ID: 1083890184

View in Genome Browser
Species Human (GRCh38)
Location 11:65592103-65592125
Sequence GGGCGGCGCTGGGAGTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 715
Summary {0: 1, 1: 0, 2: 4, 3: 50, 4: 660}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083890175_1083890184 4 Left 1083890175 11:65592076-65592098 CCACAAGGAGCGGATGTGAGTGG 0: 1
1: 0
2: 0
3: 6
4: 112
Right 1083890184 11:65592103-65592125 GGGCGGCGCTGGGAGTTGGGAGG 0: 1
1: 0
2: 4
3: 50
4: 660
1083890172_1083890184 16 Left 1083890172 11:65592064-65592086 CCGGGACCTGGACCACAAGGAGC 0: 1
1: 0
2: 0
3: 18
4: 219
Right 1083890184 11:65592103-65592125 GGGCGGCGCTGGGAGTTGGGAGG 0: 1
1: 0
2: 4
3: 50
4: 660
1083890174_1083890184 10 Left 1083890174 11:65592070-65592092 CCTGGACCACAAGGAGCGGATGT 0: 1
1: 0
2: 0
3: 4
4: 101
Right 1083890184 11:65592103-65592125 GGGCGGCGCTGGGAGTTGGGAGG 0: 1
1: 0
2: 4
3: 50
4: 660

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083890184 Original CRISPR GGGCGGCGCTGGGAGTTGGG AGG Intronic
900100899 1:961567-961589 GGGCGGCGCTGGGGGCTCCGTGG + Intronic
900109186 1:998481-998503 GAGCGGCGCTGGGATGAGGGCGG - Intergenic
900188177 1:1342600-1342622 GGGAGGCGGTGGGTGTGGGGAGG - Intronic
900396797 1:2456373-2456395 GGGCGGCCCTGGGGGGCGGGTGG + Intronic
900420574 1:2554331-2554353 GGGGGGCGCTGAGCGCTGGGTGG + Intergenic
900949026 1:5847230-5847252 GGGCAGCGCTGGGCGTGGAGCGG - Intergenic
901501659 1:9656132-9656154 GGGCGGTGCCAGGAGTAGGGTGG + Intronic
901918549 1:12519283-12519305 GGGCGGTGCTGGGAGGGGGCGGG + Intergenic
902571793 1:17351936-17351958 GGGAGGTGATGGGAGGTGGGAGG + Intronic
902943226 1:19815166-19815188 TGGCGCCGCTGGGACTTGGATGG + Exonic
903231835 1:21927022-21927044 GGCAGGCGCAGGGAGTGGGGAGG + Intronic
903270140 1:22183036-22183058 GGGCGGGGCAGGGCGCTGGGCGG + Intergenic
903344672 1:22676839-22676861 GAGAGGTGCTGGGAGTCGGGGGG - Intergenic
903875962 1:26472980-26473002 AGGCGGCGCTCGGGGTTGGCGGG + Intronic
904334084 1:29785783-29785805 GGGCGGGGCTGGGGGTGGTGAGG - Intergenic
904720007 1:32500666-32500688 CGGCGGCGGTGGGCGTTGGCGGG + Intronic
904922755 1:34021490-34021512 GGGAGGGGCTGGGAGTGGGCTGG + Intronic
905442623 1:38005121-38005143 GGGCGGCAGCGAGAGTTGGGCGG - Intronic
905650437 1:39652889-39652911 GGGCAGGGCTGGTAGTGGGGAGG + Intergenic
905871708 1:41408027-41408049 CGGCGGCGGTGGGGGGTGGGGGG + Intergenic
906083139 1:43107516-43107538 GGGGGGCGGTGGGAGGTGGTGGG + Intergenic
906524308 1:46485577-46485599 GGGTGGGGGTGGGAGTGGGGAGG + Intergenic
906525365 1:46490424-46490446 GGGCGGCGCGGGGAGGGAGGTGG + Intergenic
907920942 1:58911147-58911169 GGGCAAGGCTGGGAGTTAGGTGG - Intergenic
910229373 1:84970251-84970273 GGGGGGTGGGGGGAGTTGGGGGG - Intronic
910549723 1:88462684-88462706 GGGCGGCGCGGGGAGCGGGCAGG - Intergenic
910676611 1:89821785-89821807 GGGCTGCGCTGGGAGCCCGGCGG + Intronic
911055195 1:93702552-93702574 GGGTGGGGATGGGGGTTGGGGGG + Intronic
911490466 1:98558994-98559016 GTGGGGTGCGGGGAGTTGGGAGG + Intergenic
912285657 1:108365919-108365941 GGGGGGGGCAGGGAGTCGGGGGG + Intergenic
912516351 1:110218874-110218896 AGGGGGCGCAGGGAGTTGGGAGG + Intronic
913101181 1:115568198-115568220 TGGTGGGGCTGGGACTTGGGAGG + Intergenic
913451747 1:118997537-118997559 GGGAGGGGGTGGGAGTTGGGTGG - Intergenic
913462445 1:119102054-119102076 TGGTGGCGGTGGGGGTTGGGGGG + Intronic
915224986 1:154405531-154405553 GGGCGGGGCGGGGCGGTGGGCGG - Exonic
915316969 1:155034223-155034245 GGGCTGGGCTGGGAGGCGGGAGG - Intronic
915322339 1:155062687-155062709 GGGAGGGGCTGGGGGTTGGACGG + Exonic
915333515 1:155127815-155127837 GGGCGGGGCGGGGTGTCGGGCGG + Exonic
915354869 1:155250217-155250239 GGTAGGCACTGGGAGTTAGGTGG - Intronic
915511842 1:156390886-156390908 GGGAGGCGATGGGGGTTGGGTGG + Intergenic
916735187 1:167601366-167601388 TGGCTGGGCTGGGAGTTGAGGGG + Intergenic
916792630 1:168137035-168137057 GAGGGGCGCCGGGAGCTGGGCGG - Intronic
917291579 1:173477186-173477208 GGGCGGGGCTGGGCGCGGGGCGG - Intergenic
917291696 1:173477583-173477605 GGGCGGCGCAGGGGGCTGAGCGG - Intronic
917436168 1:175023496-175023518 GGGCGGAGCTGGGAGGTGGGTGG + Intergenic
919583066 1:199400985-199401007 GGGAGGGGAGGGGAGTTGGGGGG + Intergenic
919712076 1:200738838-200738860 GGGCGGGGGCGGGGGTTGGGGGG + Intergenic
919766085 1:201128039-201128061 GGCCTGTGCTGGGAGCTGGGAGG + Intergenic
919768447 1:201142098-201142120 TGGTGGCACTGGCAGTTGGGTGG - Intronic
920092119 1:203462224-203462246 TGGGGGCACTGGGAGGTGGGTGG + Intergenic
920528286 1:206684780-206684802 GCGCGGTGCCGGGAGCTGGGAGG - Intergenic
920556710 1:206909600-206909622 GGGTGGAGCTGGGAGTGGGGCGG - Intronic
920650619 1:207834539-207834561 GGGCTGGGTTGGGAGTTGAGGGG - Intergenic
920788297 1:209063888-209063910 AGGCGGCAGTGGGAGCTGGGTGG - Intergenic
920960894 1:210663210-210663232 GGGCGGCCCCAGGAGATGGGGGG + Intronic
922335666 1:224616633-224616655 GCCCGGCTCTGGGATTTGGGAGG + Exonic
922599725 1:226840680-226840702 AGGCTGAGCTGGGAGGTGGGAGG + Intergenic
922695328 1:227728468-227728490 GGGCGGGGCTGGGAGGGAGGCGG - Intergenic
922696959 1:227735634-227735656 GGGCTGCGCTGGGAGAGGGGCGG + Intronic
923042091 1:230326822-230326844 GGACGGAGCTGGGGGATGGGAGG - Intronic
1062932594 10:1362976-1362998 GGGCGGCGCTGGGGGCGCGGGGG - Intronic
1063114907 10:3066846-3066868 GGGCGGCGCTGGGAGCCTCGGGG - Intronic
1063115575 10:3069130-3069152 GGGGGGCGCTGGGCCTGGGGAGG - Intronic
1063960374 10:11301417-11301439 GGGGGGCGGTGGGAGCAGGGTGG - Intronic
1064167877 10:13001812-13001834 GGGAGGGGCGGGGAGTCGGGCGG + Intronic
1065102129 10:22341088-22341110 AGGCGGCGCTGGGAGCAGGCCGG - Intergenic
1065788951 10:29242344-29242366 GGGCGGCGGTGGGGGGCGGGGGG - Intergenic
1066224582 10:33369742-33369764 GGGCGGGGCCGGGAGGGGGGAGG + Intergenic
1067436868 10:46284685-46284707 GGGCGGGGCTTGCGGTTGGGCGG + Intergenic
1067946134 10:50689716-50689738 GGCCGGGGGTGGGAGTAGGGGGG - Intergenic
1068933892 10:62617724-62617746 GGGCGGGGGTGGGGGTGGGGGGG - Intronic
