ID: 1083890162

View in Genome Browser
Species Human (GRCh38)
Location 11:65592004-65592026
Sequence CCTCCAGTAGGAGCTGCTCT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 196}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083890162_1083890170 25 Left 1083890162 11:65592004-65592026 CCGAGAGCAGCTCCTACTGGAGG 0: 1
1: 0
2: 0
3: 22
4: 196
Right 1083890170 11:65592052-65592074 CGATGAGCTAGTCCGGGACCTGG 0: 1
1: 0
2: 0
3: 2
4: 34
1083890162_1083890169 19 Left 1083890162 11:65592004-65592026 CCGAGAGCAGCTCCTACTGGAGG 0: 1
1: 0
2: 0
3: 22
4: 196
Right 1083890169 11:65592046-65592068 CCAGCGCGATGAGCTAGTCCGGG 0: 1
1: 0
2: 0
3: 3
4: 30
1083890162_1083890167 18 Left 1083890162 11:65592004-65592026 CCGAGAGCAGCTCCTACTGGAGG 0: 1
1: 0
2: 0
3: 22
4: 196
Right 1083890167 11:65592045-65592067 ACCAGCGCGATGAGCTAGTCCGG 0: 1
1: 0
2: 0
3: 5
4: 16
1083890162_1083890166 -8 Left 1083890162 11:65592004-65592026 CCGAGAGCAGCTCCTACTGGAGG 0: 1
1: 0
2: 0
3: 22
4: 196
Right 1083890166 11:65592019-65592041 ACTGGAGGAGCTGGTGTCGCTGG 0: 1
1: 0
2: 1
3: 16
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083890162 Original CRISPR CCTCCAGTAGGAGCTGCTCT CGG (reversed) Exonic