ID: 1083887415

View in Genome Browser
Species Human (GRCh38)
Location 11:65579589-65579611
Sequence CCTCCTCCAAGGAGACCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 761
Summary {0: 1, 1: 1, 2: 20, 3: 142, 4: 597}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083887415_1083887419 9 Left 1083887415 11:65579589-65579611 CCAGGAGGTCTCCTTGGAGGAGG 0: 1
1: 1
2: 20
3: 142
4: 597
Right 1083887419 11:65579621-65579643 CCCAACACATGCAGCATGAGAGG 0: 1
1: 0
2: 0
3: 11
4: 139
1083887415_1083887423 29 Left 1083887415 11:65579589-65579611 CCAGGAGGTCTCCTTGGAGGAGG 0: 1
1: 1
2: 20
3: 142
4: 597
Right 1083887423 11:65579641-65579663 AGGCAGCTGGGACCAGAACTTGG 0: 1
1: 0
2: 5
3: 47
4: 317
1083887415_1083887421 16 Left 1083887415 11:65579589-65579611 CCAGGAGGTCTCCTTGGAGGAGG 0: 1
1: 1
2: 20
3: 142
4: 597
Right 1083887421 11:65579628-65579650 CATGCAGCATGAGAGGCAGCTGG 0: 1
1: 0
2: 3
3: 30
4: 331
1083887415_1083887422 17 Left 1083887415 11:65579589-65579611 CCAGGAGGTCTCCTTGGAGGAGG 0: 1
1: 1
2: 20
3: 142
4: 597
Right 1083887422 11:65579629-65579651 ATGCAGCATGAGAGGCAGCTGGG 0: 1
1: 0
2: 1
3: 32
4: 242
1083887415_1083887424 30 Left 1083887415 11:65579589-65579611 CCAGGAGGTCTCCTTGGAGGAGG 0: 1
1: 1
2: 20
3: 142
4: 597
Right 1083887424 11:65579642-65579664 GGCAGCTGGGACCAGAACTTGGG 0: 1
1: 1
2: 0
3: 26
4: 305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083887415 Original CRISPR CCTCCTCCAAGGAGACCTCC TGG (reversed) Intronic
900100457 1:960118-960140 CCTCCTCCGAGGAGCCCCCCAGG - Intergenic
900123268 1:1058633-1058655 CCTCCTGCTTGGAGCCCTCCAGG - Intergenic
900152224 1:1183673-1183695 CCTCCTCCAGGCAGCCCTCCAGG + Intronic
900331390 1:2136437-2136459 CCTCCTCCAGGAAGTCCTCTGGG - Intronic
900391296 1:2435131-2435153 CCTCCTCCCAGCAGAGCTCCTGG - Intronic
900463189 1:2811052-2811074 CCACCTCCAGGCAGCCCTCCCGG + Intergenic
900475464 1:2874397-2874419 CCTCTTCCAAGAAGTCCTCCTGG - Intergenic
900527791 1:3137566-3137588 CCTCCTCCAGGCGGTCCTCCTGG - Intronic
900617853 1:3573337-3573359 CCTCCCCCAGGGTGGCCTCCTGG + Intronic
900687318 1:3957020-3957042 CCTTCTCCAAGGATAACTTCAGG + Intergenic
900692419 1:3988576-3988598 CCTTCTCCCAGGAGAGCTCAGGG - Intergenic
900737480 1:4308312-4308334 CCTCCTCCAAGCACACCTGAGGG - Intergenic
900793196 1:4692685-4692707 CTTCCTCCAAGCAGCCTTCCAGG + Intronic
900896186 1:5484501-5484523 CTTCCTCCATGGAGCCCTCAAGG - Intergenic
900998460 1:6135378-6135400 ACTCCTCCAGGAAGCCCTCCAGG + Exonic
901057390 1:6455051-6455073 CCTCCTCCAAGATGGGCTCCCGG - Intronic
901680221 1:10908767-10908789 TCTCCTCCGAGAAGTCCTCCTGG + Intergenic
901791229 1:11654644-11654666 CCTCCTCCCAGCAGTCCCCCAGG - Exonic
902288392 1:15421360-15421382 CCTCCTCCACGGCTACCTCTGGG + Intronic
902374585 1:16024302-16024324 CCTCTTCCAGGGAGGCCTCAGGG - Intronic
902379528 1:16046074-16046096 CCTCTTCCAGGGAGGCCTCAGGG - Intronic
902393697 1:16120649-16120671 CCTCCTCCAAGCAGCCTGCCTGG + Intergenic
902410861 1:16210765-16210787 CCTCCTCCAGGAAGTCTTCCTGG - Intronic
902509887 1:16960820-16960842 CCTCCTCCAGGGAGCCCAGCAGG - Exonic
902533127 1:17103191-17103213 TCTCCTCCAGGAAGAACTCCTGG + Intronic
902779804 1:18697728-18697750 TCTCCTCCAGGAAGTCCTCCTGG + Intronic
902780233 1:18700248-18700270 CCTCCTCCAGGAAGCCCCCCAGG - Intronic
902798911 1:18817512-18817534 CTTCCTCCAGGAAGTCCTCCTGG - Intergenic
902882942 1:19384839-19384861 CCTCCTTCAGGAAGTCCTCCTGG + Intronic
902944411 1:19824399-19824421 CTTCCTCCCAGGAGAACTCTGGG - Intergenic
903363904 1:22794247-22794269 CCTCTCCCAAGAAGCCCTCCTGG - Intronic
903376010 1:22866379-22866401 CCTCCTCCAGGAAGACTTCCTGG - Intronic
903662099 1:24984505-24984527 CCACCTCCATGCAGCCCTCCAGG - Intergenic
903754407 1:25650992-25651014 ACTCCTCCAAGGAGACCTGGAGG + Intronic
904047119 1:27615533-27615555 CCTCCTCCAGGAAGGCCTTCGGG + Exonic
904082656 1:27882002-27882024 CGTCCTCCACGTCGACCTCCAGG - Exonic
904223892 1:28998170-28998192 CCTCCCCAGAGGAGACTTCCCGG - Intronic
904246187 1:29189735-29189757 CCTCCTCCAAACTGTCCTCCGGG + Intergenic
904379809 1:30103096-30103118 CGTCCTCCAAGGAGTTCTCAGGG - Intergenic
904385457 1:30138987-30139009 CCTCCCCTGAGAAGACCTCCAGG - Intergenic
904455552 1:30645915-30645937 CCTCCTCCAGGAAGCCTTCCAGG - Intergenic
905281412 1:36851799-36851821 CCTTCTCCAAACAGCCCTCCAGG - Intronic
905768102 1:40619993-40620015 CCTCCTCCCAAGAGCCCTCCAGG - Intergenic
905921073 1:41719143-41719165 CCTCCTCCAGGAAGTCTTCCAGG - Intronic
905945522 1:41898315-41898337 CCCCCTCCAGGGAGACTGCCAGG - Intronic
906581582 1:46939691-46939713 CCTCCTTCAAGAAGGCCTCCTGG - Intronic
906602137 1:47139208-47139230 CCTTCTTCAAGAAGGCCTCCTGG + Intronic
906716394 1:47972856-47972878 CCATCTCCAGGGAGCCCTCCTGG + Intronic
906955937 1:50373753-50373775 CCTCCTCCAGGGAGTCCTCTTGG - Intergenic
907194890 1:52678530-52678552 CCTCCTCCAGGAAGTCATCCTGG - Intergenic
907239768 1:53074938-53074960 TCTCCTCCAGGAAGCCCTCCAGG - Intronic
907280835 1:53346190-53346212 CCTCCTCCAGGAAGCCCTGCTGG - Intergenic
907319123 1:53591933-53591955 CCTCCTCCATGAAGCCCTTCTGG + Intronic
907476540 1:54709743-54709765 CCTCCTCCAGGAAGCCTTCCTGG - Intronic
907514795 1:54986710-54986732 CCTCCTCCAGGAAGCCTTCCTGG - Intronic
907927426 1:58967565-58967587 CCTCCTCTAAGAAGCCCTCCTGG + Intergenic
909657338 1:78046126-78046148 CCAAGTCCAAGGAGACCGCCGGG + Exonic
910225671 1:84933436-84933458 CCTCCTCCAAAAAGACCTAGAGG + Intronic
910675107 1:89808487-89808509 CCTCCTCCAAGCAGACCATGTGG - Intronic
910838809 1:91541875-91541897 CATCCTCCATGAACACCTCCTGG - Intergenic
911387359 1:97193920-97193942 CCTTCTTCAAGGAGGCTTCCAGG + Intronic
912421333 1:109544138-109544160 TCTCCTCAATGGAGCCCTCCCGG - Exonic
912698742 1:111860777-111860799 CCTCCTCCATTTAGTCCTCCCGG + Intronic
913198361 1:116476181-116476203 CCTCATCCAAGGAGCCCTGATGG + Intergenic
913649474 1:120898288-120898310 CCTCCTCAAAGGCCACCTACAGG + Intergenic
914077210 1:144365223-144365245 CCTCCTCAAAGGCCACCTACAGG - Intergenic
914101968 1:144601282-144601304 CCTCCTCAAAGGCCACCTACAGG + Intergenic
914171661 1:145230807-145230829 CCTCCTCAAAGGCCACCTACAGG - Intergenic
914296935 1:146335919-146335941 CCTCCTCAAAGGCCACCTACAGG - Intergenic
914639632 1:149592366-149592388 CCTCCTCAAAGGCCACCTACAGG + Intergenic
914825854 1:151137725-151137747 CATCCTCCACAGAGACCTCGCGG + Exonic
915299836 1:154945666-154945688 CCTCCTCCAAGCTGTCCTCCAGG + Exonic
915601518 1:156925523-156925545 CCTCCTCCAGGCAGTCTTCCAGG - Intronic
916285121 1:163098115-163098137 CCTTCCCCAAGGAGACCTCCGGG + Intergenic
916655922 1:166875735-166875757 CCACCTCCAGGAAGCCCTCCAGG + Intronic
916660825 1:166921162-166921184 ACTCCTCCAAGGAGTCGTCCTGG + Exonic
918088005 1:181261803-181261825 CCTCCTCAGAGCACACCTCCAGG + Intergenic
918394269 1:184097748-184097770 CCTCCTGGAAGGTCACCTCCAGG - Intergenic
919796662 1:201325201-201325223 CCTACTCCATGGAGAGCTGCGGG - Intronic
