ID: 1083888852

View in Genome Browser
Species Human (GRCh38)
Location 11:65585746-65585768
Sequence CTATCTGATCAGAGGGACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 100}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083888852 Original CRISPR CTATCTGATCAGAGGGACCC TGG Intronic
900079414 1:844413-844435 ACATCTGCTCAGAGGGAGCCTGG - Intergenic
901036341 1:6338427-6338449 CTCTGACATCAGAGGGACCCTGG - Intronic
902619413 1:17642271-17642293 ATATCTGGTCAGAGTGATCCAGG + Intronic
903776520 1:25797565-25797587 GGATTTGAGCAGAGGGACCCGGG - Intergenic
903787061 1:25868331-25868353 TTATCAGATCACAGGCACCCAGG - Intronic
904449320 1:30600806-30600828 CTATCTGATTCAGGGGACCCAGG + Intergenic
905024181 1:34838471-34838493 CTACCTACTCAGAGAGACCCCGG - Intronic
907874431 1:58472097-58472119 AGAGATGATCAGAGGGACCCTGG - Intronic
908268348 1:62399774-62399796 TTATCTGATCTTAGGGACTCAGG - Intergenic
912252480 1:108025839-108025861 CTATGTTATCAGAGAGGCCCTGG - Intergenic
914336989 1:146724529-146724551 TTCTCTGAGCAGAGGAACCCAGG - Intergenic
914513904 1:148357335-148357357 AAATCTGACCAGAGTGACCCTGG - Intergenic
918049066 1:180958795-180958817 CTATGTGTTGTGAGGGACCCAGG - Intergenic
918076487 1:181175046-181175068 GGTTCTCATCAGAGGGACCCAGG + Intergenic
924554524 1:245107422-245107444 CGATCAGAACAGAAGGACCCGGG - Intronic
1063611873 10:7569667-7569689 GTCTCTGATCACAGGGACTCTGG - Exonic
1066432370 10:35363513-35363535 TTACCTGATCAAAGTGACCCTGG + Intronic
1072693118 10:97584451-97584473 ATATCTGGCCAGAGGGACACTGG + Exonic
1074307874 10:112295950-112295972 CTACCAGATCAGAAGGACTCTGG + Intronic
1074819652 10:117168531-117168553 CTCGCTGATCAGAGAGAGCCGGG - Intergenic
1074970400 10:118531677-118531699 CTAACTTATCAAAGGGAGCCAGG + Intergenic
1075760157 10:124849469-124849491 CTGCCTGCTCAGAGGTACCCAGG + Intergenic
1076281819 10:129252802-129252824 ATGTGTCATCAGAGGGACCCCGG - Intergenic
1079315469 11:19404300-19404322 CTCTCTCATCTGAGTGACCCAGG - Intronic
1083888852 11:65585746-65585768 CTATCTGATCAGAGGGACCCTGG + Intronic
1084893910 11:72251373-72251395 GTAACAGATCAGAGGGAGCCTGG - Intergenic
1085154096 11:74277434-74277456 ACATCTGAACAGAGGGACCCGGG + Intronic
1085367732 11:75966983-75967005 CTTTCTGACCAGAGGAACCAGGG - Intronic
1085783117 11:79427160-79427182 CTACCAGACTAGAGGGACCCTGG + Intronic
1088720672 11:112589409-112589431 CTGTCTGAGCAGAGGGGCCCTGG + Intergenic
1089100323 11:115957727-115957749 CTTTCTGATCAGAGGGCTCCTGG + Intergenic
1095676893 12:44930704-44930726 CTGTCAGATCAGACAGACCCAGG + Intergenic
1095874292 12:47063717-47063739 CTCTCTGAAGAGAGGGACACAGG - Intergenic
1097633120 12:62088439-62088461 CTGTCTGAGCAGAAGGACCGGGG - Intronic
1101137250 12:101756966-101756988 CAAGCTGTTCAGAGAGACCCAGG - Intronic
1108771633 13:53709115-53709137 ATATCTCAGCAGAAGGACCCTGG + Intergenic
1111085788 13:83373738-83373760 CTCTCTGATGGGAGAGACCCAGG - Intergenic
1120037556 14:79715355-79715377 CTCCCTGAGCAGAGAGACCCAGG + Intronic
1125430796 15:39591359-39591381 CTGCCTGATCAGAGGGCCCGCGG + Intronic
1126437254 15:48648047-48648069 GGATCTGAGCAGAGGGACCATGG + Intergenic
1127398136 15:58559503-58559525 CCATCTCAACAGAGGGATCCAGG + Intronic
1130033762 15:80339879-80339901 CTATCTGGTCTCAGGGATCCTGG + Intergenic
1130092405 15:80831806-80831828 CTTTCTTGTCAGAGGGACTCTGG + Intronic
1139997280 16:70992790-70992812 TTCTCTGAGCAGAGGAACCCAGG + Intronic
1142559817 17:803281-803303 CGATCTCATCAGAGGGATCCTGG - Intronic
1143385348 17:6526257-6526279 GTATCTGATGTGTGGGACCCAGG - Intronic
1144787914 17:17842104-17842126 CTATCTGTTTAAAGGGACCTGGG + Intergenic
1146587422 17:34094159-34094181 CTATTTGCCCAGAGTGACCCTGG - Intronic
1146785399 17:35716083-35716105 CTCTCTGAACAAAGGGATCCTGG - Intronic
1152488888 17:80615355-80615377 GCATCTGATCATAGGAACCCAGG + Intronic
1153256782 18:3179675-3179697 CTATCTGATCAGAGATGGCCTGG + Intronic