1069691894 10:70359186-70359208 GGGCGGGGCTGGGGTTTGGAGGG - Intronic
1069819403 10:71218104-71218126 GGGCGGAGGTGGGAGTTTGCAGG + Intronic
1069854581 10:71432901-71432923 GGGAGACTCTGGGAGCTGGGAGG - Intronic
1069897842 10:71689846-71689868 GGCCAGAGCTGGCAGTTGGGTGG + Intronic
1069928141 10:71865497-71865519 GGGTGGGGCTGGGAGAGGGGAGG - Intergenic
1069960024 10:72073999-72074021 GAGGGGCTCTGGGAGCTGGGGGG + Intronic
1070147064 10:73782178-73782200 GAGCGGCGCCGGGAGAAGGGCGG + Exonic
1070162356 10:73874072-73874094 GGGCAGCGTTGGGAGGTGGTCGG + Intronic
1070327135 10:75396484-75396506 GGCTGGCGCTGGGAGGAGGGTGG + Intergenic
1070779178 10:79127565-79127587 GGGCGGGGTGGGGAGGTGGGTGG + Intronic
1070881447 10:79854716-79854738 GGCCGGGGGTGGGAGTAGGGGGG - Intergenic
1072536093 10:96364272-96364294 GGGTGGCGATGGGAGCTGAGGGG + Intergenic
1072538496 10:96381013-96381035 GGTCAGTGCTGGGTGTTGGGCGG - Intronic
1072983005 10:100115320-100115342 GGCCGGGGCTGGGGGTTGGCGGG - Intergenic
1073045040 10:100632068-100632090 GAGAGGTGCTGGGAGGTGGGAGG - Intergenic
1073057853 10:100713646-100713668 AGGGGGAGCTGGGAGCTGGGTGG + Intergenic
1073101390 10:101008526-101008548 GGGCTGGGCTGGGAGTTGGCTGG + Intronic
1073403682 10:103278282-103278304 GGCCGGGGCTGGGCGTGGGGAGG + Intronic
1073750026 10:106515005-106515027 GGGCGGGGGTGGGGGTGGGGAGG - Intergenic
1074399373 10:113129207-113129229 GGGCTGCGATGGGAGAGGGGAGG - Intronic
1075695909 10:124435176-124435198 GGCCGAGACTGGGAGTTGGGGGG - Intergenic
1075795813 10:125118708-125118730 TGGAGGCGCTGGGGGGTGGGAGG + Intronic
1076326655 10:129628959-129628981 GAGTGGCGCTGGGAGTGGGCGGG - Intronic
1076618667 10:131772969-131772991 GGGCCGGGCTGGGAGTTAGGGGG - Intergenic
1076828550 10:132982867-132982889 AGGCGGCGCTGGGAGCTGGAGGG - Intergenic
1076828562 10:132982905-132982927 AGGCGGCGCTGGGAGCTGGAGGG - Intergenic
1076828574 10:132982943-132982965 AGGCGGCGCTGGGAGCTGGATGG - Intergenic
1076828586 10:132982981-132983003 AGGCGGCGCTGGGAGCCGGACGG - Intergenic
1076828598 10:132983019-132983041 AGGCGGCGCTGGGAGCCGGACGG - Intergenic
1076828610 10:132983057-132983079 AGGCGGCGCTGGGAGCCGGACGG - Intergenic
1076828622 10:132983095-132983117 AGGCGGCGCTGGGAGCCGGAGGG - Intergenic
1076828635 10:132983133-132983155 AGGCGGCGCTGGGAGCCGGACGG - Intergenic
1076828647 10:132983171-132983193 AGGCGGCGCTGGGAGCCGGAGGG - Intergenic
1076828660 10:132983209-132983231 AGGCGGCGCTGGGAGCCGGAGGG - Intergenic
1076828673 10:132983247-132983269 AGGCGGCGCTGGGAGCCGGAGGG - Intergenic
1076828699 10:132983323-132983345 AGGCGGCGCTGGGAGCCGGAGGG - Intergenic
1076884969 10:133258074-133258096 GGGCGGGGCTGGCCCTTGGGAGG - Intergenic
1076909274 10:133379209-133379231 GGGAGGCGCTGGGAGGGGCGGGG - Intergenic
1076916138 10:133423885-133423907 GGGAGGCGCTGGGAAGTGGCAGG + Intronic
1076936242 10:133568671-133568693 GGGAGGCGCTGGGAAGTGGCAGG + Intronic
1077132237 11:978876-978898 GGCCTGCGCCCGGAGTTGGGTGG + Intronic
1077333402 11:1993166-1993188 GGGCAGTGCTGGGAGATGGTGGG + Intergenic
1077360347 11:2138000-2138022 CGGCGGAGCTGGGGGTGGGGTGG - Intronic
1077439567 11:2561748-2561770 GGGTGGCACTGGGAGTATGGTGG - Intronic
1077514187 11:2991999-2992021 GAGGCGCGCCGGGAGTTGGGAGG + Intronic
1079007876 11:16804895-16804917 GGGCGGTGCAGGGAGGTGTGGGG + Intronic
1080008124 11:27430884-27430906 TGGGGGAGCTGGGAGTGGGGTGG - Intronic
1080628280 11:34051352-34051374 GGGTGGGGGTGGGGGTTGGGGGG - Intergenic
1081739829 11:45430955-45430977 GGGGGGCGGTGGGAGGAGGGAGG + Intergenic
1081861009 11:46333300-46333322 GGGCAGCGCTGGGACTGGGCTGG + Intronic
1081870661 11:46381365-46381387 CGGCGGCGCAGGGAGTGGGCCGG + Intronic
1082795613 11:57376339-57376361 GGGTGGGGGTGGGAGATGGGGGG - Intergenic
1083419652 11:62545848-62545870 GGACGGGTTTGGGAGTTGGGCGG + Intronic
1083763553 11:64831692-64831714 GGGCGGCACTGCCAGCTGGGAGG + Exonic
1083842847 11:65314750-65314772 GGGCGGTGCCCGGAGTGGGGCGG + Intergenic
1083890184 11:65592103-65592125 GGGCGGCGCTGGGAGTTGGGAGG + Intronic
1083901218 11:65644393-65644415 GGGGGGTGCAGGGGGTTGGGAGG + Intronic
1084013235 11:66364182-66364204 GTGGGGGGCTGGGAGTAGGGAGG - Intronic
1084403066 11:68956103-68956125 GTGGGGGGCTGGGGGTTGGGGGG + Intergenic
1084677056 11:70641650-70641672 TGGAGGAGCTGGGAGCTGGGAGG + Intronic
1084967392 11:72751794-72751816 GGGTCACGCTGGGAGTGGGGTGG - Intronic
1085190884 11:74621396-74621418 GGGCGGCGGTGGGGGGTCGGGGG - Intronic
1085689892 11:78656379-78656401 AGGAGGCTCTGGGAGATGGGAGG - Exonic
1086832207 11:91579867-91579889 GTGGGGTGGTGGGAGTTGGGAGG + Intergenic
1088893436 11:114061132-114061154 GGGGGTCGCTGGGAACTGGGGGG + Intronic
1089046205 11:115503861-115503883 GGACAGCCCTGGGAGGTGGGAGG + Intronic
1089543639 11:119206226-119206248 GGGCGGCGCCGGGAGTGCGCGGG - Exonic
1089679122 11:120109748-120109770 GGGCTGTGCTGGGAACTGGGCGG - Intergenic
1089977944 11:122748745-122748767 GGTAGGCGCTTAGAGTTGGGTGG - Intronic
1091215245 11:133897248-133897270 GGTTGGCTCTGGGAGTGGGGCGG - Intergenic
1091223974 11:133946769-133946791 GGGCTGAGCTGGGGGTGGGGTGG - Intronic
1202816380 11_KI270721v1_random:48347-48369 GGGCAGTGCTGGGAGATGGTGGG + Intergenic
1091964014 12:4722792-4722814 GGGTGAGGCTGGGAGATGGGTGG + Intronic
1092170715 12:6372427-6372449 GGGCTGCTGTGGGAGTCGGGAGG - Intronic
1095752670 12:45729257-45729279 AGGCGGGGCTGGGGGTGGGGAGG - Intergenic
1095949272 12:47773162-47773184 GGGCGGCGCTGGGGGCGGGCCGG + Intronic
1095951975 12:47786519-47786541 AGGCGGTGCGGGGAGTTGGGAGG - Intronic
1096110295 12:49024783-49024805 GGAAGGGGCTGGGAGCTGGGGGG - Intronic
1096621951 12:52870708-52870730 GTGCCGCCCTGGGAGCTGGGGGG - Intergenic
1096799971 12:54104017-54104039 GGGGGAGGCTGGGAGGTGGGAGG - Intergenic
1097007186 12:55927820-55927842 GGGCGGCGCCGGGGATTCGGCGG + Exonic
1097191171 12:57220322-57220344 GGGGCGCGGTGGGGGTTGGGGGG - Intronic
1098035937 12:66302346-66302368 GCGAGGGGCTGGGAGATGGGCGG - Intergenic