920710017 1:208286298-208286320 CCTAGTCAAAGGGGACCTCCTGG + Intergenic
922321859 1:224495640-224495662 ACTGCTCCAAGGGGTCCTCCTGG + Intronic
922729962 1:227944704-227944726 CCTCTTCCAGGCAGGCCTCCAGG + Intronic
922767327 1:228162858-228162880 CCACCTCCAAGAAGCCTTCCTGG - Intergenic
922790416 1:228308019-228308041 CCTCCTCCAGGAAGCCTTCCTGG - Intronic
923377447 1:233378761-233378783 CTTGCTCCATGGAGCCCTCCTGG + Intronic
924606812 1:245542404-245542426 CCACCACCAAGGAAAGCTCCAGG - Intronic
924735934 1:246755850-246755872 CCTCCTCCCAGCAGGCCTCCGGG + Intronic
1063619792 10:7635860-7635882 CCTGGTCCAAGAAGACTTCCTGG + Intronic
1065846080 10:29744670-29744692 GCTCCTCAAAGGTGACCTTCAGG + Intergenic
1067691664 10:48505753-48505775 CCTCCACCAGGCAGCCCTCCTGG - Intronic
1067778326 10:49178687-49178709 CCTCCTCCAGGAAGCCTTCCTGG + Intronic
1068934902 10:62625991-62626013 CCTTCTCTAGGGAGACTTCCTGG + Intronic
1069544797 10:69320251-69320273 CCTCCTGGAAGCTGACCTCCAGG - Intronic
1069809699 10:71149077-71149099 CCTACTCCATGGAGAACCCCTGG - Intergenic
1069996309 10:72344164-72344186 CCGCGTCCCTGGAGACCTCCTGG + Intronic
1070564249 10:77591371-77591393 CCTCCTCCAGGAAGCCCTCCTGG + Intronic
1070596971 10:77839098-77839120 CGTCCAGCAATGAGACCTCCAGG - Intronic
1070742925 10:78914173-78914195 CCTCTTCCAGGAAGCCCTCCTGG - Intergenic
1070977540 10:80617208-80617230 CCACCCTCAAGGAGACCACCTGG - Intronic
1070990618 10:80729074-80729096 CCTCCTCCATAAAGACCTCCTGG - Intergenic
1071530990 10:86390153-86390175 CCTCCTCTCAGCAGCCCTCCTGG - Intergenic
1071718088 10:88117065-88117087 CCTGCTCCAAGAACAACTCCAGG - Intergenic
1072374867 10:94804114-94804136 CATCCTCAAAGCAGAGCTCCAGG - Intronic
1073444861 10:103574586-103574608 TCTCTTCCAAGAAGCCCTCCTGG - Intronic
1073542963 10:104327553-104327575 CCACCTCCAAGGAGCCTTCCAGG + Intronic
1074126759 10:110534755-110534777 CCACCTCCAGGAAGGCCTCCTGG - Intergenic
1074482243 10:113834583-113834605 CAACCTCCCGGGAGACCTCCCGG - Intergenic
1075001874 10:118804753-118804775 CCTCCTCCAGGAAGCCTTCCTGG - Intergenic
1075023881 10:118969668-118969690 CCTGCTCACAGGAGCCCTCCGGG + Intergenic
1075846701 10:125550865-125550887 CCTCCTCCAGGAAGCCTTCCTGG + Intergenic
1076109896 10:127852158-127852180 CCTCCTCCACAAAGCCCTCCAGG - Intergenic
1076314001 10:129527993-129528015 CCTCCTCCAGGAAGCCTTCCTGG + Intronic
1076421805 10:130337206-130337228 CCTCCTCCATGCTGCCCTCCTGG + Intergenic
1076490854 10:130860345-130860367 CCTCTTCCAAGAAGACTTCCCGG + Intergenic
1076501800 10:130943079-130943101 CTTCCCTCAAGGTGACCTCCAGG - Intergenic
1076510506 10:131011087-131011109 CTGCCTCCCAGGAGGCCTCCCGG - Intergenic
1076518936 10:131067785-131067807 GCAGCTCCATGGAGACCTCCCGG + Intergenic
1076630338 10:131848509-131848531 CCTGGTCCTAGGAGACCTCAAGG - Intergenic
1076725196 10:132409834-132409856 CCTCCTCCAGGAAGCCTTCCCGG - Intronic
1077253992 11:1572532-1572554 CCGCCTCCAGGAAGCCCTCCCGG + Intergenic
1077431490 11:2518002-2518024 CCTCCTCCATGCAGGCCTCCGGG - Intronic
1077504447 11:2923639-2923661 CCTCCTCCAGGAAGCCCTCCTGG - Intronic
1078601826 11:12739005-12739027 CTTCCTCCATGGAGCCTTCCTGG - Intronic
1081652184 11:44831848-44831870 CCTCCTCCAAGAAGGCTTCCTGG - Intronic
1081790029 11:45776012-45776034 CCTCCTCCAGGAAGCCCTTCTGG + Intergenic
1082681681 11:56180741-56180763 CTGCCTCCAAGTAGACTTCCAGG - Intergenic
1083279822 11:61620045-61620067 CCACCTCCAGGAAGCCCTCCTGG + Intergenic
1083326260 11:61874465-61874487 CCACCTCCAAGGTGACCACAAGG + Intronic
1083675464 11:64322609-64322631 CTTCCCCCAGGGAGCCCTCCTGG - Intergenic
1083887415 11:65579589-65579611 CCTCCTCCAAGGAGACCTCCTGG - Intronic
1084045970 11:66568037-66568059 GCTCCTCCAGGGTGGCCTCCAGG + Exonic
1084314591 11:68337762-68337784 CCTCCTCCAAGAAGCCTGCCTGG + Intronic
1084444407 11:69195441-69195463 CCTCCTCCAAGGAGCCTACTGGG - Intergenic
1084474843 11:69382929-69382951 CCTCCTCCAGGAAGTCTTCCAGG + Intergenic
1084662123 11:70552113-70552135 CCTCCTCCATGCAGCCCTCCTGG - Intronic
1084681422 11:70668686-70668708 CCTCCTCCAGGAAGTCTTCCAGG - Intronic
1084759477 11:71260176-71260198 CTCCCTCCAAGCAGACCTGCTGG - Intergenic
1084941414 11:72615280-72615302 CCTCCTCCAAAATGACCTCCCGG + Intronic
1085217750 11:74847587-74847609 CCTCTTCCAGGAAGCCCTCCTGG + Intronic
1085318436 11:75560062-75560084 GTTTATCCAAGGAGACCTCCCGG - Intergenic
1085393452 11:76194356-76194378 CCTCCTCCAAGGCGTCCACTGGG - Intronic
1085454867 11:76660107-76660129 GGACCTCCAAGGAGGCCTCCAGG + Exonic
1086686738 11:89741890-89741912 CCTCCTCCAAGCACCCCTCTTGG - Intergenic
1088223143 11:107590918-107590940 GCTCCTCCAGGGAGGCCACCCGG + Intergenic
1090470326 11:126975230-126975252 CCTCAACTAAGGTGACCTCCAGG - Intronic
1091306771 11:134541428-134541450 CCTTCTCCCAGGGGCCCTCCTGG - Intergenic
1091328562 11:134712554-134712576 CCTCCTCCACAGACACCTCGGGG + Intergenic
1091413948 12:263888-263910 TCTCCTTCAAGAAGACTTCCGGG - Intergenic
1091712243 12:2750264-2750286 CCACCTCCATGGAGACCAGCAGG - Intergenic
1091807763 12:3367886-3367908 CCGCCTCCCCGTAGACCTCCTGG + Intergenic
1092030231 12:5277832-5277854 TCTCCACCATGCAGACCTCCTGG - Intergenic
1092047695 12:5443789-5443811 CCACCACCAAGGAAACCTCCAGG + Intronic
1092099183 12:5869231-5869253 CCTCCTCCAAGAAGCCTTTCTGG + Intronic
1093706116 12:22276499-22276521 CCTCCCCCAGGCAGCCCTCCAGG - Intronic
1095366925 12:41418699-41418721 TCTCCTCCAAGGAGGACTGCAGG - Intronic
1096555741 12:52402585-52402607 CCTCCTCCAGGAAGGCTTCCTGG + Intronic
1099470492 12:83042171-83042193 CCTTTTCCTAGGAGAGCTCCAGG - Intronic
1100707245 12:97214628-97214650 CTTCCTCCAAGAAGACATTCTGG + Intergenic
1100854425 12:98746177-98746199 CCTCCTCCAGGAAGCCCCCCTGG - Intronic
1101319510 12:103661129-103661151 CCTCCTCAATGAGGACCTCCTGG - Intronic
1101426968 12:104595959-104595981 CCTGGTCCAAGGAGATCCCCAGG - Intronic
1101813959 12:108130917-108130939 CATGCTCCAAGGAGATCACCTGG + Intronic
1101865592 12:108517468-108517490 CTTCCTCCAGGGAGCCTTCCTGG - Intronic
1102041670 12:109805007-109805029 CCTCCTCCAGGAAGCTCTCCTGG + Intronic
1102042767 12:109811141-109811163 ACTCCTCCAAGAAGCCCTCCTGG + Intronic
1102255196 12:111410942-111410964 CTTCCTCCAGGGAGGCCTCCTGG - Intronic
1102346831 12:112166145-112166167 ACTCCTCCGAGGAGTCCTCCTGG - Intronic
1102507816 12:113394874-113394896 CCTCCTCCAAGGAGTCCTCCTGG + Intronic
1102528141 12:113526498-113526520 CCTGCTCCAAGAAGAAGTCCTGG - Intergenic
1102852107 12:116257421-116257443 CGTCCTTTAAGGAAACCTCCAGG - Intronic
1103399190 12:120631255-120631277 CCTGCACCAAGAAGACCTACTGG - Intergenic
1103772106 12:123335362-123335384 CCACCTCCCAGGATCCCTCCTGG - Intronic
1103948495 12:124539828-124539850 CCTCCTCCAGGAAGCCCGCCTGG + Intronic
1103994481 12:124820379-124820401 CCTCCCCCAGGAAGACCTCCCGG - Intronic
1103994802 12:124822065-124822087 CCTCCTCCAGGCAGCCTTCCTGG - Intronic
