAGGATGG - Intronic
1089214934 11:116829639-116829661 GGGGAGCCAGTCAGCTAGGAAGG + Intergenic
1089330559 11:117686170-117686192 GTGGAGAGATGGAGCTGGGAAGG + Intronic
1092847352 12:12596082-12596104 GTGGAGAGAATGAGTTAGGGTGG + Intergenic
1092847357 12:12596123-12596145 GTGGAGAGAATGAGTTAGGGTGG + Intergenic
1093029738 12:14277244-14277266 GTGGAGAAACAGAGATAGAAGGG - Intergenic
1093438135 12:19161503-19161525 GTGGAGACACGGAGATGGGGTGG - Intronic
1098521655 12:71440261-71440283 GTGAAGACGCTGAGGTTGGAAGG - Exonic
1100301241 12:93309870-93309892 GGGGAGCCCTTGAGCTAGGATGG + Intergenic
1100473881 12:94917900-94917922 ATTGAGACACTGAGGCAGGAGGG + Intronic
1101521355 12:105485237-105485259 GTAGAGTCTCTGAGCAAGGAGGG + Intergenic
1102876571 12:116453867-116453889 CCAGAGACACAGAGCTAGGATGG - Intergenic
1103560728 12:121792182-121792204 GGTCAGACACTGACCTAGGATGG - Intronic
1104354466 12:128073050-128073072 GGGGAGAGACTGAGCAAGAAAGG + Intergenic
1104408620 12:128539641-128539663 GTGGAAACACTGAGCTCATAGGG + Intronic
1104721182 12:131045986-131046008 GGGAGGACACTGAGCAAGGAGGG - Intronic
1107383310 13:39879740-39879762 GTGGAAACAGTGGGCTAAGACGG - Intergenic
1108404369 13:50084665-50084687 GTGGGGACAATCAGCTAGGGGGG + Intronic
1110842602 13:80159594-80159616 GAGGATACTCTGAGCTAGGGAGG + Intergenic
1113834581 13:113320297-113320319 GTGGAGGACCTGAGCTAGGGTGG + Intronic
1115365518 14:32552807-32552829 GTGGACACACTGAGAAAGAAGGG + Intronic
1115758786 14:36557011-36557033 GTGGAGGCACAGTGCTCGGAGGG + Intergenic
1117366964 14:55038661-55038683 TTGGAGAAACTGAACTAGGTGGG - Intronic
1119558513 14:75571575-75571597 TTGGAGACTCTGAGCTGGGAGGG + Intergenic
1122772897 14:104105120-104105142 CTGGAGACCCTGAGCTGGTAGGG + Intronic
1126344055 15:47674572-47674594 GTGCAGCCACTGTGCTTGGAAGG + Intronic
1126758768 15:51950119-51950141 GTGGAGCCACAGAGGTGGGATGG - Intronic
1127276007 15:57444753-57444775 GTGGGAACACAGAGCCAGGATGG + Intronic
1127466266 15:59247765-59247787 GTAGAGCCACTGAACTAGTAAGG + Intronic
1127788092 15:62373742-62373764 GAGGAGAGACTGAGGTAAGAGGG + Intergenic
1129034430 15:72640930-72640952 GAGGAGACGCTGGGCTTGGATGG + Intergenic
1129215452 15:74096286-74096308 GAGGAGACGCTGGGCTTGGATGG - Intergenic
1129732597 15:77940615-77940637 GAGGAGATGCTGAGCTTGGATGG - Intergenic
1130298606 15:82664068-82664090 GTGGGGAGCCTGAGCCAGGAGGG + Intronic
1130554126 15:84910925-84910947 TTGGACAGACTGAGCTAGGCAGG + Intronic
1130972026 15:88741196-88741218 GTGGAGAAACTGTGGAAGGATGG + Intergenic
1132609382 16:807647-807669 GTGGGGAAACTGAGGTAAGACGG + Intronic
1133281345 16:4667154-4667176 GTGGAGAGCCTGGGCTAGGCAGG - Intronic
1134511864 16:14854978-14855000 GTGGAGGGAATGAGCAAGGAAGG + Intronic
1134699507 16:16253477-16253499 GTGGAGGGAATGAGCAAGGAAGG + Intronic
1134972322 16:18541194-18541216 GTGGAGGGAATGAGCAAGGAAGG - Intronic
1135106113 16:19651334-19651356 GTGGTTACAGTGAGCTATGATGG - Intronic
1135844549 16:25907129-25907151 GTGGTTACAGTGAGCTATGATGG + Intronic
1135885408 16:26301605-26301627 ATGGAGGCACTGAGGTGGGATGG + Intergenic