1098706211 12:73692990-73693012 GGGTGGGGGTGGGAGTGGGGAGG + Intergenic
1098973508 12:76879080-76879102 GGGCGGGGCTGGGAGGAGGGCGG - Intergenic
1100992536 12:100266800-100266822 GGGCGGGGCTAGGAAATGGGCGG + Intronic
1102222480 12:111203951-111203973 CTGAGGCCCTGGGAGTTGGGAGG - Intronic
1102520787 12:113476569-113476591 TGGCGGGGGTGGGAGTGGGGTGG + Intergenic
1102543486 12:113638445-113638467 AGGGGGCGCTGGGAGTAGGCGGG + Intergenic
1102962006 12:117099187-117099209 GGGCGGCGCGGGGACCGGGGCGG - Intronic
1103936702 12:124481006-124481028 GGGTGGCGCTGGGTGGTGGCTGG + Intronic
1104321773 12:127758292-127758314 GGGCCTCTCTGGGGGTTGGGGGG + Intergenic
1104848306 12:131858199-131858221 GGGCGGTGCTGGGTGCTGTGGGG + Intergenic
1104952069 12:132445617-132445639 AGGCGGCGGAGGGAGGTGGGAGG - Intergenic
1104964953 12:132504698-132504720 GGGCTGGGCTGGGTGGTGGGTGG + Intronic
1104971012 12:132530717-132530739 GGGTGGGGCTGGGGGGTGGGGGG + Intronic
1105702534 13:22944002-22944024 GGGCGGGGCTGGGAAATGGAGGG - Intergenic
1106138438 13:26991609-26991631 TGGAGGAGCTGGGAGTGGGGAGG - Intergenic
1107095294 13:36528924-36528946 GGGCGGGGGTGGGAGAGGGGTGG + Intergenic
1107922997 13:45229301-45229323 AGGCGGTGGTGGGAGGTGGGGGG - Intronic
1107935411 13:45341526-45341548 GAGAGGTGCTGGGAGCTGGGTGG + Intergenic
1112350132 13:98626318-98626340 GGACGGGGATGGGAGTGGGGAGG + Intergenic
1113492859 13:110706025-110706047 AGGCCGCGCTGGGCCTTGGGCGG - Exonic
1113542723 13:111121662-111121684 GTGCATCGCTGGGAGATGGGAGG + Intronic
1113594577 13:111521836-111521858 GGTCGGCACTGGGAACTGGGAGG + Intergenic
1114463028 14:22900331-22900353 GGGCGGGGCGGGGAGGGGGGGGG - Intergenic
1114549433 14:23524518-23524540 GGGCAGATCTAGGAGTTGGGGGG + Exonic
1114612658 14:24052611-24052633 GGGCGGGGCCGGGAGGAGGGAGG - Intronic
1114691218 14:24583953-24583975 GTGGGGTGCTGGGAGTGGGGAGG - Intergenic
1116887063 14:50231729-50231751 GGGCGGCGCTGTCGGCTGGGAGG - Intergenic
1117156821 14:52950636-52950658 GGCCGGCGCTGCGAATTCGGTGG - Intronic
1117478445 14:56119220-56119242 GCGCCGCGCTCGGAGTTCGGGGG - Intronic
1120240732 14:81946887-81946909 GGGCGGCGGTGAGGGTAGGGAGG + Intergenic
1120976926 14:90256917-90256939 GATCGGCGCTGGGAGTTTCGGGG + Intronic
1121930127 14:97964679-97964701 GGGCAGAGCTGGGAGATGGTAGG - Intronic
1122123950 14:99569220-99569242 GGCCACCCCTGGGAGTTGGGAGG - Intronic
1122268506 14:100557800-100557822 AGGAGGTGTTGGGAGTTGGGAGG - Intronic
1122349225 14:101077960-101077982 GGGCGGCGCAGGGAGGAGAGCGG + Intergenic
1122501247 14:102201617-102201639 GGGCCGCGCTGAGCGTTGAGTGG + Intronic
1122551603 14:102553012-102553034 GGGCAAGGCTGGGAGTGGGGAGG - Intergenic
1122793096 14:104192677-104192699 GGAAGGGGCTGGGCGTTGGGCGG + Intergenic
1122840779 14:104461628-104461650 GGGCGGGGCGGGGGGGTGGGCGG + Intergenic
1122883923 14:104702224-104702246 GGAAGGCGCTGGGAGGTGGAGGG - Intronic
1122983176 14:105200658-105200680 GGGTGGGGCCGGGAGGTGGGTGG - Intergenic
1123719204 15:23048012-23048034 CGGAGGTGCTGGGGGTTGGGGGG + Intergenic
1124940197 15:34210533-34210555 GGGCGGAGGTGGGGGGTGGGGGG - Intergenic
1124971481 15:34494373-34494395 GCGCGGCCCCGGGAGGTGGGTGG - Intergenic
1125300677 15:38251880-38251902 GGGCGGGGGTGGGAGCTGCGAGG - Intergenic
1126102833 15:45129963-45129985 GGGCGGGGCTGGGGGTGAGGAGG - Exonic
1128286970 15:66445141-66445163 GGGCAGCGGGGGGAGGTGGGGGG + Intronic
1128506662 15:68277785-68277807 GAGCGGCGCCGGAACTTGGGCGG - Exonic
1128546675 15:68573188-68573210 GGGGGATGCTGGGGGTTGGGGGG - Intergenic
1128622291 15:69160843-69160865 GGGCGGCTCTGGGGGCTGCGCGG + Intronic
1128738385 15:70066448-70066470 CGGGGGTGCAGGGAGTTGGGGGG - Intronic
1129105662 15:73305581-73305603 TGGTGGGGCTGGGAGTGGGGAGG - Intergenic
1129150511 15:73684885-73684907 GGCCGGCGCTGGGAGGTTAGCGG + Intronic
1129240028 15:74245567-74245589 CGGCGGGGCGGGGAGCTGGGTGG + Intronic
1129334294 15:74843192-74843214 GGGCGGCGCTGGGGGCAGCGTGG - Exonic
1129616304 15:77101088-77101110 GGGCTGCGATGGGAAGTGGGGGG - Exonic
1129892246 15:79078939-79078961 TGGCCTCGCTGGGAGTTGAGAGG + Intronic
1130018048 15:80202297-80202319 GGGTGGGGCTGAGGGTTGGGTGG + Intergenic
1131166537 15:90145739-90145761 GAGAGGCACTGGGAGTTGGGAGG + Intergenic
1131644287 15:94325270-94325292 GGGCGGGGCCGTGAGGTGGGTGG + Intronic
1132573066 16:652388-652410 TGGCGGGGCTCGGAGTTGGTCGG + Intronic
1132583044 16:694085-694107 GGGCGGGGCTGGGAGGGCGGAGG + Exonic
1132670461 16:1100374-1100396 GGGGGGCGCTGGGAGGAGAGTGG - Intergenic
1132778466 16:1610369-1610391 GGGCGGGGTGGGGAGGTGGGCGG - Intronic
1132855472 16:2042852-2042874 GGGAGGCGCTGGGAGGATGGGGG - Intronic
1133020070 16:2963379-2963401 GGGTGGCGCTGGGAGATCAGAGG + Intergenic
1133033233 16:3021422-3021444 GGGAGGAGGTGGGAGCTGGGAGG + Intronic
1133050061 16:3112584-3112606 GGGCGGGCGGGGGAGTTGGGTGG - Exonic
1133232155 16:4371961-4371983 CGGCGGCGCAGGGAGCCGGGCGG - Exonic
1133332074 16:4981016-4981038 GGGCTGGGATGGGAGGTGGGTGG + Intronic
1134449677 16:14355433-14355455 GGGGGGGGCGGGGGGTTGGGTGG + Intergenic
1134666636 16:16023696-16023718 GGGAAGTGCTGGGAGTTGTGGGG + Intronic
1137244697 16:46692874-46692896 GGGCGGCGGTGGCGGTGGGGGGG + Intronic
1139419964 16:66844217-66844239 GGGCAGGGGTGGGAGTTGGGGGG + Intronic
1140091928 16:71845996-71846018 GGGGGGCGCTGGGTGTGGGGCGG + Exonic
1141487687 16:84351830-84351852 GGGAGGAGCTAGGAGTGGGGCGG - Intergenic
1141603049 16:85137703-85137725 GGGCGGGCCTGGGCGGTGGGTGG + Intergenic
1142030101 16:87834348-87834370 GGGCAGCGAAGGGAGTTGAGAGG - Intronic
1142094939 16:88234498-88234520 GGTCTGCGCTGCGAGATGGGAGG - Intergenic
1142226944 16:88882110-88882132 GGGCTGCGCTGACAGCTGGGAGG + Intronic
1142356564 16:89604311-89604333 GGGGAGCACTGGGAGTTGGAGGG + Intergenic
1142356570 16:89604331-89604353 GGGGAGCACTGGGAGTTGGAGGG + Intergenic
1142409112 16:89907473-89907495 GGTGGGAGCTGGGAGGTGGGAGG - Intronic
1142409171 16:89907648-89907670 GGAGGGAGCTGGGAGCTGGGAGG - Intronic
1142409218 16:89907781-89907803 GGTGGGAGCTGGGAGGTGGGAGG - Intronic