1104050975 12:125193554-125193576 CCTCCTCTAAGAAGTCTTCCTGG - Intronic
1104747928 12:131221608-131221630 CCTCCTGCAGGAAGCCCTCCAGG + Intergenic
1104765947 12:131330391-131330413 CTTCCACCAAGCAGCCCTCCAGG + Intergenic
1104932095 12:132345245-132345267 CCTCCTGCAAAGAGACCCCGAGG - Intergenic
1105211716 13:18261031-18261053 CCTCCTCCAAGAAGTCCTCCTGG + Intergenic
1105831499 13:24166348-24166370 CCTCCTCCAGGAAGCCTTCCTGG - Intronic
1106479070 13:30123409-30123431 CCGTCTACATGGAGACCTCCAGG - Intergenic
1108510145 13:51148576-51148598 CCCCCTCCAGGGGGACCTCAGGG - Intergenic
1108740275 13:53330511-53330533 CCTCCTCCCAGCAAACTTCCTGG - Intergenic
1112033524 13:95477464-95477486 CCCCCTGGAAGGAGTCCTCCGGG - Intronic
1113874944 13:113588334-113588356 CCTCCTCCATGGTGACTACCAGG - Intronic
1114459710 14:22878634-22878656 CCTCTTCCAGGAAGACCTCTTGG - Exonic
1114696699 14:24632794-24632816 CACCCTCTAAGGAGACCTCCTGG + Intronic
1117596467 14:57331297-57331319 CCTTCCCCAAGGAGACCTCTGGG - Intergenic
1118357595 14:65027484-65027506 CCTCCTCCAAAGCCACCTTCTGG - Exonic
1118482632 14:66182320-66182342 GCTCCTCCAAGCAGGGCTCCTGG + Intergenic
1119036535 14:71234353-71234375 CTTCCTCCACCGAAACCTCCTGG - Intergenic
1119071045 14:71584505-71584527 CCTCCTTCAAGGAAAGCTCCAGG - Intronic
1119439814 14:74620542-74620564 CCTCTTCCATGAAGACTTCCTGG + Intergenic
1119787402 14:77323813-77323835 CCACCTCCCAGCAGTCCTCCGGG - Intronic
1120533886 14:85668331-85668353 CCTCCAACAAGCAGACCACCAGG + Intergenic
1121117396 14:91353297-91353319 CCTCCTCCAGGAAGCCTTCCTGG + Intronic
1121276490 14:92671496-92671518 CCAACTCCAAGAAGCCCTCCTGG - Intronic
1121526350 14:94621938-94621960 CCTCCTACAGGAAGCCCTCCTGG + Intronic
1122045099 14:99017491-99017513 CCTCCTCCAGGAAGCCTTCCTGG + Intergenic
1122159643 14:99773929-99773951 CCTCCTCCAAGGGGAGATGCGGG - Intronic
1122343618 14:101044705-101044727 CCACCTCCAGGAAGCCCTCCTGG - Intergenic
1122366465 14:101197613-101197635 CCCCCTCCAGGAAGCCCTCCTGG - Intergenic
1122407210 14:101507696-101507718 CCTCCTCCAGGAAGCCTTCCTGG - Intergenic
1122577346 14:102750737-102750759 CCTCTCCCCAGGAGACCCCCTGG - Intergenic
1122628302 14:103095428-103095450 CCTCCCCCAAGAAGCCTTCCCGG - Intergenic
1122784468 14:104157481-104157503 CTGCCTCCAAGGAGTCCTGCTGG + Intronic
1122824179 14:104361683-104361705 CCTCCTTCAGGGAGCCCTCCTGG + Intergenic
1122931023 14:104933157-104933179 CCTCCTCCAGGGAGCCCTCCAGG + Exonic
1122960840 14:105093084-105093106 CCTCCTCCAGGGAGCGTTCCTGG - Intergenic
1123043157 14:105498829-105498851 CCGCCTCCAGGCAGGCCTCCTGG - Exonic
1123091177 14:105743012-105743034 CCTCCTCCAAGAGCACCTCTGGG - Intergenic
1124146741 15:27134695-27134717 CCTCCTCCAGGAAGCCCTCCAGG + Intronic
1124439787 15:29677662-29677684 CTTCCTCCACGAAGCCCTCCAGG - Intergenic
1124553376 15:30704002-30704024 CCTCCTCCAAAGAAATGTCCAGG - Intronic
1124677869 15:31701666-31701688 CCTCCTCCAAAGAAATGTCCAGG + Intronic
1126284506 15:46996135-46996157 CCTCCTTGAATGACACCTCCAGG - Intergenic
1126959758 15:53978389-53978411 CCTCCTCCACCGAGAGCGCCCGG - Intergenic
1127545648 15:59992835-59992857 CCTTCTCCAAGGGGAGCTCCAGG - Intergenic
1127809796 15:62554861-62554883 ACACCTGCAAGGAGAACTCCTGG - Intronic
1128308214 15:66613855-66613877 CCTCCTCCACTCAGACCCCCAGG - Intronic
1128513313 15:68326859-68326881 CCTCCTCCAGGAAGCCCCCCAGG + Intronic
1128683314 15:69666792-69666814 CCTCCTCCAAAATGCCCTCCTGG - Intergenic
1128752741 15:70160868-70160890 TCTCCTCCAGGGAGTCTTCCCGG - Intergenic
1129253153 15:74319620-74319642 CCTCCTCCAGGAAGACCCCCGGG - Intronic
1129458560 15:75688625-75688647 CCTCCTCCAGGGTGGCCTCCAGG + Exonic
1129466324 15:75726134-75726156 GCTCCTCCATGGGGACCTGCGGG - Exonic
1129467728 15:75733269-75733291 CCACCTCCAGGGAGACTTCCAGG + Intergenic
1129679017 15:77647425-77647447 TCTCCTCCAGGGAGACCCCTGGG - Intronic
1129697995 15:77751563-77751585 CCTTCTCCAGGAAGCCCTCCAGG - Intronic
1129719489 15:77870317-77870339 CCACCTCCAGGGAGACTTCCAGG - Intergenic
1129725233 15:77898247-77898269 CCTCCTCCAGGGTGGCCTCCAGG - Intergenic
1129783159 15:78288097-78288119 CCTCCTCCAAGCAGCCCTTGAGG + Intronic
1129856628 15:78829810-78829832 CCTCCTCCAAGAAGTCTTTCAGG + Intronic
1130093518 15:80840032-80840054 CCTCCTCTAAGGGGCCCCCCAGG + Intronic
1130273282 15:82463453-82463475 CCTCCTCCAGGGTGGCCTCCAGG - Intergenic
1130465633 15:84190824-84190846 CCTCCTCCAGGGTGGCCTCCAGG - Intergenic
1130487058 15:84403996-84404018 CCTCCTCCAGGGTGGCCTCCAGG + Intergenic
1130498632 15:84482712-84482734 CCTCCTCCAGGGTGGCCTCCAGG + Intergenic
1130587923 15:85195419-85195441 CCTCCTCCAGGGTGGCCTCCAGG - Intergenic
1130678400 15:85974371-85974393 CCTCCTCCAGGGACCCCTCCTGG - Intergenic
1131117259 15:89803058-89803080 CCTCTTGCAAGGAGCCATCCCGG + Intronic
1131401206 15:92126976-92126998 CTTCCTCCAAGCAGACCACGAGG + Intronic
1131443387 15:92475736-92475758 CCTCCTGCAAGTAGAGTTCCGGG - Intronic
1132746839 16:1439697-1439719 TCTACTCTAAGGTGACCTCCTGG - Intronic
1132855259 16:2042108-2042130 CCACCTGCAAGGAGACCCCAGGG - Intronic
1133034907 16:3029104-3029126 CCTCCTCCAGGAAGACTTCCTGG - Intronic
1133314523 16:4874378-4874400 CTTCATCCAATGAGTCCTCCAGG - Exonic
1133550545 16:6850391-6850413 CCTCCTCAGAGAAGCCCTCCAGG - Intronic
1133739321 16:8639789-8639811 CCTCCTCCGAGCAGCCCCCCAGG + Intronic
1133772893 16:8878070-8878092 CCTCCACCAGGCAGACCTCCAGG + Intergenic
1133927629 16:10206011-10206033 CCTCCTCCACGAAGACTTCTAGG + Intergenic
1134819298 16:17233211-17233233 CCGGCTTCAAGGAGACCTCAAGG + Intronic
1134892991 16:17857751-17857773 CCTCCTCCTGGAAGTCCTCCTGG - Intergenic
1135341894 16:21655469-21655491 CCTCTTCCAAGGGCACATCCCGG - Exonic
1135402958 16:22178722-22178744 CTTCCTCCAGGGAGCCCTCCTGG - Intronic
1135546600 16:23371195-23371217 CCTCCGGCCAGGGGACCTCCAGG - Intronic
1136019511 16:27431041-27431063 CCTCCTCCAGGAAGCCCTCCAGG - Intronic
1136136577 16:28259944-28259966 CCTCCTTCAGGAAGCCCTCCTGG + Intergenic
1136254348 16:29028517-29028539 CCTCCTCCAGGAAGCCCTCTGGG - Intergenic
1136396232 16:29993969-29993991 GCTCTTCCAAGAAGAGCTCCAGG - Exonic
1136400115 16:30012243-30012265 CCTCTTCCTAGGAGCCTTCCTGG + Intronic
1136510662 16:30736573-30736595 CCTCCTCCAGTGAGGCCTCCAGG - Exonic
1136548596 16:30969441-30969463 CCTTCTCCGAGGAGGACTCCTGG - Exonic
1136615484 16:31395773-31395795 CTTCCTCCATGGAACCCTCCTGG - Intronic
1137444876 16:48525624-48525646 TCTCCTCCAAGGAGACTCCCAGG + Intergenic
1137710998 16:50566775-50566797 CCTCCTCCATGCAGCCCACCTGG + Intronic
1138234852 16:55373635-55373657 CCTCCTCCAGGCAGACCTCAGGG + Intergenic
1138477859 16:57282850-57282872 CCTCCTCCAACAAGCCTTCCTGG + Intronic
1138858630 16:60727249-60727271 CCTCTTCCATGAAGACCTCCTGG - Intergenic
1139126751 16:64087901-64087923 GCTCCACTAAGCAGACCTCCAGG - Intergenic
1140859157 16:79004315-79004337 CTTCCTCCAAAGAGAATTCCTGG + Intronic