1135889646 16:26345622-26345644 GAGGATGCAGTGAGCTAGGATGG + Intergenic
1139605361 16:68014330-68014352 GTGGAGAAACTCAGGTAGGCTGG - Intronic
1139833775 16:69821931-69821953 GAGGCTACACTGAGCTATGATGG - Intronic
1142157211 16:88538036-88538058 GAGGAGACAGTGAGCCAGGGGGG - Intergenic
1142742693 17:1940424-1940446 GAGGGGAAACTGAGGTAGGAGGG - Intronic
1143524481 17:7464044-7464066 GTGGAGGCACTGAGCTCAGACGG - Intronic
1144022348 17:11248607-11248629 GTGGAAACAGTGAACCAGGAGGG - Intronic
1144480654 17:15626300-15626322 CAGGTGACACTAAGCTAGGAAGG + Intronic
1144888795 17:18481790-18481812 GTGTGTACACTGAGCTAGGATGG + Intronic
1144917654 17:18737441-18737463 CAGGTGACACTAAGCTAGGAAGG - Intergenic
1145143412 17:20462508-20462530 GTGTGTACACTGAGCTAGGATGG - Intronic
1145792429 17:27636119-27636141 GTGTGTACACTGAGCTAGGATGG + Intronic
1145807314 17:27743992-27744014 GTGTGTACACTGAGCTAGGATGG + Intergenic
1146134098 17:30303604-30303626 GAGGAGACACTGAGCTTCAAAGG + Intergenic
1146936824 17:36817274-36817296 GAGGAGAGGCTGAGCTAGAAGGG + Intergenic
1149371187 17:55994719-55994741 GAGGTGACAGTGAGCTATGATGG - Intergenic
1151185880 17:72363607-72363629 GTGGGGAAGCTGAGCTAGGAAGG - Intergenic
1152187328 17:78865946-78865968 GTGACGAAACTGAGCTGGGACGG + Intronic
1155710083 18:28865945-28865967 GTGTAGTCTTTGAGCTAGGATGG + Intergenic
1157941290 18:51931620-51931642 GTGAAGACACTGAGGCATGATGG + Intergenic
1159005171 18:63004663-63004685 GTGGAGACCCAGAGCCAGGAGGG + Intergenic
1160119111 18:76111549-76111571 GTGGAGAGACTGACTTAGGATGG + Intergenic
1161269541 19:3382294-3382316 GTGGTGACACGGGGCCAGGAGGG + Intronic
1161364060 19:3868431-3868453 GAGAAGACACAGACCTAGGAGGG - Intronic
1161791123 19:6360926-6360948 GAGGCCACATTGAGCTAGGATGG + Intergenic
1161868025 19:6848899-6848921 CTGGGGAGGCTGAGCTAGGAGGG - Intronic
1162398924 19:10432930-10432952 CTGGAGACACTGAGCCAGGCAGG - Intronic
1162514413 19:11139292-11139314 GTGGAGACTGTGAGCCAGGCAGG - Intronic
1162931234 19:13958979-13959001 CTGGGGACACTGAGCGAGGCTGG + Intronic
1163295295 19:16407879-16407901 GTGGAGACCCTGGGCCAGAAGGG + Intronic
1163306414 19:16482312-16482334 GAGGCTACAGTGAGCTAGGATGG + Intronic
1163382800 19:16979854-16979876 GTGAGGACACTGAGATAGGTAGG - Intronic
1165382233 19:35489616-35489638 GTGGTGTCACTGAGCTGGGGGGG - Intronic
1165940936 19:39414388-39414410 GTGGATCCTCTGAGCTCGGAAGG + Intronic
1166679578 19:44758643-44758665 CTGGATCCAGTGAGCTAGGAGGG + Intronic
1167796906 19:51715390-51715412 GTGGAGTGCCTGAGGTAGGATGG - Intronic
924990613 2:309603-309625 GTGGAGACAGTGTGCTGGGGTGG + Intergenic
925027910 2:624169-624191 GGGAAGACTCTGAGCTAGGGAGG + Intergenic
925877973 2:8328402-8328424 GGGCTGACACTGAGCTAGGGTGG - Intergenic
927228518 2:20796117-20796139 GTGAAGACACTGAGAATGGAGGG - Intronic
927458266 2:23276046-23276068 ATGGAGAGACTGAGGAAGGAAGG - Intergenic
927758228 2:25725902-25725924 GAGGATACAGTGAGCTATGATGG - Intergenic
928923292 2:36548979-36549001 GTGGGGACAGTGAGTTTGGATGG + Exonic