1142409260 16:89907898-89907920 GGCAGGAGCTGGGAGGTGGGAGG - Intronic
1142409493 16:89908633-89908655 GGTGGGAGCTGGGAGGTGGGAGG - Intronic
1142409528 16:89908724-89908746 GGCAGGAGCTGGGAGCTGGGAGG - Intronic
1142690885 17:1605580-1605602 CTGCGGAGCTGGGAGGTGGGTGG + Intronic
1142698940 17:1648244-1648266 GGCCTGCGCTGGGAACTGGGAGG - Intronic
1142708779 17:1712327-1712349 GGGCGGAGGTGGAAGTAGGGCGG + Intergenic
1143115116 17:4577638-4577660 GGGCTGCGCAGGGTGTGGGGTGG - Intergenic
1143390485 17:6556613-6556635 CGGCGGCGCGGGGGGTGGGGTGG - Intergenic
1143452004 17:7042164-7042186 GGGCGGCGAAGAGAGCTGGGGGG - Exonic
1143626993 17:8116197-8116219 GGGCTGCTCTGGGTGTTGGGAGG - Intronic
1143639526 17:8188233-8188255 GGCTGGTGCTGGGAGTGGGGTGG - Intergenic
1143719369 17:8799155-8799177 GGGCGGAGCTGGGCGCAGGGCGG + Exonic
1143962120 17:10729730-10729752 GGGCGGAGCTGGGAGCCGGGCGG + Intronic
1144343977 17:14333604-14333626 GGGCGGGGTAGGGTGTTGGGAGG + Intronic
1144695886 17:17303608-17303630 GGGCGGCGCGGGGCGGCGGGCGG + Exonic
1144784363 17:17823666-17823688 GGGCGGGGCTGGGGGCGGGGCGG - Intronic
1144787647 17:17840747-17840769 GGGGGGCTCTGGGAGTGGGGAGG - Intergenic
1145960906 17:28886087-28886109 CGGCTGAGCTGGCAGTTGGGGGG - Intronic
1146147982 17:30438842-30438864 GGGTGGAGGTGGGAGTGGGGTGG - Intronic
1146455380 17:33005443-33005465 GGCCGGAGCTGGGACTTGGATGG + Intergenic
1146673998 17:34760539-34760561 GGGGGGCGGTAGGTGTTGGGGGG - Intergenic
1147258379 17:39195345-39195367 CGGCAGTGCTGGGTGTTGGGTGG + Intronic
1147317663 17:39628438-39628460 GGGCGGGGCGGGGAGGGGGGCGG + Intronic
1147338143 17:39739158-39739180 GGGCGGTGCGGCTAGTTGGGGGG - Intronic
1147389575 17:40100872-40100894 GGGAGGAGCTGAGAGTGGGGTGG + Intergenic
1147442563 17:40456367-40456389 GGGCTGGGCTGGGATTGGGGTGG + Intronic
1147895061 17:43745169-43745191 GGGCTGGGCTGGGGGTTGTGAGG + Intergenic
1148049998 17:44765203-44765225 GGGGGGAGCTGGCAGGTGGGTGG + Intronic
1148147902 17:45377568-45377590 GGGAGTGGCTGGGAGGTGGGGGG - Intergenic
1148262060 17:46192967-46192989 GGGCGGCTCCGGGCGTCGGGGGG - Intronic
1148427266 17:47610149-47610171 GGGTGGGGCTGAGAGTGGGGAGG - Intronic
1148722653 17:49764493-49764515 GCGCGGCGCTGGGTGTAGGTTGG + Intronic
1148760436 17:49997080-49997102 GGCGGGCGCTGGGCGCTGGGGGG - Intergenic
1149461625 17:56834022-56834044 GGGCGGAGGTGTGAGGTGGGAGG - Intronic
1149684789 17:58529087-58529109 GTGCTGCTCTGGGAGATGGGTGG - Intronic
1150133123 17:62679965-62679987 GGGCGGGGCCTGGAGGTGGGCGG + Intronic
1152226139 17:79093841-79093863 GGGCGGGGCGGGGAGGTGCGCGG - Intronic
1152604184 17:81280857-81280879 GGGCGGCACAGGGTGGTGGGGGG - Intronic
1152891437 17:82883802-82883824 GGGCGGCGCAGGAGGTGGGGAGG - Intronic
1153184718 18:2473377-2473399 GGGCAGGGATGGGAGGTGGGAGG + Intergenic
1153223683 18:2882234-2882256 GGGCTGCTCGGGCAGTTGGGAGG - Intronic
1153285398 18:3450987-3451009 GGGCCCGGCTGGGAGTAGGGGGG - Intronic
1154177274 18:12093705-12093727 GGGGGGCGGTGGGAGGTGGGGGG + Intergenic
1154940931 18:21111902-21111924 GGGCGGGGCGGTGAGGTGGGCGG + Intergenic
1155519590 18:26656040-26656062 GGGGGGCGGCGGCAGTTGGGGGG + Intronic
1156492768 18:37506066-37506088 GGGCGGCGTTGGGGGTGGGAGGG - Intronic
1157384251 18:47248136-47248158 GGGCGGCGCGGGGACTGGTGGGG - Intronic
1157588507 18:48820484-48820506 GGGTGGTTCTGGGAGTTGGGGGG - Intronic
1157727883 18:49978812-49978834 GGGAGGAGCAGGGTGTTGGGCGG + Intronic
1160028503 18:75238641-75238663 GGGAGGAGCTAGGATTTGGGGGG + Intronic
1160164017 18:76495026-76495048 GTGCGCCGCTGGGGGTAGGGGGG - Intronic
1160703156 19:517852-517874 GGGCGGTGCTGGGAGGAGGGAGG + Intronic
1160753039 19:743659-743681 GGGCCACGCTGGGAGTTGGGAGG - Intronic
1160787685 19:908886-908908 GGGCGGCGGTGGGCGGGGGGCGG - Intronic
1160788333 19:912109-912131 GGGTGGACCAGGGAGTTGGGGGG + Intronic
1160788402 19:912254-912276 GGGTGGACCAGGGAGTTGGGGGG + Intronic
1160807076 19:996603-996625 GGACGGCGCCGGGACTGGGGAGG + Intronic
1160865427 19:1253946-1253968 GGGCGCCGCTGGGGGCTGTGGGG - Intronic
1160900680 19:1426574-1426596 GGGCTGGCCTGGGGGTTGGGGGG - Intronic
1161041427 19:2112757-2112779 GGGCTGCCCTGGGACCTGGGTGG + Intronic
1161207938 19:3051478-3051500 GTGAGGCGGTGGGGGTTGGGGGG + Intergenic
1161266369 19:3366531-3366553 GGGCGGGGGGGGGGGTTGGGGGG + Intronic
1161378041 19:3950200-3950222 GAGAGGCCCTGGGAGGTGGGGGG + Intergenic
1161490077 19:4556792-4556814 GGCCAGGGCTGGCAGTTGGGCGG + Intronic
1161498059 19:4598155-4598177 GGGCGGGGCTCGGAGGCGGGGGG + Intergenic
1161627688 19:5336793-5336815 GGGCGGCGGCGGGTGGTGGGGGG + Intronic
1161760529 19:6167958-6167980 GGGTGAGGGTGGGAGTTGGGTGG - Intronic
1162013662 19:7832123-7832145 GGCCAGAGCTGGGAGTGGGGAGG - Intronic
1162914067 19:13865164-13865186 GCGCGGCGCGGGGAGGAGGGAGG + Intronic
1162935198 19:13978576-13978598 GGGCGGAGCTGGGACCTGGACGG + Intronic
1164639151 19:29812062-29812084 CGGCGGCGCCGGGAGTCGGCGGG - Exonic
1165394755 19:35558168-35558190 GGGCGGGGCTGGGTGGTGGGCGG + Intronic
1165455466 19:35908095-35908117 GGGCAGGGCAGGGAGTGGGGTGG - Intronic
1165745574 19:38228394-38228416 GGGCGGGGGTGGGGGGTGGGGGG - Intronic
1166044140 19:40219573-40219595 GGTCGGGGCTGGGATGTGGGAGG + Intergenic
1166318728 19:42003456-42003478 GGAGGGCGAAGGGAGTTGGGGGG + Intronic
1166513075 19:43424090-43424112 GGGTGGGGGTGGGAGGTGGGAGG - Intergenic
1166929947 19:46296540-46296562 GGGTGGGGTTGGGAGTTGGGGGG + Intergenic
1167048915 19:47067188-47067210 GGGCGCTGCCGGGCGTTGGGGGG + Exonic
1167072921 19:47230954-47230976 GGGCGGCGGTGGGGGGCGGGCGG + Intronic
1167148132 19:47694671-47694693 GGGCAGCGCTGGGAAGGGGGTGG - Exonic
1167311131 19:48738744-48738766 GGGCGGGCCTGAGAGTTGGGTGG - Intronic
1167311221 19:48739016-48739038 GCGCGGCGCTTCGAGTTGCGCGG - Exonic
1167368175 19:49065380-49065402 GGGCGGGGTTGGGAGGTGGTGGG - Intergenic
1167454215 19:49590159-49590181 GGGCGGGGCTTGGAGTGCGGGGG + Intronic
1167586198 19:50377099-50377121 GGGCGGGGCAAGGTGTTGGGAGG + Intronic
