ID: 1083886600

View in Genome Browser
Species Human (GRCh38)
Location 11:65576240-65576262
Sequence TCCCGCTGGCCCGCCACCGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 99}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083886600_1083886618 15 Left 1083886600 11:65576240-65576262 CCAGCGGTGGCGGGCCAGCGGGA 0: 1
1: 0
2: 1
3: 23
4: 99
Right 1083886618 11:65576278-65576300 AGTGGGCGGCGGGGTGGCGGGGG 0: 1
1: 0
2: 9
3: 102
4: 1057
1083886600_1083886612 6 Left 1083886600 11:65576240-65576262 CCAGCGGTGGCGGGCCAGCGGGA 0: 1
1: 0
2: 1
3: 23
4: 99
Right 1083886612 11:65576269-65576291 GGCCTGAGAAGTGGGCGGCGGGG 0: 1
1: 0
2: 1
3: 20
4: 239
1083886600_1083886607 1 Left 1083886600 11:65576240-65576262 CCAGCGGTGGCGGGCCAGCGGGA 0: 1
1: 0
2: 1
3: 23
4: 99
Right 1083886607 11:65576264-65576286 CCCCGGGCCTGAGAAGTGGGCGG 0: 1
1: 0
2: 1
3: 18
4: 298
1083886600_1083886617 14 Left 1083886600 11:65576240-65576262 CCAGCGGTGGCGGGCCAGCGGGA 0: 1
1: 0
2: 1
3: 23
4: 99
Right 1083886617 11:65576277-65576299 AAGTGGGCGGCGGGGTGGCGGGG 0: 1
1: 0
2: 2
3: 49
4: 511
1083886600_1083886611 5 Left 1083886600 11:65576240-65576262 CCAGCGGTGGCGGGCCAGCGGGA 0: 1
1: 0
2: 1
3: 23
4: 99
Right 1083886611 11:65576268-65576290 GGGCCTGAGAAGTGGGCGGCGGG 0: 1
1: 0
2: 4
3: 28
4: 343
1083886600_1083886605 -2 Left 1083886600 11:65576240-65576262 CCAGCGGTGGCGGGCCAGCGGGA 0: 1
1: 0
2: 1
3: 23
4: 99
Right 1083886605 11:65576261-65576283 GAGCCCCGGGCCTGAGAAGTGGG 0: 1
1: 0
2: 1
3: 11
4: 175
1083886600_1083886616 13 Left 1083886600 11:65576240-65576262 CCAGCGGTGGCGGGCCAGCGGGA 0: 1
1: 0
2: 1
3: 23
4: 99
Right 1083886616 11:65576276-65576298 GAAGTGGGCGGCGGGGTGGCGGG 0: 1
1: 0
2: 3
3: 52
4: 486
1083886600_1083886610 4 Left 1083886600 11:65576240-65576262 CCAGCGGTGGCGGGCCAGCGGGA 0: 1
1: 0
2: 1
3: 23
4: 99
Right 1083886610 11:65576267-65576289 CGGGCCTGAGAAGTGGGCGGCGG 0: 1
1: 0
2: 1
3: 19
4: 265
1083886600_1083886619 27 Left 1083886600 11:65576240-65576262 CCAGCGGTGGCGGGCCAGCGGGA 0: 1
1: 0
2: 1
3: 23
4: 99
Right 1083886619 11:65576290-65576312 GGTGGCGGGGGCCATGACCTCGG 0: 1
1: 0
2: 0
3: 13
4: 203
1083886600_1083886614 9 Left 1083886600 11:65576240-65576262 CCAGCGGTGGCGGGCCAGCGGGA 0: 1
1: 0
2: 1
3: 23
4: 99
Right 1083886614 11:65576272-65576294 CTGAGAAGTGGGCGGCGGGGTGG 0: 1
1: 0
2: 3
3: 40
4: 404
1083886600_1083886604 -3 Left 1083886600 11:65576240-65576262 CCAGCGGTGGCGGGCCAGCGGGA 0: 1
1: 0
2: 1
3: 23
4: 99
Right 1083886604 11:65576260-65576282 GGAGCCCCGGGCCTGAGAAGTGG 0: 1
1: 0
2: 5
3: 27
4: 291
1083886600_1083886615 12 Left 1083886600 11:65576240-65576262 CCAGCGGTGGCGGGCCAGCGGGA 0: 1
1: 0
2: 1
3: 23
4: 99
Right 1083886615 11:65576275-65576297 AGAAGTGGGCGGCGGGGTGGCGG 0: 1
1: 0
2: 5
3: 87
4: 755

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083886600 Original CRISPR TCCCGCTGGCCCGCCACCGC TGG (reversed) Exonic