929505891 2:42527745-42527767 CTCAAGACACTGAGGTAGGAGGG + Intronic
930257038 2:49104783-49104805 GTGGAAATACTGGGCTGGGATGG - Intronic
930519342 2:52444407-52444429 GTGGGAACACTGAGGCAGGAGGG - Intergenic
931480798 2:62637607-62637629 GTAGAGACAGGGAGCCAGGATGG - Intergenic
934762801 2:96865633-96865655 CTGGGGACACCGAGGTAGGAGGG + Intronic
936061267 2:109297135-109297157 GTGGGGGCAGTGAGCTAGGGAGG + Intronic
938105341 2:128526247-128526269 GGGAAGACAGTGAGCCAGGAGGG - Intergenic
938628057 2:133133288-133133310 GCAGAGCCACTGAGCTGGGATGG + Intronic
938977537 2:136494365-136494387 GAGGAGAGAGTGAGATAGGAAGG + Intergenic
941644543 2:168025846-168025868 GTGAAGACACTGCCATAGGAAGG - Intronic
942952797 2:181740281-181740303 GTGCATACACTAAGCTACGATGG + Intergenic
944855545 2:203763805-203763827 GTGGAGAAAATGAGCCATGAAGG + Intergenic
944893966 2:204145307-204145329 TTGGAGACACTGGGTCAGGAAGG - Intergenic
947797180 2:232901881-232901903 CTGGAGACACGGAGCCTGGATGG - Intronic
948233076 2:236365978-236366000 TTGGAGTCACAGGGCTAGGAAGG - Intronic
1170118072 20:12882855-12882877 TTGTAGAGACTGAGCAAGGAGGG + Intergenic
1170948441 20:20912471-20912493 GATCAGACACTGAGCTAGCAGGG - Intergenic
1172057118 20:32161922-32161944 GTGGGGTCACAGAGTTAGGAGGG - Intronic
1172461010 20:35118739-35118761 GTGCAGCCACTGAGTGAGGAGGG - Intronic
1174338564 20:49882224-49882246 GTGGAGAAAATGAGCGAGCACGG - Intronic
1174784263 20:53418071-53418093 GAGGGGACCCTTAGCTAGGATGG + Intronic
1175740538 20:61416999-61417021 GTGGAGAGGCTGAGCTGGGGAGG + Intronic
1175922874 20:62458315-62458337 GTGGAGACTCTGAGATGTGATGG + Intergenic
1177656009 21:24018797-24018819 GTGGAGAAACTGAACTAGGGTGG - Intergenic
1178872949 21:36391362-36391384 GTAGAGACAGTTAGCCAGGATGG + Intronic
1179480303 21:41672544-41672566 ATGGAGAAACTGAGGCAGGACGG + Intergenic
1180080509 21:45485671-45485693 GTGGAGACCCAGACCTAGAAGGG + Intronic
1181579917 22:23822410-23822432 GTGGACTCACAGAGCTAAGACGG - Intronic
1183088465 22:35503639-35503661 GTGGAGACTCTGCTCTGGGAGGG - Intergenic
1184047940 22:41983375-41983397 AAGGAGACAGAGAGCTAGGAGGG - Intronic
949598400 3:5572547-5572569 GTGTAGAGACTGAGCTGGAAGGG + Intergenic
949767003 3:7537659-7537681 GTGCAGGCACTGGGTTAGGAGGG + Intronic
951778051 3:26332136-26332158 CTGGAGATACTGAGAGAGGAGGG + Intergenic
952992405 3:38843156-38843178 GAAGAGGCACTGAGCCAGGAAGG - Intergenic
954559546 3:51544969-51544991 ATGGTGACACTGAGCTCAGATGG - Intronic
958748613 3:98167433-98167455 GAGGAAACAATGATCTAGGATGG - Intergenic
959983582 3:112547027-112547049 GGGGAGAAACTGACCTAAGAAGG + Intronic
960623490 3:119658728-119658750 CTGGATAGAGTGAGCTAGGAGGG - Intronic
960717813 3:120594757-120594779 GATTAGACACTGATCTAGGAAGG - Intergenic
960885345 3:122388215-122388237 TTGGAGATACTGAGTAAGGAAGG + Intronic
963136274 3:141908254-141908276 GAGGAAAAACTGGGCTAGGATGG - Intronic
964496413 3:157295365-157295387 GTGGAGGCAGTGAGCTATGATGG + Intronic
966131890 3:176650760-176650782 CTGGAGTCACTGAGCAAGAATGG - Intergenic
966639432 3:182173177-182173199 GGGGATAAACTGAGCTAGAAGGG + Intergenic