1168075635 19:53979769-53979791 GGGAGGCGCCGCGAGATGGGGGG + Intronic
1168076858 19:53985176-53985198 GGGCGGTGCTGGGAGTGGAGAGG + Exonic
1168082449 19:54020234-54020256 GGGCGGGGCTGGGAACAGGGTGG - Intergenic
1168179897 19:54654819-54654841 GGACTGAGCTGGGAGATGGGAGG - Intronic
1168239646 19:55082608-55082630 GGGCGGGGCTGGGAGGCAGGGGG + Intronic
1168309021 19:55451552-55451574 GGGCGGCGCAGGGATCTGGGCGG - Intergenic
1168471310 19:56643103-56643125 GGGGGGAGGTGGGAGATGGGAGG - Intergenic
1168493476 19:56830842-56830864 GGGGGGCCCTGGGAGGTGGAGGG + Intronic
1168724048 19:58571007-58571029 GGGCTGCGCCGGGAGCCGGGCGG - Exonic
925009219 2:469155-469177 GGGCGGAGCTGGGGCCTGGGAGG + Intergenic
925157521 2:1658828-1658850 GGGAGCCGCGGGGAGATGGGGGG - Intronic
925278897 2:2669416-2669438 GGGCTGCCCTGCGAGGTGGGAGG + Intergenic
925411741 2:3643569-3643591 GGACAGGGCTGGGAGGTGGGAGG - Intronic
926075660 2:9940983-9941005 GGGCAGCAGTGGGAGATGGGAGG - Intergenic
926634523 2:15165655-15165677 GGGCACCGGTGGGAGTGGGGTGG + Intergenic
927679934 2:25132587-25132609 GGGCGGAGCGGGGGGTCGGGGGG - Intronic
927755088 2:25702021-25702043 GGGCCCAGCTGGGATTTGGGAGG + Intergenic
928093683 2:28391746-28391768 GGGCGGGGCTGGGAGGGGCGCGG - Intergenic
929281615 2:40086797-40086819 GGGGGTGGCGGGGAGTTGGGGGG + Intergenic
929692564 2:44086911-44086933 GGGCTTCGCTGGGACTGGGGCGG - Intergenic
931385833 2:61796442-61796464 GGGGGGCGCTGGGAGAGGGAGGG + Intergenic
932198007 2:69800980-69801002 GGCAGGCACTGGGGGTTGGGGGG + Intronic
932776362 2:74530329-74530351 CGGTGGCGCTGGGCGCTGGGGGG + Exonic
933758874 2:85661186-85661208 GGGCAGGGCGGGGGGTTGGGGGG + Intronic
934503926 2:94877620-94877642 GGGCAGCTCTGTGAGCTGGGTGG + Intergenic
936028664 2:109053898-109053920 GGACTGCGCTGGCAGTGGGGTGG - Intergenic
937070866 2:119061974-119061996 GGGGGCTGCTAGGAGTTGGGGGG + Intergenic
937204584 2:120227268-120227290 GGGGGGGGCAGGGAGATGGGAGG - Intergenic
938474237 2:131592122-131592144 GGGAGGAGGTGGGACTTGGGGGG + Intergenic
938959630 2:136329557-136329579 GGTCGGGGCTGGGGGTGGGGGGG + Intergenic
939990642 2:148875120-148875142 GCGCAGCGCTCGGAGTCGGGCGG + Intergenic
940778328 2:157907210-157907232 GGGAGAGGGTGGGAGTTGGGTGG + Intronic
941686477 2:168453911-168453933 GGGTGAAACTGGGAGTTGGGAGG + Intergenic
941905011 2:170712058-170712080 GGGCGGAGATGGGGGTGGGGTGG - Intergenic
942136501 2:172931179-172931201 GGGGGGCGCTGGGGGGCGGGGGG + Intronic
943798724 2:192030919-192030941 GGGCGGGGCGGGGAGTTGATGGG + Intronic
945261098 2:207844141-207844163 GTGTGGCTCTGAGAGTTGGGAGG - Intronic
946250125 2:218406524-218406546 GGGCGGGGCGGGAAGTGGGGCGG - Intergenic
946358913 2:219207141-219207163 GGGCGGGGCTTGAAGCTGGGGGG + Intronic
946395528 2:219442101-219442123 GGGCGGCGCCGGGAGGGGGCAGG + Intronic
948010036 2:234645401-234645423 GGGAGGCTGTGGGAGTAGGGAGG - Intergenic
948010062 2:234645501-234645523 GGGAGGCAGTGGGAGTAGGGAGG - Intergenic
948010067 2:234645518-234645540 GGGAGGCAGTGGGAGTAGGGAGG - Intergenic
948010084 2:234645585-234645607 GGGAGGCAGTGGGAGTAGGGAGG - Intergenic
948010120 2:234645734-234645756 GGGAGGCAGTGGGAGTAGGGAGG - Intergenic
948010146 2:234645834-234645856 GGGAGGCAGTGGGAGTAGGGAGG - Intergenic
948010159 2:234645885-234645907 GGGAGGCAGTGGGAGTAGGGAGG - Intergenic
948010173 2:234645938-234645960 GGGAGGCAGTGGGAGTAGGGAGG - Intergenic
948010211 2:234646104-234646126 GGGAGGCAGTGGGAGTAGGGAGG - Intergenic
948010224 2:234646154-234646176 GGGAGGCAGTGGGAGTAGGGAGG - Intergenic
948010237 2:234646204-234646226 GGGAGGCAGTGGGAGTAGGGAGG - Intergenic
948010271 2:234646339-234646361 GGGAGGCAGTGGGAGTAGGGAGG - Intergenic
948010301 2:234646470-234646492 GGGAGGCAGTGGGAGTAGGGAGG - Intergenic
948010314 2:234646520-234646542 GGGAGGCAGTGGGAGTAGGGAGG - Intergenic
948010327 2:234646570-234646592 GGGAGGCAGTGGGAGTAGGGAGG - Intergenic
948010363 2:234646720-234646742 GGGAGGCAGTGGGAGTAGGGAGG - Intergenic
948010373 2:234646754-234646776 GGGAGGCAGTGGGAGTAGGGAGG - Intergenic
948010378 2:234646771-234646793 GGGAGGCAGTGGGAGTAGGGAGG - Intergenic
948010383 2:234646788-234646810 GGGAGGCAGTGGGAGTAGGGAGG - Intergenic
948010388 2:234646805-234646827 GGGAGGCAGTGGGAGTAGGGAGG - Intergenic
948010393 2:234646822-234646844 GGGAGGCAGTGGGAGTAGGGAGG - Intergenic
948010398 2:234646839-234646861 GGGAGGCAGTGGGAGTAGGGAGG - Intergenic
948010403 2:234646856-234646878 GGGAGGCAGTGGGAGTAGGGAGG - Intergenic
948010413 2:234646890-234646912 GGGAGGCAGTGGGAGTAGGGAGG - Intergenic
948010430 2:234646958-234646980 GGGAGGCAGTGGGAGTAGGGAGG - Intergenic
948010443 2:234647008-234647030 GGGAGGCAGTGGGAGTAGGGAGG - Intergenic
948010456 2:234647058-234647080 GGGAGGCAGTGGGAGTAGGGAGG - Intergenic
948010469 2:234647108-234647130 GGGAGGCAGTGGGAGTAGGGAGG - Intergenic
948010503 2:234647243-234647265 GGGAGGCAGTGGGAGTAGGGAGG - Intergenic
948010533 2:234647374-234647396 GGGAGGCAGTGGGAGTAGGGAGG - Intergenic
948010546 2:234647424-234647446 GGGAGGCAGTGGGAGTAGGGAGG - Intergenic
948010559 2:234647474-234647496 GGGAGGCAGTGGGAGTAGGGAGG - Intergenic
948010593 2:234647609-234647631 GGGAGGCAGTGGGAGTAGGGAGG - Intergenic
948010623 2:234647740-234647762 GGGAGGCAGTGGGAGTAGGGAGG - Intergenic
948010636 2:234647790-234647812 GGGAGGCAGTGGGAGTAGGGAGG - Intergenic
948010649 2:234647840-234647862 GGGAGGCAGTGGGAGTAGGGAGG - Intergenic
948010662 2:234647890-234647912 GGGAGGCAGTGGGAGTAGGGAGG - Intergenic
948010675 2:234647940-234647962 GGGAGGCAGTGGGAGTAGGGAGG - Intergenic
948010680 2:234647957-234647979 GGGAGGCAGTGGGAGTAGGGAGG - Intergenic
948010709 2:234648088-234648110 GGGAGGCAGTGGGAGTAGGGAGG - Intergenic
948010722 2:234648138-234648160 GGGAGGCAGTGGGAGTAGGGAGG - Intergenic
948010747 2:234648238-234648260 GGGAGGCAGTGGGAGTAGGGAGG - Intergenic
948010752 2:234648255-234648277 GGGAGGCAGTGGGAGTAGGGAGG - Intergenic
948010765 2:234648305-234648327 GGGAGGCAGTGGGAGTAGGGAGG - Intergenic