900240613 1:1615728-1615750 TCCCGCTGGCCCAGCAGCCCCGG + Intronic
901005777 1:6170926-6170948 TCCGCCTCCCCCGCCACCGCAGG + Intronic
903219258 1:21859910-21859932 TCCCACTGACCTGACACCGCAGG + Exonic
903498882 1:23791163-23791185 TCCCCCTCGGCCGCCCCCGCCGG - Exonic
907461718 1:54609241-54609263 GTCCGCTGGCCCACCACCCCTGG + Exonic
908977708 1:69919452-69919474 TCCCGCTGGGCCGCTCCCACTGG - Intronic
916720860 1:167483995-167484017 TCCCACTGCTCTGCCACCGCTGG + Intronic
918423486 1:184386728-184386750 TCCGGCTGGCCGGCCGCTGCAGG + Intergenic
922917579 1:229271176-229271198 TCCGGCTGGGCCGCAGCCGCTGG + Exonic
923157264 1:231289805-231289827 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
924626716 1:245701871-245701893 TCCCTCTGCCCGGCCACCTCTGG + Intronic
1064011981 10:11742679-11742701 TCCCGCCGCCCCGCCCCGGCCGG - Exonic
1064441150 10:15354668-15354690 TCCCGCTGACCCAGCACCGTGGG + Intronic
1066180678 10:32958203-32958225 TCCCGCTGGGCCTCTCCCGCGGG + Intronic
1068373990 10:56155153-56155175 TCCAGCTGGCCAGCAAGCGCCGG - Intergenic
1070973394 10:80586050-80586072 TGCCGCTGGGCCGGCACTGCTGG - Intronic
1071532353 10:86400197-86400219 TCCCGCAGGGCCGCAGCCGCGGG - Intergenic
1072903579 10:99430663-99430685 GGCCGCGGGCCCGCCCCCGCCGG - Intergenic
1075801830 10:125159339-125159361 TCCTCCTCGCCCGCCGCCGCCGG - Intronic
1077105920 11:842640-842662 TCCACCGGCCCCGCCACCGCTGG + Intergenic
1083886600 11:65576240-65576262 TCCCGCTGGCCCGCCACCGCTGG - Exonic
1084650281 11:70485534-70485556 GCCCGCTCCCCCGCCCCCGCCGG - Intronic
1085245571 11:75098237-75098259 TCCAGCTGGCCTGCAAGCGCAGG - Intergenic
1086397778 11:86433851-86433873 TCCAGCTGGCCCACAAGCGCCGG + Intergenic
1088481084 11:110296746-110296768 TCCCGCAGGCTCGCAGCCGCAGG + Intergenic
1095444989 12:42274032-42274054 TCCAGCTGGCCCGCAAGCACTGG + Intronic
1095587382 12:43863930-43863952 TCTAGCTGGCCCGCAAGCGCCGG - Intronic
1095949415 12:47773662-47773684 TGCCGACGGCCCGCCACTGCCGG + Intronic
1098515964 12:71376888-71376910 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
1100315534 12:93441649-93441671 TCCGGCTGCCCCGCCGCGGCCGG + Intronic
1101813847 12:108130224-108130246 CCCCGCTGGCCCACCTCCGCGGG - Intronic
1112088218 13:96053582-96053604 TCCCGCGGGTCCGCTCCCGCGGG + Intergenic
1116452327 14:45080467-45080489 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
1116653745 14:47626588-47626610 TCGCGCTGGCCCGCAAGCGCCGG - Intronic
1117368219 14:55051866-55051888 TCCCGCTTGGCCGCGCCCGCGGG - Intronic
1120914804 14:89701687-89701709 CCCCGCTGGCGCGCCGGCGCCGG - Intergenic
1121629921 14:95414432-95414454 TCCCTCTGTCCCGCCACCACTGG + Intronic
1122494086 14:102139773-102139795 TCCCTTTGGCCCGCCCTCGCAGG + Intronic
1128547581 15:68578673-68578695 TCCCGCTGGCCCGGGGACGCTGG - Intergenic
1131186074 15:90275211-90275233 TCGCGCTGGCCGGCCGCGGCTGG + Exonic
1131912560 15:97224278-97224300 TCGCGCTGGCCCGCCAGCGCCGG - Intergenic
1132365092 15:101251471-101251493 GCCCGCCGGGCCGCCGCCGCAGG + Exonic