1141154829 16:81590091-81590113 CCTCCTCTCAGGAGTCCTGCTGG - Intronic
1141560243 16:84863023-84863045 CCGCCTCCAGGGAGCCTTCCTGG + Intronic
1141646447 16:85370458-85370480 CCTCCTCCCTGGAGCCCTCCTGG - Intergenic
1141684814 16:85564176-85564198 CCTCCTCCAGGAAGCCTTCCTGG - Intergenic
1141691824 16:85601026-85601048 CCTCCTCCAGGGAGTCCTCCTGG - Intergenic
1141738545 16:85873064-85873086 CCACCTCCCAGAAGACATCCTGG - Intergenic
1141829160 16:86500153-86500175 CCTACTCCAAGGAATTCTCCTGG + Intergenic
1141861185 16:86717704-86717726 CCTCCTCCATGAAGCCCTCCTGG - Intergenic
1141879358 16:86847581-86847603 CGTCCAGCCAGGAGACCTCCAGG - Intergenic
1142128223 16:88420644-88420666 CCTCTTCCAGGAAGCCCTCCTGG - Intergenic
1142373425 16:89695283-89695305 CCTCCTCCAGGGCGACGGCCGGG + Exonic
1142497058 17:311457-311479 ACTCCTCCAGGCAGCCCTCCTGG + Intronic
1142608355 17:1094784-1094806 CCTCCTCCATGCAGCCCTCCAGG - Intronic
1142890004 17:2937110-2937132 CCTCCTCCAGGAAGCCCTCTTGG - Intronic
1143032374 17:3974853-3974875 CCTTCTCCAAGAAGTCCCCCTGG + Intergenic
1143289446 17:5817903-5817925 CCTCCTCCAGGAAGCCCTCCTGG - Intronic
1144126553 17:12207885-12207907 CCTCCTCCAAGATGTCTTCCTGG + Intergenic
1144493504 17:15733341-15733363 CCTCCTCCCAGTAGCCTTCCAGG - Intronic
1144640753 17:16935318-16935340 CCTCCTCCCAGTAGCCCTCTGGG + Intronic
1144838446 17:18170979-18171001 CCTCCTCCCAAGAGATCCCCTGG - Intronic
1144906758 17:18643311-18643333 CCTCCTCCCAGTAGCCTTCCAGG + Intronic
1144953132 17:19004584-19004606 CCTCCTCCGGGCAGGCCTCCTGG - Intronic
1145922376 17:28619808-28619830 CCTCGTTCTAGGAGACTTCCTGG + Intronic
1145991694 17:29082957-29082979 CATCCACTAAGGAGACCTTCAGG - Intronic
1146691285 17:34877937-34877959 CCTCCAGAAGGGAGACCTCCAGG + Intergenic
1146719841 17:35116312-35116334 CCGCCTCCAGGGAGACAGCCGGG + Intronic
1147490681 17:40863313-40863335 CTTCGGCCAAGGAGTCCTCCAGG + Exonic
1148155555 17:45423494-45423516 CCTCCTCCAGGAAGCACTCCTGG + Intronic
1148497394 17:48061121-48061143 CCTCCCCCAGGCAGCCCTCCAGG - Exonic
1148674961 17:49439757-49439779 CCTCCTCCAGGAAGCCTTCCTGG + Intronic
1148756669 17:49976657-49976679 CCTCCTCCACTGGGAGCTCCAGG - Intergenic
1148849845 17:50549243-50549265 CCTCCCCCTAGCTGACCTCCAGG + Intronic
1149377853 17:56064066-56064088 CCTCCTTCAATGACATCTCCAGG - Intergenic
1149656662 17:58312711-58312733 CCTCCTGCCAGGAGAGCTCATGG - Exonic
1149983459 17:61329794-61329816 CCTCCTCCAAGCTTACCTGCAGG + Intronic
1150867426 17:68868156-68868178 CCTGCTCCTTGGAGAGCTCCAGG + Exonic
1150876434 17:68975986-68976008 CCTGCTCCTTGGAGAGCTCCAGG + Exonic
1151388297 17:73768891-73768913 CCTCCTCCATGAAGCCTTCCTGG - Intergenic
1151451385 17:74200323-74200345 CCTCCTCCACGAAGCCTTCCAGG + Intergenic
1151791268 17:76307406-76307428 CCTCCTCCAGGCCGCCCTCCAGG - Intronic
1151909523 17:77072889-77072911 CCATCTCCATGGAGACCACCCGG - Intergenic
1152683283 17:81681087-81681109 CCTCCTTCCTGGAGACCTGCTGG - Intergenic
1152915597 17:83033238-83033260 ACTCCCCCATGGAGACCTGCCGG + Intronic
1152918182 17:83052501-83052523 CCTCCTCCTGGGGGACCTCGCGG - Intergenic
1152918203 17:83052552-83052574 CCTCCTCCTGGAGGACCTCCTGG - Intergenic
1152918240 17:83052654-83052676 CCTCCTCCTGGGGGACCTCCTGG - Intergenic
1152918261 17:83052705-83052727 CCTCCTCCTGGGGGACCTCGCGG - Intergenic
1152918282 17:83052756-83052778 CCTCCTCCTGGGGGACCTCCTGG - Intergenic
1152918303 17:83052807-83052829 CCTCCTCCTGGGGGACCTCGCGG - Intergenic
1152918323 17:83052858-83052880 CCTCCTCCTGGGGGACCTCCTGG - Intergenic
1152918344 17:83052909-83052931 CCTCCTCCTGGGGGACCTCGCGG - Intergenic
1155037044 18:22033470-22033492 CCACCTCCAGGCAGAGCTCCAGG + Intergenic
1155329747 18:24703114-24703136 ACTACTCCAGGAAGACCTCCAGG + Intergenic
1155650041 18:28130655-28130677 CCTCTTCCAGGGAGCCCTGCGGG + Intronic
1156127883 18:33929385-33929407 CCTCCTCTAGGAAGCCCTCCTGG + Intronic
1156467268 18:37355759-37355781 CCTCCTCCAGGGAGACTGCCTGG - Intronic
1157185374 18:45536100-45536122 CCTCCTCCAAGAAGCCCTCCTGG - Intronic
1157310497 18:46549100-46549122 CCTCCTCCAGGAATACATCCTGG + Intronic
1157404450 18:47411316-47411338 CCTCCTCCAGGAAGCCCTCCAGG - Intergenic
1157576743 18:48748753-48748775 CCTCATCCAGGAAGCCCTCCTGG - Intronic
1158391750 18:57050444-57050466 CCTCCTGCAGGCAGGCCTCCTGG + Intergenic
1158549640 18:58424500-58424522 TCTCCTCCAGGGCAACCTCCAGG - Intergenic
1160403466 18:78628615-78628637 CTTCCTCCAGGAAGACCACCTGG + Intergenic
1160408648 18:78659993-78660015 GCTCCTCGAAGGAGCCCACCAGG + Intergenic
1160747433 19:718737-718759 CCTCCTCCAGGCAGCCTTCCAGG - Intronic
1160750147 19:730137-730159 CCTCCTGCAGGAAGCCCTCCAGG + Intronic
1160750158 19:730181-730203 CCTCCTGCAGGAAGCCCTCCAGG + Intronic
1160766446 19:810718-810740 CCTCCTCCACGGAGCCCATCTGG - Exonic
1160774449 19:848574-848596 CCTCCTCCAGGAAGCCCCCCAGG - Intergenic
1160792488 19:929124-929146 CTGCCTCCAAGAAGGCCTCCAGG + Intronic
1161000261 19:1907301-1907323 CTGCCTCCGAGGAGCCCTCCTGG + Intronic
1161080264 19:2307037-2307059 CCACTTCCAGGGAGCCCTCCTGG + Intronic
1161242381 19:3229490-3229512 CCTCCTCCAGGCGGCCCTCCTGG - Intronic
1161258737 19:3323825-3323847 CCACCTCCAGGAAGCCCTCCTGG + Intergenic
1161341485 19:3745551-3745573 CTTCCTCCAGGAAGCCCTCCTGG - Intronic
1161348300 19:3778655-3778677 CTTCCTCCAGGAAGCCCTCCTGG + Intronic
1161352893 19:3803665-3803687 CCTCCTCCAGGAAGCCCTCGGGG + Intergenic
1161422502 19:4183577-4183599 CCTCCTCCAGGAAGCCCTCCCGG - Intronic
1161482830 19:4519324-4519346 CCTCCTCCAGGGAGCCTCCCTGG - Intergenic
1161483252 19:4521373-4521395 CCTCCTCCAGGAAGGCTTCCAGG - Intergenic
1161489845 19:4555872-4555894 CCTCCTCCAGGAAGCCTTCCTGG - Intronic
1161495960 19:4585716-4585738 CCTCCTCCAGGAAGCCCTCCTGG - Intergenic
1161502401 19:4623647-4623669 CCTCCTCCAGGAAGCCCTCCCGG + Intergenic
1161618564 19:5286277-5286299 CCTCCTCCATGAAGGTCTCCTGG - Intronic
1161619788 19:5292041-5292063 CCTCTTCCAAGAAGCCCTCCTGG + Intronic
1161684221 19:5695148-5695170 CTTCCTCCAGGAAGGCCTCCTGG + Intronic
1161999610 19:7734964-7734986 CCTCCTCCAGGAAGCCCTCCCGG - Intergenic
1162006495 19:7783773-7783795 CCTCCTCCAGGAAGCCCTCTCGG + Intergenic
1162016977 19:7851336-7851358 CCGCCTCCAGGGAGCCTTCCTGG - Intronic
1162330605 19:10026948-10026970 CCTCCTCCAAGAGGTCCTCCAGG + Intergenic
1162800520 19:13107831-13107853 CCTCCTCCACGCTGACTTCCGGG - Exonic
1163207096 19:15811679-15811701 CCTCTTCCATGCAGTCCTCCTGG + Intergenic
1163270692 19:16251707-16251729 CCTCCTTCAGGCAGCCCTCCTGG + Intergenic
1163428876 19:17254838-17254860 CCTCCTCAAGGAAGCCCTCCTGG - Intronic
1163444111 19:17336890-17336912 CCTCCTCCAGGAAGTCTTCCTGG - Intronic
1163497693 19:17656163-17656185 CCTCCTCCAGGAAGTCCTCCAGG + Exonic
1163501057 19:17676480-17676502 CCTCCTACAAGAAGCCCTCCAGG + Intronic
1163544574 19:17933380-17933402 CCTCCTCTAAGCAGCCCTCCCGG - Intronic