967379892 3:188846080-188846102 GTGCAGACACTGTGCTAGTCAGG + Intronic
968149288 3:196324452-196324474 GGAGAAACACTGAGCTAAGACGG + Intronic
970159639 4:13175836-13175858 GAGGTGACACTGAGCTGAGATGG - Intergenic
970772937 4:19638124-19638146 GAGGATACAGTGAGCTATGATGG - Intergenic
972194157 4:36632456-36632478 GTGTAGACACACAGCTAAGAAGG + Intergenic
977335794 4:95697254-95697276 ATGAAAACACTGAACTAGGAAGG + Intergenic
981910870 4:149980495-149980517 TTTGAGACTCTGACCTAGGATGG + Intergenic
983197838 4:164826990-164827012 GAGGTGACAGTGAGCTATGATGG + Intergenic
985101631 4:186463866-186463888 GAGGTTACAGTGAGCTAGGAGGG + Intronic
985286534 4:188341835-188341857 TAGGAGAAACTGAGTTAGGACGG - Intergenic
986178031 5:5368551-5368573 GTGGAGACATTGAGGTAAAAAGG + Intergenic
986463075 5:7993158-7993180 GTTGAGACAGTGAGCTGTGATGG + Intergenic
986895029 5:12355053-12355075 GTGGAGACCCTGGGGTAAGAAGG - Intergenic
993707937 5:91192628-91192650 GAGGTTACACTGAGCTATGATGG + Intergenic
997382364 5:133446815-133446837 GTGGAGCCACAGAGCTGGGGAGG - Intronic
999574876 5:152964768-152964790 CTGTAGACACTGAGCTCCGATGG + Intergenic
999602557 5:153282933-153282955 GGTCAGACACTGAGCTAGGTAGG + Intergenic
1001664103 5:173418496-173418518 GAGCAGACACTGAGCTGGGCTGG + Intergenic
1001806887 5:174594363-174594385 GCAGAGACACAGAGCTAAGAGGG + Intergenic
1002207560 5:177574109-177574131 GTGGAGAGATTTATCTAGGATGG - Intergenic
1004256318 6:14068007-14068029 GTGGAGACCCTGATCTACAAGGG + Intergenic
1006863615 6:37190590-37190612 GAGGTGATACTGAGCTATGACGG + Intergenic
1007326090 6:41061065-41061087 GTGGAGACAATGTCCTAGTAGGG + Intronic
1007756640 6:44103800-44103822 GTGGCAACACTGACCCAGGAGGG - Intergenic
1009498574 6:64382234-64382256 GTGAAGAGAATGAGATAGGAAGG - Intronic
1013616778 6:111850792-111850814 GTGGAGACCCTGAGCGTGGATGG - Intronic
1013633905 6:112010471-112010493 TTTGGGACACTGAGCTAGTATGG + Intergenic
1013982556 6:116149651-116149673 GTGGAGACACTGAATTAAAAAGG + Intronic
1015710585 6:136134857-136134879 GTGCAGACAGTCAGCTAGGAAGG + Intronic
1015912408 6:138182121-138182143 GTGGACACACTGAGGTTGGAGGG + Intronic
1017946669 6:159101714-159101736 GTGGACACAGTGAGCTAAGGCGG + Intergenic
1018847517 6:167565964-167565986 GTGTTCACCCTGAGCTAGGAGGG - Intergenic
1019322226 7:420945-420967 GTGGAGTCACTGAGGTTGGAGGG - Intergenic
1019356816 7:584494-584516 GCGCAGCCACTGACCTAGGATGG + Exonic
1019524860 7:1476358-1476380 GCGGAGACGCGGAGCCAGGACGG - Exonic
1020153438 7:5701941-5701963 GTGGAAACACTAACCCAGGAAGG + Intronic
1023090957 7:36616956-36616978 ATGGAGACACGGAGATAGAAAGG + Intronic
1023423023 7:40004050-40004072 GTCCAGCCACTGAGCTAGGTAGG - Intronic
1024627197 7:51218051-51218073 GTGGTGCCACTGGGCTAGAATGG - Intronic
1026070663 7:67116579-67116601 CTTGAGACACTGAGATAAGAGGG + Intronic
1026706235 7:72695698-72695720 CTTGAGACACTGAGATAAGAGGG - Intronic
1030385842 7:108867147-108867169 GCAGAGACAGTGAGCTTGGAAGG + Intergenic
1030894039 7:115034735-115034757 GAGGAGACAGTGATCTAGCAAGG - Intergenic