948010799 2:234648440-234648462 GGGAGGCAGTGGGAGTAGGGAGG - Intergenic
948010838 2:234648605-234648627 GGGAGGCAGTGGGAGTAGGGAGG - Intergenic
948010851 2:234648655-234648677 GGGAGGCAGTGGGAGTAGGGAGG - Intergenic
948010864 2:234648705-234648727 GGGAGGCAGTGGGAGTAGGGAGG - Intergenic
948010900 2:234648855-234648877 GGGAGGCAGTGGGAGTAGGGAGG - Intergenic
948010910 2:234648889-234648911 GGGAGGCAGTGGGAGTAGGGAGG - Intergenic
948010915 2:234648906-234648928 GGGAGGCAGTGGGAGTAGGGAGG - Intergenic
948010920 2:234648923-234648945 GGGAGGCAGTGGGAGTAGGGAGG - Intergenic
948010925 2:234648940-234648962 GGGAGGCAGTGGGAGTAGGGAGG - Intergenic
948010935 2:234648974-234648996 GGGAGGCAGTGGGAGTAGGGAGG - Intergenic
948010952 2:234649042-234649064 GGGAGGCAGTGGGAGTAGGGAGG - Intergenic
948010965 2:234649092-234649114 GGGAGGCAGTGGGAGTAGGGAGG - Intergenic
948010978 2:234649142-234649164 GGGAGGCAGTGGGAGTAGGGAGG - Intergenic
948010991 2:234649192-234649214 GGGAGGCAGTGGGAGTAGGGAGG - Intergenic
948010996 2:234649209-234649231 GGGAGGCAGTGGGAGTAGGGAGG - Intergenic
948011001 2:234649226-234649248 GGGAGGCAGTGGGAGTAGGGAGG - Intergenic
948011006 2:234649243-234649265 GGGAGGCAGTGGGAGTAGGGAGG - Intergenic
948011035 2:234649374-234649396 GGGAGGCAGTGGGAGTAGGGAGG - Intergenic
948011048 2:234649424-234649446 GGGAGGCAGTGGGAGTAGGGAGG - Intergenic
948011073 2:234649524-234649546 GGGAGGCAGTGGGAGTAGGGAGG - Intergenic
948011078 2:234649541-234649563 GGGAGGCAGTGGGAGTAGGGAGG - Intergenic
948395046 2:237639201-237639223 GGGCTGAGATGGGGGTTGGGTGG + Intronic
948478135 2:238234467-238234489 GGGGGGCGCCGTGAGCTGGGAGG - Intergenic
948609614 2:239158596-239158618 GGGAGGCGCTGGCAGTTGGGGGG - Intronic
948809266 2:240466570-240466592 CGGCGGTGCAGGGAGCTGGGGGG - Exonic
1168771805 20:420684-420706 GGGTGGGGCTGGGGGATGGGGGG - Intronic
1168792929 20:592079-592101 GGGCTGGACTGGAAGTTGGGAGG - Intergenic
1169074324 20:2751996-2752018 CGGCGGCGCTGGGAGGGCGGAGG - Intronic
1169204594 20:3732658-3732680 GGGCGGCGCGAGGAGGCGGGAGG + Exonic
1169207706 20:3749466-3749488 GGGCGCCGCTGTGAGTGGGGTGG - Intronic
1170430107 20:16267876-16267898 GCTGGGGGCTGGGAGTTGGGAGG - Intergenic
1172793582 20:37522569-37522591 GGGCGGGGCAGGGGGTGGGGCGG + Intronic
1172877932 20:38177335-38177357 AGGCTGGGCTGGGAGGTGGGAGG + Intergenic
1172904475 20:38358658-38358680 GGGTGACGCTGGGGGCTGGGAGG - Intronic
1172923997 20:38513465-38513487 CGGCGGCGGTGGGGGGTGGGGGG + Intronic
1173055021 20:39603692-39603714 GGTGGTTGCTGGGAGTTGGGGGG - Intergenic
1174819425 20:53713912-53713934 GGGCGGGTGTGGGAGTTGAGGGG - Intergenic
1174845913 20:53943081-53943103 GGGCTGCCCTGGGAGGTGGGGGG - Intronic
1175210485 20:57350926-57350948 GGGCGGCGCGGGGGGGCGGGGGG + Intergenic
1175429813 20:58892569-58892591 GGGCGGCGAGGGGAGGAGGGAGG + Intronic
1176078630 20:63260670-63260692 GGGCGGCGATGGCTGTGGGGTGG - Intronic
1177792281 21:25734604-25734626 GGGCGGCGCGGGGGGCAGGGAGG - Exonic
1178621488 21:34180836-34180858 GGGCGGGGGTGGGGGTGGGGAGG + Intergenic
1180008184 21:45032978-45033000 GGGCGGGGGTGGGCGGTGGGGGG - Intergenic
1180095689 21:45554465-45554487 GGGGGGCGCGGGGGATTGGGGGG - Intergenic
1180099834 21:45579221-45579243 GGGCGCCCCTGGGACGTGGGCGG + Intergenic
1180711695 22:17843547-17843569 TGACGGCTCTGGGAGGTGGGTGG - Intronic
1180871471 22:19149502-19149524 GGACGGCGCTGGGCGTCCGGGGG - Intronic
1181085436 22:20437504-20437526 TGGCGGCGCCGGGCATTGGGAGG - Intronic
1181126105 22:20703225-20703247 GGGCGGGGCGGGGATGTGGGCGG + Intergenic
1181533126 22:23528437-23528459 GGGTGGGGCTGGGGTTTGGGGGG + Intergenic
1181737311 22:24892149-24892171 GGATGGCACTGGGAATTGGGAGG + Intronic
1182202913 22:28591952-28591974 GGGCGGAGCTGGGGGGAGGGTGG + Intronic
1182249924 22:28992163-28992185 GGCCGGGGCGGGGGGTTGGGGGG - Intronic
1182494115 22:30694526-30694548 GAGCTGCGCTGGGAGCTGGCGGG + Intronic
1182664016 22:31944477-31944499 CGGCCGCGCTGGGGGATGGGAGG - Exonic
1182903970 22:33920795-33920817 GCCCGGCGCTCGGAGCTGGGCGG + Intronic
1183247289 22:36703538-36703560 GGGCGGCGCAGGGAGCTGTCCGG - Exonic
1183508093 22:38220469-38220491 GTGGGGAGCTGGGAGGTGGGGGG - Exonic
1183546005 22:38455206-38455228 GGGCAGCGCTGAAAGTTGGGCGG - Intergenic
1183586181 22:38754606-38754628 GGGCGGGGCAGGGAGGGGGGAGG - Intronic
1183602832 22:38850053-38850075 GGGGGGCCCTTGGAGTTGGCTGG + Intergenic
1183740689 22:39666963-39666985 GGGCGGAGCTGGCACTGGGGCGG - Intronic
1184072885 22:42157058-42157080 GGGAGGAGCTGGGAATTGGAGGG - Intergenic
1184236764 22:43187164-43187186 GGGGGGCGCTGGGAGGAGGGCGG - Intergenic
1184236782 22:43187195-43187217 GGGGGGGGCTGGGAGGAGGGCGG - Intergenic
1184236798 22:43187222-43187244 GGGGGGGGCTGGGAGGAGGGCGG - Intergenic
1184236814 22:43187249-43187271 GGGGGGGGCTGGGAGGAGGGCGG - Intergenic
1184781483 22:46651832-46651854 GGGCGGAGCTGGAGGTGGGGGGG + Intronic
1184785457 22:46669411-46669433 GGGCTGTGCCGGGAGGTGGGTGG + Intronic
1184857569 22:47154777-47154799 GGGGGCCGCTGAGAGTGGGGAGG - Intronic
1184982826 22:48106434-48106456 GGGCTGTGCTGAGAGTTTGGGGG - Intergenic
1185055321 22:48576040-48576062 GGGCGGCGCGGGGGGGGGGGGGG - Intronic
1185228195 22:49665132-49665154 GGGCGGCGCTGGGACTGAGCAGG - Intergenic
1185246918 22:49777628-49777650 GGGCGGTGCTGGGAGCTGCGTGG + Intronic
1185285835 22:49999628-49999650 GGGCGGGGCGCGGAGGTGGGTGG + Intronic
1185285855 22:49999668-49999690 GGGCGGGGCGCGGAGGTGGGTGG + Intronic
949577785 3:5355592-5355614 GGGGGGCGGGGGGAGGTGGGGGG + Intergenic
950076972 3:10194119-10194141 GGACGGCCCTGGGAGGTGTGGGG + Intronic
950202772 3:11056718-11056740 GGGCGTCGCTGGCAGCTGGAAGG + Intergenic
950710491 3:14810337-14810359 GGGAGGCGCTGGGGGTTCGAAGG - Intergenic
952484769 3:33798942-33798964 GCGCGGGGCTGGGAGTGGGTAGG + Intronic
952582427 3:34850183-34850205 TGGCGGAGCGGGGAGGTGGGGGG + Intergenic
952665578 3:35900237-35900259 GAGCGGGGGTGGGGGTTGGGGGG + Intergenic
953326073 3:42013566-42013588 GGGCGGGGCTGGGAAGGGGGAGG + Intergenic