1133784484 16:8963720-8963742 GCCCGCAGGCCCGCCGCGGCCGG - Intronic
1135395923 16:22131597-22131619 TCCTGCTGCCCCGACACCGCAGG - Exonic
1139908326 16:70381409-70381431 GGCCGCTGGCCCGCCCCCGAAGG + Exonic
1140701697 16:77587341-77587363 GCCCCCCGGCCCGCCACCCCAGG + Intergenic
1142757565 17:2024998-2025020 GCCCGGTGGCCCGGCCCCGCAGG + Exonic
1142957466 17:3531529-3531551 TCCCCCGGGCCGGCCACAGCGGG + Intronic
1147034762 17:37671695-37671717 ACCCTCTGGCCCGCCCACGCTGG + Intergenic
1147647009 17:42040063-42040085 GCCCGCTGGCGCACCACGGCAGG + Intronic
1148128040 17:45246925-45246947 TCCCCCGGGCCCCCCACTGCAGG + Exonic
1148905499 17:50909410-50909432 CCCCGCTGGCCCCCTGCCGCGGG + Intergenic
1153226889 18:2906639-2906661 TCCCGCTGGCCTGACGTCGCAGG + Intronic
1153805303 18:8705290-8705312 TCCCGCTCCCCGCCCACCGCCGG - Intergenic
1155003286 18:21706549-21706571 TCCCGCTGGCCCGTGATCGCGGG - Intronic
1156473928 18:37394128-37394150 CCCCGCTGCCCCGCCCCCGTCGG - Intronic
1160989494 19:1854681-1854703 ACGAGCTGGCCCGCCACCACCGG - Exonic
1161802671 19:6424630-6424652 TCCGGCTCCCCCGCCCCCGCCGG + Exonic
1162032783 19:7924695-7924717 CCACGCTGTCCCGCCACGGCAGG + Exonic
1163895145 19:20052061-20052083 TCCCGCAGCCCTGCCATCGCTGG - Intergenic
926702286 2:15811542-15811564 TCCTGCAGGCCCTCCTCCGCTGG + Intergenic
929070023 2:38020543-38020565 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
929779042 2:44946096-44946118 TGCCCCTGGCCCGCAGCCGCGGG + Intergenic
933834277 2:86232700-86232722 TCCCTCGGGCCCCCCACCACCGG - Exonic
942317630 2:174709897-174709919 TCCAGCTGGCCCGCAAGCGCGGG + Intergenic
944495956 2:200307147-200307169 TCCCGCTTGCCCGCGCCGGCTGG - Intronic
947411959 2:229850749-229850771 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
947418480 2:229921700-229921722 TTCCGCGGCCCCGCCGCCGCCGG + Intronic
947754317 2:232550789-232550811 TCCCCCGCGCCCGCCCCCGCTGG + Intronic
1168800752 20:642258-642280 CCCCGCTGGCCCCCCACCACAGG - Intergenic
1168800795 20:642349-642371 CCCCGCTGGCCCCCCCCCACAGG - Intergenic
1174361485 20:50031516-50031538 TCCAGCTGGCCCCACACCCCAGG - Intergenic
1175732888 20:61366069-61366091 TGCGGCTGGCCGGCCACCACTGG - Intronic
1175873627 20:62219658-62219680 CCCCGCTGGCCCGGCCACGCTGG + Intronic
1176178748 20:63740119-63740141 CCCCGCTGCCCCGCCCCCGGGGG - Intronic
1176306311 21:5125246-5125268 ACCCGAAGGCCAGCCACCGCAGG + Intronic
1177318696 21:19493628-19493650 TCGCGCTGGCCGGCAAGCGCCGG - Intergenic
1179850747 21:44136784-44136806 ACCCGAAGGCCAGCCACCGCAGG - Intronic
1184520603 22:44991714-44991736 TCCCGCTGGCCTCCCTCCACTGG + Intronic
1185403002 22:50628074-50628096 TCCCCCCGGCCCGACTCCGCTGG - Exonic
949769961 3:7568629-7568651 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
950583917 3:13879859-13879881 TCCCGCGGGCCGGCCCCGGCGGG + Exonic
953002857 3:38951183-38951205 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