1031268055 7:119607470-119607492 CTGAAGACACTGGGGTAGGATGG + Intergenic
1032802288 7:135326305-135326327 GTGCAGATACTGAGTTAGGATGG - Intergenic
1033605034 7:142920650-142920672 GCAAAGACACTGAGCTAGCAAGG - Intronic
1034415880 7:150964023-150964045 GTGGAGCCCCTGACCTCGGATGG - Intronic
1035234748 7:157489037-157489059 GTGAAGACACAGACCCAGGAGGG + Intergenic
1035736063 8:1888415-1888437 GAGGAGACACTGAGTGTGGAGGG + Intronic
1035736159 8:1888970-1888992 GAGGAGACACTGAGGTGTGAGGG + Intronic
1035962283 8:4150342-4150364 CTGCAGACACTGAGTTAGAATGG - Intronic
1040568515 8:48588115-48588137 GTGGAAGCTCTGAGCTAGGATGG - Intergenic
1042036535 8:64540103-64540125 GTGGGGAGACTGAGGTAGGAGGG + Intergenic
1043548465 8:81341348-81341370 GTGGACAGAAGGAGCTAGGAAGG - Intergenic
1044143401 8:88683066-88683088 CTGGAGACACTGAAGTAGGGTGG + Intergenic
1048955174 8:139530095-139530117 GAGGACACACTGGGCTGGGAAGG - Intergenic
1049314102 8:141950556-141950578 GTGGTGCCACTGAGTGAGGAAGG + Intergenic
1049743329 8:144251455-144251477 GTGGAGAAAGTGAGGTAAGAGGG - Intronic
1050210964 9:3255673-3255695 GTAGAGACACTGACCTACAAAGG + Intronic
1052331156 9:27269973-27269995 GTGGCGCCACTAAGCTGGGAAGG - Intergenic
1052343048 9:27381709-27381731 GAGGATACAATGAGCTACGATGG - Intronic
1052347823 9:27427856-27427878 CTGGAGAGCCTGACCTAGGAGGG - Intronic
1052357031 9:27515722-27515744 TTGGAGACATTGAGCTAGTATGG - Intronic
1052692855 9:31837096-31837118 GTGGGGACACTAAGCAAGAATGG - Intergenic
1055580043 9:77698799-77698821 TTGGAGACAGTGAACTTGGAGGG - Intergenic
1055962167 9:81831034-81831056 GAGGTGACACTGAGCTAGCTAGG - Intergenic
1056601937 9:88053396-88053418 GAGGAGACTCTGCGCAAGGAGGG - Intergenic
1056638587 9:88351015-88351037 GAGGATGCAGTGAGCTAGGATGG + Intergenic
1058056687 9:100455932-100455954 GTGGAGAAACAGCGCTGGGAAGG - Intronic
1058151165 9:101465217-101465239 GTGAGGACACTGACCTAGGTTGG + Intergenic
1060942354 9:127550173-127550195 GAGGAGACAGGGAGCCAGGAAGG - Intronic
1061153421 9:128842612-128842634 GTGGAGGCACTGGGGGAGGAAGG - Intronic
1061290645 9:129648858-129648880 GGGGAGAAACTGAGGTAGCAGGG + Intergenic
1061416367 9:130449228-130449250 GTGGTGGCACTGAGCTGGGATGG + Intronic
1062172835 9:135144936-135144958 CCAGAGACACTGAGCCAGGATGG + Intergenic
1186272932 X:7909141-7909163 CTGAAGTCACTGAGCTTGGAAGG - Intronic
1186854303 X:13611085-13611107 GAGGAGACAGTGAGACAGGAAGG - Intronic
1188009536 X:25041592-25041614 ATGGAGACACAGAGAGAGGATGG - Intergenic
1190218118 X:48493472-48493494 GTTGAAACCCTGGGCTAGGAGGG + Intergenic
1190509522 X:51161798-51161820 GTGAAGACCCTGAGCGAGAATGG + Intergenic
1193300860 X:79886862-79886884 GTGGAGGAACTCAGCCAGGAGGG - Intergenic
1195473889 X:105262723-105262745 TTGGAGAAACAGAGCTTGGAAGG + Intronic
1197771064 X:130089710-130089732 CAGGAGACAATGAGCAAGGAAGG - Intronic
1198329143 X:135605652-135605674 TTAGAAACACTGAGCTAAGAAGG - Intergenic
1200323316 X:155212599-155212621 GTGAGGACACTGAGCTAGATAGG + Intronic
1200943879 Y:8812233-8812255 GAGCAGACACTGAGCTAGTCAGG - Intergenic