1163575870 19:18110467-18110489 CCGCCTCCGGGGAGCCCTCCCGG + Intronic
1163623090 19:18372462-18372484 CCTCTTCCAGGAAGCCCTCCTGG + Intergenic
1163627404 19:18398027-18398049 CCTCCTCCAGGAAGCCTTCCAGG - Intergenic
1163692739 19:18746116-18746138 CCTCCTCCAGGAAGTCCCCCAGG - Intronic
1163748013 19:19059428-19059450 CCTCCTCCCTGGAGACTCCCAGG + Intronic
1163764638 19:19155995-19156017 CCTCCCCCAAGAAGCTCTCCTGG - Intronic
1163772965 19:19201887-19201909 TCTCCTCCAGGAAGCCCTCCGGG - Exonic
1163776665 19:19222770-19222792 CCTCCTCCAGGAAGCCTTCCAGG + Intronic
1163860213 19:19738855-19738877 CCTCCTCCCAGTAGACCTCTGGG - Intergenic
1164531855 19:29054934-29054956 CCTCCTCCAAGCAGACAGCCAGG + Intergenic
1164669252 19:30063469-30063491 CCTCCTCCAGGCAGCCTTCCTGG + Intergenic
1165075864 19:33279628-33279650 CCTCCTCCAGGAAGCCCACCTGG + Intergenic
1165121210 19:33560051-33560073 CCCTCACCAAGGAGACCTCAGGG - Intergenic
1165140938 19:33699448-33699470 CCTCTTCCAGGAAGTCCTCCTGG - Intronic
1165789523 19:38483210-38483232 CCACTTCCAGGGAGACCTCTTGG - Intronic
1166065491 19:40356066-40356088 CCTCCTCCATGAAGCCCTCTGGG - Intronic
1166312282 19:41969655-41969677 CCCTCTCCAAGGAGGCCTCCGGG - Intronic
1166668818 19:44697830-44697852 TCTCCTCCAGGAAGCCCTCCTGG - Intergenic
1166669947 19:44703843-44703865 CCTCCTTCAAGATGGCCTCCAGG + Intronic
1166801137 19:45457958-45457980 CCTCCACCAGGAAGTCCTCCTGG + Intronic
1166876388 19:45900423-45900445 CCTCCTCCAGGAAGCCCTCCTGG + Intronic
1167072883 19:47230861-47230883 CCTCCTCCAGGGAGTCCACCCGG + Intronic
1167151340 19:47712029-47712051 CCTCCTCAGAGAAGTCCTCCAGG - Intergenic
1167217076 19:48171780-48171802 CCTCCTCCACGCAGGCCCCCAGG + Exonic
1167234197 19:48303824-48303846 CCTCCAACACAGAGACCTCCTGG + Intronic
1167474083 19:49690205-49690227 TCTCCACCAAGGAGCCCTCGGGG + Exonic
1167608566 19:50494887-50494909 CCACCCCCACGGAGGCCTCCTGG - Intergenic
1167744467 19:51342432-51342454 CCTCCTCCAGGAAGTCTTCCTGG - Intergenic
1168233098 19:55045514-55045536 CCTCCCCCAAGGAGCCTTCCTGG + Intronic
1168287751 19:55342869-55342891 TCTCCTCCAAGGATACCTGCAGG - Intronic
1168433035 19:56296219-56296241 CCTCCTCCGAGAAGCCCTGCTGG - Intronic
1168527301 19:57099430-57099452 CCTCCTCTGAGGAGCCTTCCAGG + Intergenic
1168695146 19:58400063-58400085 CCTCCTCCAGGCAGCCTTCCTGG - Intergenic
925031730 2:655004-655026 CCTCCTCAGAGGGGACTTCCTGG - Intergenic
925333098 2:3074102-3074124 CCTCCTTCAAGGAGGACACCTGG - Intergenic
925333112 2:3074182-3074204 CTTCCTTCAAGGAGGCCACCTGG - Intergenic
925867953 2:8245370-8245392 CCTCCTCTAGGGTGACCTCATGG - Intergenic
926141234 2:10369676-10369698 CCTCCTCCAAGAAGGCCTCAGGG - Intronic
926880338 2:17538618-17538640 CCGCCACGAAAGAGACCTCCAGG + Intergenic
927342293 2:21996236-21996258 CTTCCTCCAAGAAGTCTTCCTGG - Intergenic
927487722 2:23500237-23500259 CCTCTTCCATGAAGCCCTCCTGG - Intronic
927513355 2:23658190-23658212 CCTCCACCAAGGCCAGCTCCAGG + Intronic
927875768 2:26654236-26654258 CCTCCTCCAGGGAGATCTTAGGG - Intergenic
928086108 2:28347418-28347440 CCTCCTCCAGGAAGCCCTCCAGG - Intergenic
929595247 2:43171358-43171380 CCTCCTTCAGGAAGCCCTCCTGG - Intergenic
929981657 2:46687033-46687055 CTTCCTCCGAGGACTCCTCCAGG - Intergenic
930357996 2:50345787-50345809 TCTTCTCCAGGCAGACCTCCGGG + Intronic
930606682 2:53500198-53500220 CCTCCTCCCAGCAAATCTCCCGG + Intergenic
932431116 2:71674105-71674127 CCTCCTCCAGGCAGCCTTCCAGG + Intronic
934301909 2:91781424-91781446 CCTCCTCCAAGAAGTCCTCCTGG - Intergenic
934581601 2:95445400-95445422 CCTCCTCCAAGCACTGCTCCTGG - Intergenic
934597849 2:95631314-95631336 CCTCCTCCAAGCACTGCTCCTGG + Intergenic
934709133 2:96503733-96503755 CCTCCTCCCACGAGGCCTGCAGG + Intronic
935396853 2:102619172-102619194 GCTCCTCCAAGGGGACACCCCGG - Intergenic
935595489 2:104874159-104874181 CTTCCTCCCAGGAGACCCGCAGG - Intergenic
935700750 2:105809802-105809824 CCTCCTCCAGGAAGACCTCCTGG - Intronic
935934989 2:108172192-108172214 CTTCCTACAAGGAGACATACAGG + Intergenic
936635490 2:114251761-114251783 CCTCCTCCAAGCAATCTTCCTGG + Intergenic
937017214 2:118617017-118617039 CTTCCTCCAGGGAGTCCTCAAGG + Intergenic
937147926 2:119663361-119663383 CCTCCTGCAAGATGTCCTCCAGG - Intergenic
937208682 2:120253159-120253181 ACTCCCCCAGGGAGTCCTCCCGG - Intronic
937313493 2:120916443-120916465 CCTCTTCCAATGAGCCTTCCTGG + Intronic
937354935 2:121192373-121192395 CCTTCTCCAGGAAGCCCTCCAGG + Intergenic
937888260 2:126915247-126915269 TCCCCTGCAATGAGACCTCCCGG - Intergenic
937953982 2:127408727-127408749 CCTCCTCCAGGAAGTCTTCCTGG + Intergenic
938207871 2:129439260-129439282 CCTCCTCCAAGAAGCCTTCCTGG - Intergenic
938302735 2:130228394-130228416 CCTCCTCCGAGAAGCCCCCCAGG + Intergenic
938453934 2:131445828-131445850 CCTCCTCCGAGAAGCCCCCCAGG - Intergenic
938454027 2:131446079-131446101 CCTCCTCCGAGAAGCCCCCCTGG - Intergenic
938557414 2:132438090-132438112 CCTCCTCCAGGAAGGCTTCCAGG - Intronic
940817681 2:158313814-158313836 CTTCTTCCAAAGAGATCTCCAGG + Exonic
942108977 2:172661189-172661211 CCCTCTCCCAGTAGACCTCCAGG + Intergenic
942222447 2:173783871-173783893 CCTCCTCCAAGAAGCCCTCTTGG - Intergenic
943566865 2:189526250-189526272 CCTCCCCCAGGGAGACCTTTAGG + Intergenic
946185061 2:217976087-217976109 CTTCCTCCAAGGAGTCTTTCTGG + Intronic
946486157 2:220102842-220102864 CCTCCACCAGGAAGCCCTCCAGG + Intergenic
947444659 2:230154802-230154824 CCTCCTCCAAGGAAACTTTTGGG - Intergenic
948158174 2:235801298-235801320 CCTCCTCCAGGAAGTCTTCCCGG - Intronic
948551384 2:238775165-238775187 CCTCCTCCAGGAAGTCTTCCAGG - Intergenic
948560472 2:238848203-238848225 CCTCCTCCATGGCGCCCGCCCGG - Exonic
948637012 2:239345061-239345083 CCTCCTCCTGGGAGCCCTCTTGG + Intronic
949042409 2:241855358-241855380 CCTCCTCCAGGAAGGCTTCCTGG + Intronic
1168851941 20:982990-983012 CCTCCCCAGAGGAGGCCTCCTGG - Intronic
1169132762 20:3174402-3174424 CCTCCTCCCGGCAGTCCTCCCGG - Intergenic
1169360786 20:4947099-4947121 CCTCCTCCAGGGAGCACTCCTGG + Intronic
1169558099 20:6770005-6770027 CCTCCTCCAGGATGCCCTCCTGG - Intronic
1169830536 20:9820440-9820462 CCTCCTCCAAGGAGAAATGAAGG + Intronic
1170606999 20:17882196-17882218 CCTCCTACAAGCAGCCCTCCAGG - Intergenic
1172224922 20:33299207-33299229 ACCGCTCCAGGGAGACCTCCGGG - Intronic
1172275586 20:33677210-33677232 CCTCCTCAGAAGTGACCTCCTGG + Exonic
1172444091 20:34984311-34984333 CCTCCTCTAGGAAGGCCTCCTGG - Intronic
1172657610 20:36546580-36546602 CTTCCTGCCAGGTGACCTCCTGG - Intronic
1172847341 20:37937839-37937861 CCTCCTCCAGGAAGCCCTCCTGG - Intronic
1172895612 20:38298097-38298119 CCTCCTACATGGAGCCTTCCAGG - Intronic
1173027983 20:39326957-39326979 CTTTCTCCCAGGAGAGCTCCAGG - Intergenic
1173724670 20:45289046-45289068 CCTCCTCCAGGAAGCCTTCCTGG + Intergenic
1174103607 20:48146501-48146523 CCTCCTCCAGGAAGTCCTCTTGG - Intergenic
1174199609 20:48798159-48798181 CCTCCTCCAGGAAGCCTTCCAGG + Intronic