954210338 3:49093709-49093731 GGGTGGCCCGGGGATTTGGGTGG - Intronic
954468872 3:50674952-50674974 CGGCGGCGCCGGGAGCCGGGCGG + Intergenic
954636376 3:52073105-52073127 GGGCAGAGCTGGGGGTGGGGTGG - Intergenic
955934008 3:64084972-64084994 GGAGGGGGCTGGGAGGTGGGTGG + Intergenic
956600894 3:71021202-71021224 GGCAAGGGCTGGGAGTTGGGAGG - Intronic
956718096 3:72095920-72095942 GGGTGGGGTGGGGAGTTGGGAGG + Intergenic
958123837 3:89329261-89329283 GGGCGGAGCGGGGAGTGGGAAGG - Intronic
959531002 3:107433517-107433539 GGGTGGGGCTGGGGGTTGCGGGG - Intergenic
960692676 3:120363207-120363229 CGGGGGGGCTGGGTGTTGGGGGG + Intergenic
961013395 3:123449803-123449825 GGGCGGCGCGGGGGGCGGGGAGG - Intergenic
961384433 3:126516097-126516119 GGTGGGTGCTGGGAGTTGGGAGG - Intronic
961384468 3:126516191-126516213 GGTGGGTGCTGGGAGTTGGGAGG - Intronic
965590529 3:170357260-170357282 GGGCGGCGGTGAGGGTGGGGTGG + Intergenic
966861935 3:184235328-184235350 GGGCAGGCCTGGGGGTTGGGTGG + Intronic
967933276 3:194706018-194706040 GGGCAGTGGTGGGAGTGGGGAGG + Intergenic
968095993 3:195931262-195931284 GGGTGGGGCCGGGGGTTGGGTGG - Intergenic
968225562 3:196969937-196969959 GGGCTGCGCTGAGAGCGGGGTGG + Intergenic
968434162 4:576353-576375 GGGCGGGGTGGGGGGTTGGGGGG - Intergenic
968434370 4:576885-576907 GGGAGGGGCCGGGAGCTGGGGGG + Intergenic
968434397 4:576934-576956 GGGAGGGGCCGGGAGCTGGGGGG + Intergenic
968466947 4:757166-757188 GGGCGGGGGTGGGAGTGGGGGGG - Intronic
968650292 4:1757722-1757744 GGGTGGGGGTGGGGGTTGGGTGG - Intergenic
968691340 4:1991957-1991979 GGGTGCTGCTGGGAGGTGGGAGG - Intronic
968913350 4:3486585-3486607 GGGCAGCCCTGGGAGTGGGGAGG + Intronic
969277981 4:6149882-6149904 GGGGAGAGCTGGGAGTTGGAAGG - Intronic
969497587 4:7534926-7534948 GGTTGGGGCTGGGAGTAGGGAGG + Intronic
969701822 4:8771803-8771825 TGAGGGCGCGGGGAGTTGGGCGG + Intergenic
970273848 4:14375901-14375923 GTGCGGAGTTGGGAGGTGGGGGG + Intergenic
972274056 4:37540787-37540809 AGGTGGGGGTGGGAGTTGGGGGG + Intronic
973574978 4:52277747-52277769 GGGGGGAGGTGGGAGTGGGGAGG + Intergenic
975485778 4:74933208-74933230 GGGCTGCGGTGGGAGCCGGGAGG - Exonic
976009606 4:80471568-80471590 GGGCGGGGGTGGGGGTGGGGGGG + Intronic
978619042 4:110621565-110621587 GTGCGGCGCTGGGGGAGGGGAGG - Intronic
982172846 4:152678522-152678544 GGGCGGCGGTGGGGGGAGGGGGG + Intronic
984194968 4:176648332-176648354 GCCAGGGGCTGGGAGTTGGGGGG + Intergenic
984830550 4:183968755-183968777 GGGGGGCGGGGGGTGTTGGGTGG + Intronic
984952673 4:185018809-185018831 AGGCAGCCCTCGGAGTTGGGAGG + Intergenic
985472563 5:54614-54636 GGGGGTCGCTGGGAGGTGGGGGG + Intergenic
985492175 5:186516-186538 TGGGGGCGCTGGGAGCTGAGGGG + Exonic
985577768 5:681673-681695 GGGAGGCGCTGGGGGTGGGTGGG - Intronic
985595179 5:784755-784777 GGGCGGGGCTGGGGGCGGGGCGG - Intergenic
985659726 5:1151033-1151055 GGGCGGCCTTGGGAGCTGGACGG + Intergenic
985674116 5:1221529-1221551 TGGGTGGGCTGGGAGTTGGGAGG + Intronic
985827682 5:2204999-2205021 GGGTGGGGCTGGGGCTTGGGCGG + Intergenic
986694434 5:10339372-10339394 GGTGGGGGCTGGGGGTTGGGGGG + Intergenic
987829924 5:23082882-23082904 GGGAGCCGGTGGGAGGTGGGAGG - Intergenic
991493766 5:67208423-67208445 GGGAGGAGGTGGGAGTTGGGTGG + Intergenic
992226009 5:74620399-74620421 GGGCGGTGGGGGGAGTTGGGGGG - Intergenic
992939918 5:81751432-81751454 GGGCGGCGCGGGGGGAGGGGTGG - Intronic
993305709 5:86272645-86272667 GGGAGGGGCAGGGAGTGGGGGGG + Intergenic
993641370 5:90409919-90409941 GGGGGGCGTTAGGAGGTGGGCGG - Intergenic
995849561 5:116531193-116531215 GGGAGGCGGTGGGGATTGGGGGG + Intronic
997521725 5:134527560-134527582 GGGCGGCGCCGGGAGGTGGGTGG - Intronic
999175058 5:149626189-149626211 GGGAGGTGCTGGGTGTGGGGAGG - Intronic
999260153 5:150233340-150233362 GGGCGGTGCTGGGTGTAGTGTGG - Intronic
1001507108 5:172288449-172288471 GGGAGGCGGGGGGAGGTGGGAGG - Intergenic
1002580946 5:180209155-180209177 GGGCTGCGCTGGGAGCCGGGCGG - Intergenic
1002888081 6:1313004-1313026 GGGCGGCGCGGGGAGCGGCGAGG + Exonic
1003098943 6:3162805-3162827 GGGCGGCGCCGGGAGGCGCGAGG + Intergenic
1003173486 6:3738015-3738037 GGGCTGGGCAGGGAGGTGGGAGG - Intronic
1003261020 6:4516167-4516189 GGGAGGCGGTGGGAGGTAGGAGG + Intergenic
1003551823 6:7107659-7107681 CGGCGGCGCTCGGACTGGGGGGG - Intronic
1003571985 6:7261854-7261876 GGGCGGCGGGGGGATTTGGATGG + Intergenic
1003962813 6:11224753-11224775 GGGAGGCGGAGGGTGTTGGGGGG + Intronic
1003974727 6:11331458-11331480 TGGCGGTGGTGGGAGTGGGGAGG + Intronic
1004348092 6:14866862-14866884 GGGGTGAGCTGGGGGTTGGGTGG - Intergenic
1006132927 6:31879617-31879639 GTGCGGGGCAGGGAGGTGGGGGG - Intergenic
1006170217 6:32087925-32087947 GGCCGGGGCCGGGACTTGGGGGG + Intronic
1006599096 6:35214070-35214092 CGGCGAAGCTGGGAATTGGGTGG + Intergenic
1007249869 6:40488339-40488361 GGATGGCGGTGGGGGTTGGGGGG - Intronic
1007323120 6:41041326-41041348 GGGTGGGGCTGGGAGGAGGGTGG - Intronic
1007323128 6:41041343-41041365 GGGTGGGGCTGGGAGGAGGGTGG - Intronic
1007550738 6:42727869-42727891 GGGCGGCGTGGGGGGTGGGGTGG - Intergenic
1007665328 6:43510041-43510063 GGGCGGCGCTGGGGCGGGGGCGG + Exonic
1007897472 6:45377728-45377750 GGGCGGTGCGGGGATTCGGGCGG - Intronic
1008678190 6:53843997-53844019 TGGCTGCCCTGGGAGTTGGATGG + Intronic
1008932602 6:56955406-56955428 GCGGGGCGCAGGGAGGTGGGAGG - Exonic
1009351845 6:62690056-62690078 GGGCGGTGGTGGGAGGGGGGAGG + Intergenic
1010029262 6:71256165-71256187 GGGTGGGGCTGGGGGTGGGGTGG + Intergenic
1011734368 6:90296696-90296718 GGGCGGCGGCGGGAGTGGGCAGG + Exonic
1012257570 6:97051289-97051311 GGGAGGTGCTGAGAGTTGGAAGG - Intronic
1015837153 6:137432711-137432733 GGGCTGTGGTGGGAGGTGGGAGG + Intergenic
1017274436 6:152549448-152549470 GGGGGGCGGTGGGAGTGGAGGGG + Intronic
1017302216 6:152875041-152875063 GGGCTGCTCTGGGAATAGGGTGG + Intergenic
1017724035 6:157264477-157264499 GGGCGGAGCTGCAAGTTGGTAGG + Intergenic
1017760236 6:157562865-157562887 GGGGGGCGGTGGGAGGCGGGAGG - Intronic
