ID: 1083884912

View in Genome Browser
Species Human (GRCh38)
Location 11:65568310-65568332
Sequence CAGTGGGAGAAGAGGGATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083884905_1083884912 13 Left 1083884905 11:65568274-65568296 CCCTGAGAGGAGAAAAGGGACAA No data
Right 1083884912 11:65568310-65568332 CAGTGGGAGAAGAGGGATGCAGG No data
1083884906_1083884912 12 Left 1083884906 11:65568275-65568297 CCTGAGAGGAGAAAAGGGACAAG No data
Right 1083884912 11:65568310-65568332 CAGTGGGAGAAGAGGGATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083884912 Original CRISPR CAGTGGGAGAAGAGGGATGC AGG Intergenic
No off target data available for this crispr