1174330485 20:49813268-49813290 CCTCCTCCAGGAAGTCGTCCGGG + Intronic
1174588576 20:51627346-51627368 CGTCCTCCAAGAAGTCTTCCTGG - Intronic
1174735812 20:52964725-52964747 CCTCTTCCAAGAAGTCTTCCTGG - Intergenic
1174969474 20:55257756-55257778 CCTCCTCAAAGGTCAACTCCTGG - Intergenic
1175045446 20:56100608-56100630 CATCTTCCTAGGAGACCACCAGG - Intergenic
1175248152 20:57593564-57593586 CCTCCTCCCTGTAGCCCTCCCGG - Intergenic
1175320856 20:58087229-58087251 CCTCCTCCAGGGAGCCTTCCTGG + Intergenic
1175335604 20:58193868-58193890 CTTCCTCCAAAGAACCCTCCTGG + Intergenic
1175368499 20:58471226-58471248 CCTCCACCAAGGAGCCCTGGGGG + Intronic
1175875344 20:62226888-62226910 CCTCCTCCAGGGAGCCTTCCCGG - Intergenic
1175940712 20:62536360-62536382 CTTCCTCCAGGAAGCCCTCCTGG + Intergenic
1175965934 20:62660308-62660330 CCTCCTCCGGGCAGACCTCCAGG - Intronic
1175985781 20:62763621-62763643 CCTCCTCCAGGCAGCCTTCCTGG - Intergenic
1176140044 20:63541035-63541057 CCTCCTCCATAGGGACCCCCAGG - Intronic
1176190097 20:63804449-63804471 CCTCCTCCAGGAAGCCCTCCCGG + Intronic
1177807503 21:25888661-25888683 GCTCCTGCAAGGATACCTCCTGG + Intronic
1178061856 21:28861578-28861600 CCTTCCCCAAGGAGACGTCATGG + Intergenic
1178913911 21:36696611-36696633 CCTCCAGCAGGGAGAGCTCCGGG + Intergenic
1179279313 21:39920904-39920926 CCTCTGCCAAGGAGCCATCCTGG - Intronic
1179597394 21:42452079-42452101 CCCCCTCCAGGAAGCCCTCCTGG + Intergenic
1179966476 21:44809687-44809709 CCTGCTCCTCAGAGACCTCCTGG - Intronic
1180031407 21:45210991-45211013 CTTTCTCAAAGGAGACCTCAGGG - Intronic
1180091349 21:45535168-45535190 CCTCCTCCAGGGAGACCCCCCGG - Intronic
1180814521 22:18781295-18781317 CCTCCTCCAAGAAGTCCTCCTGG + Intergenic
1180841742 22:18962139-18962161 CCTCCTCCAGGCAGCCATCCTGG + Intergenic
1180844933 22:18975770-18975792 CCTCCTCCTGGGAGCCTTCCTGG + Intergenic
1181041062 22:20192830-20192852 CCTCCTCCATGCTGGCCTCCGGG + Intergenic
1181047085 22:20220273-20220295 CCTCCTCCAGGAAGCCTTCCTGG + Intergenic
1181056526 22:20262939-20262961 CCTCCTCCTGGGAGCCTTCCTGG - Intronic
1181200709 22:21215631-21215653 CCTCCTCCAAGAAGTCCTCCTGG + Intronic
1181701032 22:24621342-24621364 CCTCCTCCAAGAAGTCCTCCTGG - Intronic
1181728027 22:24825082-24825104 CCTCCTCCTAGAAGCCTTCCTGG - Intronic
1181761411 22:25061326-25061348 CCTTCTCCAAGAAGCCCTCCTGG + Intronic
1181774135 22:25147570-25147592 CCTCAGCCAAGAGGACCTCCAGG - Intronic
1181830300 22:25555189-25555211 CCTCCTCAGAGAAGGCCTCCTGG + Intergenic
1181870849 22:25898143-25898165 CTTCCTCCAGGGTCACCTCCAGG - Intronic
1181872511 22:25911179-25911201 GCTCTTCAAAGGAGACCTTCAGG + Intronic
1182019030 22:27065457-27065479 CCTCCTTAAAAGAGACCCCCTGG + Intergenic
1182108681 22:27707329-27707351 CCTCCTCCATAAAGCCCTCCTGG - Intergenic
1182512126 22:30826991-30827013 CCTCCTCCAGGAAGCTCTCCAGG - Intronic
1182991899 22:34776239-34776261 CCTCCTCCAGGAAGTCCTCTTGG - Intergenic
1183270634 22:36860623-36860645 CCTCCTCCAGGAAGCCCTCCTGG - Intergenic
1183370582 22:37429485-37429507 CCTTCTCCCTGGAGACCTCCAGG + Intergenic
1183371914 22:37437535-37437557 TCTCTTCCAAGGAGACTTCCTGG - Intergenic
1183392437 22:37553102-37553124 CCTCCTCCAGGCAGTCTTCCTGG + Intergenic
1183817164 22:40312223-40312245 CCTGCTCCCAGGAGACTTCAGGG - Intronic
1183830580 22:40416575-40416597 CCTGCTCACAGGAGACATCCTGG + Intronic
1183936432 22:41265056-41265078 CCTCTTACAAGGAGCCTTCCCGG - Intronic
1184257328 22:43294694-43294716 CGTCCTCCAGGAAGTCCTCCTGG + Intronic
1184286747 22:43476325-43476347 CCTCCTCCAGGGAGCCTTCCAGG - Intronic
1184286913 22:43477083-43477105 CCTCCAACAGGGAGCCCTCCTGG - Intronic
1184326871 22:43795010-43795032 CCTCCACCAAGGAGCTCCCCAGG + Intronic
1184371963 22:44088296-44088318 CCTCCTCCAAGAAGCCCTCCTGG - Intronic
1184387848 22:44186456-44186478 CCTCCTCCAGGGAGGCCTCCTGG + Intronic
1184418279 22:44364494-44364516 CTTCCTCCAGGGTGACCTCCTGG - Intergenic
1184470328 22:44692327-44692349 CCTCCTCCCAGGGCTCCTCCTGG + Intronic
1184491181 22:44810040-44810062 CCTCCTCCAGGAAGGCTTCCTGG + Intronic
1184493356 22:44823314-44823336 CCTCCTCCTAGAAGTCTTCCTGG - Intronic
1184517508 22:44971704-44971726 CCACCTCCAGGGAGCCCTCGTGG + Intronic
1184660291 22:45962517-45962539 CCTCCTCCAAGAAGTCCACCAGG + Intronic
1184666678 22:45992924-45992946 CCTCCTCCAGGGAGCCCTCCTGG + Intergenic
1184674198 22:46031701-46031723 CCTCCTCCAGGGAGCTTTCCAGG - Intergenic
1184890893 22:47378453-47378475 CCTCCTCCAGGAAGCCTTCCTGG - Intergenic
1185060166 22:48602464-48602486 CCACCTCCACGGATGCCTCCTGG - Intronic
1185098821 22:48826638-48826660 GCTCCTCCCAGGAGGCCGCCTGG + Intronic
1185165647 22:49260776-49260798 CCGCCTCCAAAGGGTCCTCCTGG - Intergenic
1185165662 22:49260846-49260868 CCACCTCTGAGGAGTCCTCCTGG - Intergenic
1185207572 22:49548866-49548888 CCTCCTCCACCCAGACCTCCGGG - Intronic
1185316288 22:50180623-50180645 CCTCCTCCAGGAAGCCTTCCTGG - Intergenic
1185343457 22:50301529-50301551 TCTCCTGAAAGGAGGCCTCCCGG + Intronic
1185364986 22:50433326-50433348 CCTCCTCCAGGTTCACCTCCAGG - Intronic
1185365028 22:50433450-50433472 CCTCCTCCAGGTTCACCTCCAGG - Intronic
1185365132 22:50433760-50433782 CCTCCTCCAGGTTCACCTCCAGG - Intronic
1185365155 22:50433822-50433844 CCTCCTCCAGGTTCACCTCCAGG - Intronic
1185365240 22:50434070-50434092 CCTCCTCCAGGTTCACCTCCAGG - Intronic
1185365302 22:50434256-50434278 CCTCCTCCAGGTTCACCTCCAGG - Intronic
1185365346 22:50434380-50434402 CCTCCTCCAGGTTCACCTCCAGG - Intronic
1185365390 22:50434503-50434525 CCTCCTCCAGGTTCACCTCCAGG - Intronic
1185365413 22:50434565-50434587 CCTCCTCCAGGTTCACCTCCAGG - Intronic
1185365454 22:50434677-50434699 CCTCCTCCAGGTTCACCTCCAGG - Intronic
1185365475 22:50434739-50434761 CCTCCTCCAGGTTCACCTCCAGG - Intronic
1203226208 22_KI270731v1_random:79804-79826 CCTCCTCCAAGAAGTCCTCCTGG - Intergenic
1203264620 22_KI270734v1_random:6982-7004 CCTCCTCCAAGAAGTCCTCCTGG + Intergenic
950086310 3:10260481-10260503 CCTCCTCCATGCTGACCTCTGGG - Exonic
950528197 3:13536858-13536880 CCTCCTCCCAGGAGCTCTCCTGG - Intergenic
950638581 3:14333346-14333368 CCTCCTCCAGGAAGCCCTCCTGG + Intergenic
950652981 3:14419201-14419223 GCTCCTCCAAGCAGCCCTCTTGG + Intronic
950860164 3:16140651-16140673 CCTGCTGCATGGATACCTCCGGG - Intergenic
950964852 3:17139022-17139044 CCTCCTCCCTGGGGAGCTCCTGG + Intergenic
953009555 3:39011699-39011721 GCTCCTTCAAGGAGACTTCCAGG - Intergenic
953027794 3:39154613-39154635 CCTCCTCCAGGGAGCCTTCGTGG + Intergenic
953032680 3:39188551-39188573 CCTCCTCCAGGGAAATCCCCCGG + Exonic
954156421 3:48687340-48687362 CCTCCTCCCAGAAGCCCTCCTGG + Intergenic
954456484 3:50602445-50602467 ACTCCTCCAGGCAGCCCTCCAGG - Intergenic
954622761 3:52005290-52005312 CCTTGTCCTAGGAGACCTGCTGG - Intergenic
954726920 3:52620076-52620098 CCTTCTCCAAGGAGACATCCTGG + Intronic
954796544 3:53164188-53164210 CTTCCTCCCAGGATATCTCCAGG + Intronic