1153707247 18:7758232-7758254 GTATCTGAACAGAGCTACCCAGG - Intronic
1158009659 18:52714193-52714215 CTATCTGACCACAGGGTCCATGG + Intronic
1158635880 18:59157015-59157037 ATATGTAATCAGATGGACCCAGG - Intronic
1161455943 19:4369763-4369785 GGAGCTGAGCAGAGGGACCCGGG - Intronic
1165075084 19:33276060-33276082 CACCCTGATCAGGGGGACCCAGG - Intergenic
925715431 2:6780551-6780573 CTTTCTGAGGAGTGGGACCCTGG - Intergenic
927119179 2:19938675-19938697 CAATCTGAGCAGAGGGAAACAGG - Intronic
929646919 2:43637353-43637375 CTATCTCAGCAGCGGGTCCCCGG - Exonic
932307949 2:70717085-70717107 CTCTCTGCACAGAGGAACCCAGG + Intronic
938572582 2:132573644-132573666 CCATCAGATGGGAGGGACCCAGG - Intronic
939643849 2:144672204-144672226 CCATCTGCTCACAGGGACCATGG + Intergenic
940238782 2:151540612-151540634 CTCTCTGATCAGAGGTAGCAGGG + Intronic
942112841 2:172699925-172699947 CTCTCTAATCTGAGGTACCCAGG - Intergenic
945935606 2:215900139-215900161 CAATTTGTTCAGCGGGACCCTGG - Intergenic
946272864 2:218608739-218608761 CTACCAGATCAGAGTTACCCAGG - Intronic
948556650 2:238816189-238816211 AGATCTGACCAGAGGGACCAAGG - Intergenic
948596240 2:239081522-239081544 CTTTCTGCCCAGAGAGACCCAGG - Intronic
1169099362 20:2932641-2932663 CCATCTGCTCAGAGGGAGCTTGG + Intronic
1169965801 20:11215881-11215903 CTTTTTGATTAGAGGGACCCAGG - Intergenic
1176018624 20:62951744-62951766 CTTTCTGTTCAGAGGGCCCTGGG + Intergenic
1177504990 21:22008035-22008057 ATATCTGAACAGAGGGATCAGGG - Intergenic
1179988360 21:44933072-44933094 CTCTGTGAGCAGAGGGGCCCCGG + Intronic
1180670505 22:17548984-17549006 TTATCTGAGAAGAGGGACCTTGG - Exonic
1180973764 22:19832702-19832724 CTTTCTGATCAGGGGAACCAAGG + Intronic
1181801111 22:25348581-25348603 CTCACAGCTCAGAGGGACCCAGG + Intergenic
1181818670 22:25458995-25459017 CTCTTTGATCAGAAGGCCCCTGG + Intergenic
1183864274 22:40691806-40691828 CTATTTGATGAGCTGGACCCAGG - Intergenic
1183891025 22:40928795-40928817 CTATCTTATCAGGGAAACCCAGG + Exonic
953023983 3:39134375-39134397 GCATCTGGTCACAGGGACCCTGG - Intronic
954186125 3:48918503-48918525 CTATCTGGTCAGAGGGGAGCTGG - Exonic
956636962 3:71374825-71374847 CTATCTGTTCAGAGAGTACCAGG - Intronic
962471273 3:135711382-135711404 CTATCTGGGCAGCTGGACCCTGG - Intergenic
963208145 3:142657442-142657464 CTTTCTTATCTGAGGGACTCTGG - Intronic
968651832 4:1763249-1763271 CTCTCTGTTCAGTGGGACCCAGG - Intergenic
968945920 4:3664147-3664169 CTCACTGATCAGGAGGACCCTGG + Intergenic
975366692 4:73538006-73538028 CTATCTCATCAGAGAGAGCTAGG - Intergenic
998134113 5:139665754-139665776 CAAGCTGGGCAGAGGGACCCCGG + Intronic
1000230271 5:159309660-159309682 CCATTTGAACAAAGGGACCCTGG + Intergenic
1000505981 5:162118724-162118746 AAATCTGATCACAGGAACCCAGG - Intronic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1019716357 7:2541221-2541243 CTTTCTGCTCGGAGGCACCCGGG - Intronic
1022148244 7:27569804-27569826 CTCTCTGATCAGAGGAACTATGG - Intronic
1022258671 7:28683590-28683612 CTCCCTGATCAGAGGCACACTGG + Intronic
1032534355 7:132649597-132649619 CTAACTGTTCTGTGGGACCCAGG - Intronic
1035982347 8:4386606-4386628 ATATTTAATCAGAGAGACCCTGG + Intronic
1039965518 8:42281002-42281024 CTCTCTGATCACAGTGATCCAGG + Intronic
1047794785 8:128243515-128243537 ATGTATCATCAGAGGGACCCAGG + Intergenic
1047919357 8:129618088-129618110 ATATGTTGTCAGAGGGACCCAGG + Intergenic
1050291187 9:4156740-4156762 TTATCTGATGAGGAGGACCCTGG + Intronic
1052223326 9:26054238-26054260 ATATTTGATCAGAGAGACCAAGG + Intergenic
1061550163 9:131329705-131329727 CTCTGTGATCAGGGGGACCTTGG + Intergenic
1189240888 X:39523449-39523471 CTTCCTGAACAGAGAGACCCTGG + Intergenic
1189540726 X:41985091-41985113 CTGGCTTCTCAGAGGGACCCAGG + Intergenic
1192170359 X:68851057-68851079 CCCTGTGATCAGAGGGACTCTGG + Intergenic
1201850624 Y:18476000-18476022 CTGGCTGATGAGAGGGAGCCAGG - Intergenic
1201882694 Y:18844377-18844399 CTGGCTGATGAGAGGGAGCCAGG + Intergenic