953246640 3:41199601-41199623 CCCCGCCGAGCCGCCACCGCAGG + Exonic
954200586 3:49021213-49021235 TCCCGCTCGCCCGGCCCCGCGGG + Exonic
954326944 3:49869082-49869104 TGCTGCTGGCTCGCCCCCGCTGG + Intronic
960282104 3:115791593-115791615 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
962758219 3:138484680-138484702 TCCAGCTGGCCCGCAAGCACCGG - Intergenic
968422746 4:499149-499171 TTCCGCCAGCCCGCCACAGCGGG - Exonic
968495013 4:910576-910598 TCCCGCAGGCCGGCTAGCGCAGG - Intronic
970692026 4:18630900-18630922 TCACGCTGGCCTGCGAGCGCAGG + Intergenic
981146806 4:141333522-141333544 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
984778377 4:183504190-183504212 TCGGGCTCGCCCGGCACCGCGGG - Intergenic
985150943 4:186946368-186946390 CCCCCCTGCCCCGCCACCGCAGG - Intergenic
986912420 5:12574273-12574295 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
993822003 5:92631365-92631387 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
1001586004 5:172834309-172834331 TCCGGCCGCCCCGCCCCCGCCGG - Exonic
1002431162 5:179204789-179204811 CCCCGCTGACCCTCCGCCGCCGG + Intronic
1005842530 6:29752995-29753017 TCCAGCTGCTCCGCCACCCCAGG + Intergenic
1006180388 6:32150520-32150542 TGCCGCCGCCCCGCCCCCGCCGG - Exonic
1006327726 6:33366337-33366359 TCCCCCTCGGCCGCCCCCGCCGG + Intergenic
1006408542 6:33858739-33858761 TCCCGCATGCCCGGCACCGCTGG - Intergenic
1008545236 6:52577454-52577476 TCCGGCTGCCCGGCCACCCCCGG - Intergenic
1011472672 6:87723414-87723436 CCCAGCTGGCCTGCCACAGCAGG + Intergenic
1014246800 6:119078486-119078508 TCCCGCCGGCCCGAAGCCGCGGG + Exonic
1015904910 6:138107236-138107258 TCGCGCTGGCCGGCCGCGGCTGG - Exonic
1018551359 6:165001912-165001934 TCGTGCTGGCCCGCGAGCGCTGG + Intergenic
1019340112 7:504871-504893 TCGAGATGGCCGGCCACCGCGGG + Intronic
1019472589 7:1229535-1229557 CCCCTCTGGCCCGCCAGCCCCGG - Intergenic
1030659857 7:112206933-112206955 TCCCGCTGGGCCACCACCCGTGG - Intronic
1034632168 7:152539188-152539210 TCCAGCTGGCCCGCAAGCGCTGG + Intergenic
1035044109 7:155952812-155952834 CCCCGCTGTCTCCCCACCGCTGG - Intergenic
1035861160 8:3029355-3029377 TCCCATTGGCCTGGCACCGCAGG + Exonic
1037450728 8:19013813-19013835 CCCCCGGGGCCCGCCACCGCCGG - Intronic
1046288872 8:112132724-112132746 TCCAGCTGGCCTGCAAGCGCCGG - Intergenic
1049103790 8:140598595-140598617 TCCCGCTTGCCCGACAGCCCTGG + Intronic
1049843200 8:144787244-144787266 CCCCGCGCGCCCGCCCCCGCCGG + Intronic
1062582832 9:137236028-137236050 TCCCGCTGGCCAGGCACTTCGGG + Exonic
1062718651 9:138023513-138023535 TCCCGCTCGGCCGCCTCCTCCGG - Exonic
1186496296 X:10015062-10015084 TCCCGCTGCTCCGCCTCCCCCGG - Intergenic
1188881779 X:35499307-35499329 TCCCGCTGGCTCGCAAGCGCCGG - Intergenic
1189321518 X:40090323-40090345 CCCCGCAGGCCGGCCACCCCTGG + Intronic
1196820029 X:119694231-119694253 TCCCCGTGGCCCACCTCCGCGGG + Intergenic
1200224443 X:154409385-154409407 TCCCGCTGGCCCGGGAAGGCGGG - Intronic