954871375 3:53769815-53769837 CCACCTCCAAGGAGAGCCACTGG + Intronic
955187860 3:56732295-56732317 CCTCCTGCTGGAAGACCTCCAGG - Exonic
956425348 3:69128687-69128709 CCTCCTCCAGGAAGCCCTCCTGG + Intergenic
957426537 3:80046742-80046764 TCTCTTCTAAGGAGACTTCCTGG + Intergenic
958934113 3:100239215-100239237 CCTTCCCCAAGGAGACCTCTGGG + Intergenic
960949603 3:122990671-122990693 TCTCCTTCATGGAGCCCTCCTGG + Intronic
960956491 3:123035170-123035192 CCTCCTTCAAGAAGCCTTCCTGG - Intergenic
961444747 3:126974141-126974163 CCCTCTCCATGGAGACCCCCTGG + Intergenic
961467344 3:127089885-127089907 CCTCCTCCAGGGAGCCCTCTTGG - Intergenic
962370149 3:134814501-134814523 CCTCCTCCAGGAAGCCATCCTGG - Intronic
962752101 3:138441069-138441091 CTTCCTCCAAGAAGGCTTCCTGG - Intronic
962923970 3:139975026-139975048 CCTCCTCCATAGAGATATCCTGG - Intronic
964322838 3:155516100-155516122 CCACTTCCCTGGAGACCTCCAGG + Intronic
964763425 3:160155903-160155925 CCTCCTCCATGAAGTCTTCCTGG - Intergenic
966313798 3:178623920-178623942 CCTTCTCTCAGGAGAGCTCCTGG - Intronic
967188034 3:186961916-186961938 CCACCCACAAGGAGCCCTCCTGG - Intronic
968655333 4:1776105-1776127 CCTCCACCAGGAAGTCCTCCAGG + Intergenic
968655823 4:1778062-1778084 CCTCTTCCAGGAAGTCCTCCTGG - Intergenic
968903491 4:3441712-3441734 CCTCCTCCAGGAAGTCTTCCAGG - Intergenic
968982547 4:3858207-3858229 CCACCTCCAGGAAGCCCTCCTGG + Intergenic
969090082 4:4687285-4687307 CCTCCTACAGGAAGGCCTCCTGG + Intergenic
969299179 4:6287431-6287453 CCTCCTCCAGGATGACCTCCTGG + Intronic
969316637 4:6385487-6385509 CCTCCTCCAGGAAGCCTTCCTGG + Intronic
969345096 4:6564962-6564984 CCACCTCCAGGAAGGCCTCCAGG + Intergenic
969354036 4:6614679-6614701 CTTCTTCCAGGGAAACCTCCTGG + Intronic
969453742 4:7289311-7289333 CCTCCTCCAGGAAGCCTTCCTGG + Intronic
969456041 4:7300205-7300227 CCTCCTCCAGGAAGCTCTCCTGG - Intronic
969470534 4:7385054-7385076 CCTGCTCCACAGAGCCCTCCTGG - Intronic
969528214 4:7714943-7714965 CCTCCTCCAGGCAGCCCTCCAGG + Intronic
969585221 4:8087622-8087644 CCTCCTCCAGGAAGCCTTCCAGG - Intronic
969615028 4:8247269-8247291 CCTGCTTCCTGGAGACCTCCTGG - Intergenic
969720704 4:8891919-8891941 CCTCCTCCAGGCAGTCTTCCCGG + Intergenic
970011606 4:11465395-11465417 CCTCTTCCCAGAAGACCTCCAGG + Intergenic
970715341 4:18915322-18915344 CATCCTCCAAGGAAACTTCAGGG - Intergenic
971342324 4:25781975-25781997 CCTCCTCCAAGAAGCCTTCCTGG + Intronic
971479149 4:27098912-27098934 CCTCCTCTAGGAAGCCCTCCTGG - Intergenic
980077173 4:128306197-128306219 CCTCCTCCAAGTAGCCTTCCTGG - Intergenic
981746536 4:148057661-148057683 CCTCCTCCAGGAAGCCCTCCTGG + Intronic
981834797 4:149042521-149042543 TCTTCCCCAAGGAGACCTCTGGG + Intergenic
982821269 4:159943078-159943100 TTTCCTCCAAGAAGATCTCCAGG + Intergenic
983899835 4:173122164-173122186 CTTCCTGCAAGAAGACTTCCTGG + Intergenic
985521310 5:375060-375082 CCTGCTCCCAGGAATCCTCCTGG - Intronic
985773381 5:1826787-1826809 CCACCTCAAGGGTGACCTCCTGG + Intergenic
985821936 5:2166430-2166452 CCATCTCCAAGGAGTCCTCCTGG - Intergenic
988609648 5:32712436-32712458 CCTCCTCCTGGAAGACCTCGTGG - Exonic
988646936 5:33105198-33105220 CCACATCCAGGCAGACCTCCAGG - Intergenic
989400798 5:41005558-41005580 CCTCCTCCTCGGAGAACTACCGG - Exonic
989980760 5:50641584-50641606 CCTCCTCAAAGGCCACCTACAGG + Intergenic
992180887 5:74197391-74197413 CCTCCTCAATGGAGACCACGTGG + Intergenic
997436631 5:133880391-133880413 CCTCCTCCAGGAAGCCCTCCTGG + Intergenic
997605189 5:135170202-135170224 CCCCCTCGAAGGAGAACTGCAGG - Intronic
998134422 5:139667261-139667283 CCTCCTCCAAGAAGCCCTCTGGG + Intronic
998139501 5:139691904-139691926 CCTCCTCCAAGAAGCCTTCTTGG - Intergenic
998379517 5:141714181-141714203 CCTCCTCCAAGGAGCCTGCCTGG - Intergenic
998743317 5:145229236-145229258 CATCCTCCAGGGAGCCCTCCAGG - Intergenic
999173894 5:149618242-149618264 CCCTCTCCAAGAAGACCACCCGG + Exonic
999233030 5:150073431-150073453 CCTCCCCCACGGTCACCTCCTGG + Exonic
999311915 5:150557189-150557211 CCTTCTCCAGGGAGACTTTCCGG - Exonic
999324969 5:150638206-150638228 CCTCCTCCAGGAAGACTTCCTGG + Intronic
1000912401 5:167038018-167038040 CTTTCCCAAAGGAGACCTCCTGG + Intergenic
1001284340 5:170411511-170411533 CCACCTCCAAGAAGCCTTCCAGG - Intronic
1001637058 5:173217964-173217986 CCTCCCCCAGGGAGGCCTCTGGG + Intergenic
1001647719 5:173294776-173294798 CCTACTCCAGGAAGCCCTCCTGG - Intergenic
1002098632 5:176846526-176846548 TCTCCTCCAGGAAGCCCTCCTGG + Intronic
1002566254 5:180113952-180113974 CCTCCTCCAGGAAGCCCCCCTGG - Intronic
1002870630 6:1164573-1164595 ACTCCTCCAAGGAGAGCCCAAGG + Intergenic
1003007140 6:2392526-2392548 CCTCCTTTAAGGACACCTCAGGG - Intergenic
1003474940 6:6472596-6472618 CCTCCTCCAAGAAGAGCTTATGG + Intergenic
1005522478 6:26613172-26613194 GCTCCTGCAGGGTGACCTCCTGG + Intergenic
1006321326 6:33321304-33321326 CCACCTCCAATGAGCCCTCTGGG - Exonic
1006386027 6:33731349-33731371 GTCCCTCCAGGGAGACCTCCTGG - Intronic
1006401305 6:33819235-33819257 CCTCCTCCTGGGAGCCCTCCTGG - Intergenic
1006501786 6:34464042-34464064 CCTCCTCCAGGAAGCCTTCCTGG + Intergenic
1006792665 6:36714105-36714127 GCCCCTCCAGGGAGGCCTCCGGG + Intronic
1007290702 6:40784049-40784071 ACCCCTCCAAGAAGACCTTCAGG - Intergenic
1007630214 6:43269352-43269374 CCTCCTCCGAGAAGCCTTCCTGG - Intronic
1007709394 6:43812176-43812198 CCTCCTCCAAGGACATCTTCAGG - Intergenic
1007715178 6:43851524-43851546 TCTCCTCCAAGGAGGCCACCTGG + Intergenic
1008699459 6:54081234-54081256 CCGCCACCATGGAGACCTGCGGG - Intronic
1010282974 6:74041580-74041602 CCTCCCCCAAGGAGCCCTGATGG + Intergenic
1010387579 6:75300000-75300022 CTACAGCCAAGGAGACCTCCTGG - Intronic
1010543561 6:77122921-77122943 CCACCTCCAAGCAGATCTCCAGG - Intergenic
1012780074 6:103546686-103546708 GCTCCTCCATGGAGCACTCCTGG + Intergenic
1015268270 6:131311429-131311451 CCTCCCACAAGGAAAACTCCTGG + Intergenic
1017430180 6:154363207-154363229 CCCCCTCCCTGGAGACCCCCGGG + Intronic
1018313856 6:162537561-162537583 CCTCCTCCAAGGCAATCTGCCGG + Intronic
1018952432 6:168387809-168387831 TCTCCTCCCTGGGGACCTCCAGG - Intergenic
1019493223 7:1324646-1324668 CCTCCTCCAGGGAGAACTCCTGG - Intergenic
1019508023 7:1403253-1403275 CCTCCTCCAGGAAGAACTCCTGG - Intergenic
1019603102 7:1895081-1895103 CCTTCTCCAGGAAGCCCTCCTGG - Intronic
1020082062 7:5291520-5291542 CCTCCTACAGGAAGCCCTCCAGG + Intronic
1022503515 7:30896871-30896893 CCTCCTCTAAGAAGCCCTCCTGG + Intergenic
1022843232 7:34184534-34184556 CCTCCTCCAAGGAAAGCTGCTGG + Intergenic
1022855095 7:34305600-34305622 CCTCATCCATGCAGACCTCAGGG + Intergenic
1023207145 7:37763444-37763466 CCTCCTCCAAGGAGCCCAGAAGG - Intronic
1023967549 7:44970781-44970803 CCTCCCCCATGAAGGCCTCCTGG + Intronic
1024005450 7:45222230-45222252 CCACCTCCATGGCCACCTCCTGG + Intergenic
1024023485 7:45391643-45391665 CCGCCTCCAGGCAGGCCTCCAGG + Intergenic
1024237654 7:47410069-47410091 CCTTCTCCCAGGACACTTCCTGG - Intronic
1024360138 7:48459633-48459655 CTTCCTACAGGGAGACTTCCTGG + Intronic
1024455182 7:49597835-49597857 CTTCCTCCAAGGAGCCTTCCTGG - Intergenic
1025196856 7:56940618-56940640 CCTCCTACAGGAAGCCCTCCAGG - Intergenic
1025675092 7:63636319-63636341 CCTCCTACAGGAAGCCCTCCAGG + Intergenic
1025815075 7:64903532-64903554 GCTGCGCCAAGGAGAACTCCTGG - Intronic
1026170150 7:67946812-67946834 CCTCTACCAGGCAGACCTCCTGG + Intergenic
1026859760 7:73778181-73778203 CCTCCTACAGGAAGCCCTCCTGG - Intergenic
1026865018 7:73818382-73818404 CCTCCTCTAGGGAGACTTCCTGG - Intronic
1026897603 7:74019331-74019353 CCTCCTCCAGGAAGCCCTCCTGG + Intergenic
1027131844 7:75596818-75596840 CCTCCTCCCAGGGAGCCTCCCGG + Intronic
1027170994 7:75872339-75872361 GCTTCTCCAGGGAGGCCTCCTGG + Intronic
1027173374 7:75888312-75888334 CAGGCTCCAAGGAGTCCTCCAGG + Exonic
1029515903 7:101022840-101022862 CCTCCTCCAGGGAGCCTTCCAGG + Intronic
1029606901 7:101604730-101604752 CCTCCTCCAGGAAGCCCTCCAGG + Intergenic
1029623184 7:101702709-101702731 CCTCCTCCAGGAAGCCTTCCTGG - Intergenic
1029630501 7:101747448-101747470 CCTCCTCCAGGAAGCCTTCCAGG + Intergenic
1031144618 7:117984167-117984189 CCTCTTCCAAGAAGCCTTCCTGG - Intergenic
1032001387 7:128267672-128267694 CATCCACCAAGCAGCCCTCCTGG - Intergenic
1032843994 7:135737116-135737138 CCTCCTCCAGGGAGGTCTGCAGG + Exonic
1033276176 7:139973146-139973168 CGGCCTCCGAGGAGACCTCTGGG + Intronic
1033587981 7:142788323-142788345 CCTCCCGCAAGGGGTCCTCCTGG - Intergenic
1034283953 7:149872536-149872558 CCTCCTCCAGGGAGTCTTCCTGG + Intergenic
1034489813 7:151387226-151387248 CCTGCACCAAGGAGGCTTCCTGG + Intronic
1034549198 7:151809538-151809560 CCCCCTCCAAGGATACCTCCAGG + Intronic
1034878410 7:154745226-154745248 ACTCCACTATGGAGACCTCCAGG - Intronic
1035022440 7:155807516-155807538 CCTCCTCCCAGGCAACTTCCTGG - Intronic
1035101640 7:156402346-156402368 CCTACCCCAAGGAGACCACGGGG + Intergenic
1036635327 8:10546600-10546622 CCCCCTCCAGGAAGCCCTCCTGG + Intronic
1036635795 8:10548773-10548795 CCCCCTCCAGGCAGCCCTCCTGG + Intronic
1037300897 8:17451029-17451051 CATGCTCCATGGAGTCCTCCCGG + Intergenic
1038330479 8:26604425-26604447 CCTCCTCCAGGAAGCCTTCCAGG - Intronic
1038695038 8:29798934-29798956 TCTCCTCCAGGAAGACTTCCTGG - Intergenic
1040101685 8:43511881-43511903 CCTCTTCCCAGTAGCCCTCCAGG - Intergenic
1040723277 8:50350927-50350949 CAGCCTCCAAGGGGACCTACGGG - Intronic
1041196742 8:55408618-55408640 CCACCTGCCAGGAGACCTCAGGG - Intronic
1041433471 8:57810489-57810511 ACTCCTCCAAAGAGACCTCTGGG - Intergenic
1042871833 8:73406722-73406744 CTTCCTGCAAGAAGCCCTCCTGG - Intergenic
1043457239 8:80424812-80424834 CCTCCTCTAGGGAGTCTTCCCGG + Intergenic
1044002117 8:86895732-86895754 CCTCATCCAAGAAGACATACAGG - Intronic
1047180830 8:122586185-122586207 CCTCCAACAGGGAGACATCCTGG + Intergenic
1047288840 8:123511404-123511426 CCACTTCCAAGGACCCCTCCTGG - Intronic
1047347121 8:124039199-124039221 CCTTCTCCCAGGAGCTCTCCAGG + Intronic
1048069832 8:131009733-131009755 CCTCCTCGAGGGAGCCTTCCTGG - Intronic
1048461528 8:134625458-134625480 CCTCCTTCAAGAAGCCTTCCAGG + Intronic
1048829948 8:138466130-138466152 CCTCTTCCAACAAGAGCTCCAGG + Intronic
1049220495 8:141426691-141426713 CCTCCTCCAGGAAGCCTTCCTGG - Intronic
1049352194 8:142170339-142170361 CCTCCTCCAGGAAGCCCTCCTGG - Intergenic
1049426498 8:142540247-142540269 CTTCCTCCAGGAAGCCCTCCTGG - Intronic
1049803372 8:144528339-144528361 CCTCCTCCGCGGAGACTACCTGG + Intronic
1052363285 9:27583003-27583025 CCTCCTCCATGAAGTCTTCCTGG + Intergenic
1053350630 9:37411342-37411364 CCTCCTCCAACCTGATCTCCTGG - Intergenic
1053455864 9:38232830-38232852 CCTCCTCCCAGGATTCCCCCTGG + Intergenic
1056457936 9:86781424-86781446 CCACCTGCAGGGAGACCACCTGG - Intergenic
1056942152 9:90964949-90964971 ACTCCCCCAAGGGGTCCTCCTGG + Intergenic
1057004282 9:91543240-91543262 CCTCCTCCAGGAAGACGTGCTGG - Intergenic
1057152749 9:92809092-92809114 CCTCCTCCAAAGAGAGATCGGGG - Intergenic
1057196937 9:93120696-93120718 CCTCCTCCAAGCAGCCTTCCAGG - Intergenic
1057499813 9:95587733-95587755 CCTCCTCCAGGGAGCCTTCTGGG - Intergenic
1057520893 9:95759446-95759468 CATCCTCAAAGCTGACCTCCAGG + Intergenic
1057724732 9:97560335-97560357 CCTCCTCCAGGGAGTCTTCCTGG - Intronic
1058695928 9:107559013-107559035 CCTCCTCCAAAAAACCCTCCTGG + Intergenic
1058910896 9:109518972-109518994 CTTCCTCCAGGAAGACTTCCTGG + Intergenic
1059407792 9:114112683-114112705 CCTCTTCCAAGAAGCCCTGCTGG + Intergenic
1059421806 9:114196876-114196898 CCTACTCCAGGAAGTCCTCCTGG + Intronic
1059767932 9:117401375-117401397 CCTCCTCCAAGTAGTCTTCCCGG - Intronic
1060187418 9:121572210-121572232 CCTCCTACCAGGACAGCTCCTGG + Intronic
1060199397 9:121643677-121643699 CCTCCTCCAGGCAGTCTTCCAGG + Intronic
1060361075 9:122958242-122958264 CCTCCCCCAGGCAGCCCTCCAGG + Intronic
1060376295 9:123117566-123117588 CCTACTCCAAGGGAAACTCCTGG + Intronic
1060736133 9:126067530-126067552 CCTCCTCCAGGAAGGCCTCCTGG + Intergenic
1061077806 9:128352475-128352497 CCTCCTCCAAGAAGCCTCCCCGG - Intronic
1061119062 9:128632180-128632202 CCTCCTCCATGGCGGCCCCCAGG - Exonic
1061301865 9:129710090-129710112 CCTCCTCCAAGAAGCCCTCCTGG - Intronic
1061389890 9:130311615-130311637 CCTCCTCCAAGAAGTCTTCCTGG - Intronic
1061805827 9:133137449-133137471 CCTCTTCCAAGGAGCTCTCCTGG - Intronic
1061913976 9:133739543-133739565 CCTCCTCTAAGAGGTCCTCCTGG - Intronic
1062028097 9:134349778-134349800 CCTCCTCCAAGCAGCCTTCCTGG - Intronic
1062280239 9:135748668-135748690 CCTCCTCCACGCAGCCGTCCAGG + Intronic
1062451920 9:136619362-136619384 CCTCCTTCAGGAAGTCCTCCTGG - Intergenic
1062586113 9:137250833-137250855 CTTCCTCCAGGGAGCCTTCCTGG + Intergenic
1062624645 9:137437238-137437260 CCTCCTCCAAGCAGCCCTGCAGG + Exonic
1185474107 X:403436-403458 GCTCTCCCTAGGAGACCTCCTGG + Intergenic
1186414352 X:9370368-9370390 CCTCCTAGAAGGAGAGCTCACGG - Intergenic
1186577620 X:10783342-10783364 CCTCTTCCAAGAAGACCTGCAGG + Intronic
1187491137 X:19752587-19752609 CATCCTCCCAGGAGACTCCCTGG - Intronic
1192449316 X:71233619-71233641 CCTGCTCCAGGTAGACATCCTGG - Intergenic
1196122003 X:112061328-112061350 CCATCTCCAAGGATACCCCCAGG - Intronic
1197718577 X:129728330-129728352 TCTACTCCCCGGAGACCTCCAGG - Intergenic
1200694512 Y:6347060-6347082 CCTTCTCCCAGGGGACCTCCTGG + Intergenic
1201013423 Y:9573419-9573441 CCTCGCACTAGGAGACCTCCAGG - Intergenic
1201040765 Y:9827650-9827672 CCTTCTCCCAGGGGACCTCCTGG - Intergenic
1201796808 Y:17904977-17904999 CTTTCCCCAAGAAGACCTCCAGG - Intergenic
1201804745 Y:18001008-18001030 CTTTCCCCAAGAAGACCTCCAGG + Intergenic
1202358187 Y:24074039-24074061 CTTTCCCCAAGAAGACCTCCAGG - Intergenic
1202369602 Y:24187903-24187925 CCTCTTCCAGGGTGGCCTCCAGG + Intergenic
1202501183 Y:25482214-25482236 CCTCTTCCAGGGTGGCCTCCAGG - Intergenic
1202512591 Y:25596074-25596096 CTTTCCCCAAGAAGACCTCCAGG + Intergenic