1017810847 6:157982184-157982206 GGGCGGCGCTGGGACTGCCGGGG + Intronic
1018003886 6:159602852-159602874 GGGTGGGGCTGCGAGGTGGGAGG - Intergenic
1018892677 6:167994016-167994038 GGGCTGCAGTGGGAGCTGGGAGG - Intergenic
1018893947 6:168000563-168000585 GGTCGGCAATGGGAGTGGGGAGG - Intronic
1019159915 6:170062880-170062902 GGCCGGAGCTGGGAGCTGGGAGG - Intergenic
1019298258 7:290287-290309 GGGCGGTGCTGGGGCTTTGGGGG + Intergenic
1019419798 7:945731-945753 GAGCGGGGCTGGGAGGAGGGAGG - Intronic
1019629972 7:2043798-2043820 GGGCAGTGCGGGGTGTTGGGAGG - Intronic
1019803140 7:3103260-3103282 GGGCGGTGCTGGGAGAGGTGAGG + Intergenic
1020083120 7:5296880-5296902 GGGCGGTGCAGGGAGCTGGGCGG + Intronic
1020136945 7:5592890-5592912 GCGCGGCCCCGGGAGGTGGGTGG - Exonic
1020256048 7:6503697-6503719 GGGCGGGGCGGTGAGCTGGGCGG + Intronic
1020256828 7:6507185-6507207 GGGCAGCCCTGGGAGCTGGAAGG + Intronic
1021576169 7:22108229-22108251 GGGCTGAGGTGGGAGTGGGGAGG - Intergenic
1022028167 7:26467775-26467797 GGGCTGAGCTGGGAGCTGGTGGG - Intergenic
1022066573 7:26864643-26864665 GGCCGGGGCGGGGAGATGGGTGG + Exonic
1022507502 7:30915934-30915956 GGGAGGGGCTGGGGGCTGGGTGG + Intronic
1023972284 7:45000223-45000245 GGGCGGCGCCGGGAGCGCGGGGG + Intronic
1024894576 7:54243041-54243063 GGGAGGGGCAGGGAGGTGGGGGG + Intergenic
1025211162 7:57020308-57020330 GGGCGGTGCAGGGAGCTGGGCGG - Intergenic
1025660793 7:63556539-63556561 GGGCGGTGCAGGGAGCTGGGCGG + Intergenic
1026236951 7:68535154-68535176 GGGCGGCGGGGGGAGGTGGTGGG + Intergenic
1026765202 7:73155573-73155595 GGGAGGGGGTGGGAGATGGGGGG - Intergenic
1026968283 7:74453904-74453926 GGGCGGCGCGGGGAGAGGAGCGG - Intronic
1027041676 7:74965329-74965351 GGGAGGGGGTGGGAGATGGGGGG - Intronic
1027081966 7:75237040-75237062 GGGAGGGGGTGGGAGATGGGGGG + Intergenic
1028984058 7:96996215-96996237 GGGCGGGGTTGGGGGTGGGGAGG + Intergenic
1029378846 7:100199473-100199495 GGGGGGAGCTTGGAGTTGGAAGG + Intronic
1029390550 7:100271585-100271607 GGGAGGGGGTGGGAGATGGGGGG + Intronic
1029424443 7:100487208-100487230 GGGTGGAGCTGGGAGCTGGGAGG + Intronic
1029424737 7:100488607-100488629 GGGCGGCGGTGGGCATGGGGCGG - Exonic
1029731209 7:102439357-102439379 TGGGGGCGCTGGGAGTTGCCAGG + Intronic
1030330831 7:108268610-108268632 GGGCGGGGGTGGGGGTGGGGGGG + Intronic
1030672194 7:112350118-112350140 GGGCGGCGGGGGGTGTTGTGGGG - Intergenic
1031494681 7:122431921-122431943 GGGCGGGGGTGGGGGTGGGGAGG + Intronic
1032164157 7:129532745-129532767 GGGCGGCGCAGGGTGTGGGAGGG + Intergenic
1033052883 7:138022210-138022232 GGCCGGGGCGGGGTGTTGGGGGG + Intronic
1033581968 7:142746226-142746248 GAGAGGAGCTGGGAGTTTGGGGG + Intergenic
1034116512 7:148588617-148588639 TGGCGGGGGTGGGAGTCGGGGGG + Intergenic
1034210123 7:149356148-149356170 GGGTGGCGGTGGGGGGTGGGGGG - Intergenic
1034540403 7:151754701-151754723 GTGCGGCGGAGGGGGTTGGGTGG - Intronic
1034547279 7:151797230-151797252 AGGCGGCGGTGGGGGGTGGGGGG - Intronic
1035560640 8:601402-601424 GGAAGGCGCTGGGAGTGGGAAGG + Intergenic
1036555158 8:9853098-9853120 GGGGGGAACTGGGAGTGGGGAGG + Intergenic
1037734192 8:21554035-21554057 GGCAGGAGCTGGGAGCTGGGAGG - Intergenic
1038319447 8:26513996-26514018 CGGCAGCGCTGGGAGGAGGGAGG - Exonic
1040981506 8:53250743-53250765 GCGCAGCGCTGGGGGCTGGGCGG - Intronic
1041839038 8:62248438-62248460 GGGTTGTGCTGGGGGTTGGGAGG - Intergenic
1041839107 8:62248776-62248798 GGGCGGGGCGGGGGGTTGGAAGG - Intronic
1042174759 8:66028129-66028151 GGTCAGCACTGGGACTTGGGAGG + Intronic
1043414453 8:80033302-80033324 GGGCGGGGAGGGGGGTTGGGGGG + Intronic
1043508840 8:80930351-80930373 GGGAGGCACTGGGAGTTGGCTGG + Intergenic
1045738051 8:105318992-105319014 GCGCGGGGCCGGGAGTTGGTGGG + Intronic
1046654176 8:116874614-116874636 GCTCTCCGCTGGGAGTTGGGCGG + Exonic
1046776255 8:118167178-118167200 GGGGGGCGCGGGGGGCTGGGGGG - Intergenic
1046962172 8:120123828-120123850 GGGCGGCGGTGGGGGCTGGAAGG + Intronic
1047097649 8:121641470-121641492 GGGCGGCGGAGGGAGTGGGGGGG + Intergenic
1047235951 8:123042155-123042177 GGTCGGCACGGGGAGTCGGGCGG - Exonic
1047963002 8:130024510-130024532 TGGCGGGGGTGGGGGTTGGGGGG - Intergenic
1048346020 8:133575185-133575207 GGGCAGCGGTGGGGGTCGGGAGG - Intergenic
1048437679 8:134433220-134433242 AGGAGGTGCTGGGACTTGGGAGG - Intergenic
1049274430 8:141712750-141712772 TGGTGGCCCTGGGGGTTGGGTGG + Intergenic
1049457529 8:142701036-142701058 GGGTGGACCTGGGAGGTGGGCGG + Intronic
1049789403 8:144465982-144466004 GGGCGGGGCTGCGAGGAGGGGGG + Intergenic
1049861619 8:144902440-144902462 GGGCGGGGCTGGGGGCTGCGTGG + Intergenic
1049957703 9:708673-708695 CGGCAGTGCTGGGGGTTGGGAGG + Intronic
1049997480 9:1046217-1046239 GGGCGGAGCTGGGGGGTGTGGGG + Intergenic
1050175253 9:2863539-2863561 GGGCGCTGGTGGGAGGTGGGTGG + Intergenic
1052900685 9:33792197-33792219 GAGAGGAGCTGGGAGTTTGGCGG + Intronic
1053231749 9:36416194-36416216 GGGAGGGGGTGGGAGATGGGAGG + Intronic
1053269273 9:36739214-36739236 GGGTGGGGGTGGGAGATGGGGGG + Intergenic
1053367114 9:37530739-37530761 AGGCGGAGGTGGGAGGTGGGAGG - Intronic
1053413909 9:37934179-37934201 GGGAGGGGCTGGGAGAGGGGGGG - Intronic
1053435040 9:38068844-38068866 GGGCGGCGCTAGGCGGAGGGAGG - Exonic
1053789547 9:41677097-41677119 GGGGGAGGCTGGGAGGTGGGAGG - Intergenic
1053835477 9:42130108-42130130 GGGCGGAGGCGGGAGGTGGGAGG + Intergenic
1054155596 9:61637655-61637677 GGGGGAGGCTGGGAGGTGGGAGG + Intergenic
1054177885 9:61888788-61888810 GGGGGAGGCTGGGAGGTGGGAGG - Intergenic
1054475365 9:65568665-65568687 GGGGGAGGCTGGGAGGTGGGAGG + Intergenic
1054659644 9:67692036-67692058 GGGGGAGGCTGGGAGGTGGGAGG + Intergenic
1055941345 9:81653000-81653022 GGGTGGAGTTGGGAGTTGGGAGG - Intronic
1056380297 9:86051735-86051757 CTGCGGGGGTGGGAGTTGGGGGG - Intronic
1056451526 9:86721725-86721747 GGGGGGCGGTGGGGGTGGGGGGG - Intergenic
1057049006 9:91907885-91907907 GGGTGGCCCTGGGTGTGGGGTGG - Intronic
1057259062 9:93574217-93574239 GGGCAGGGCTGGGAGGTGGGTGG + Intergenic
1057558488 9:96108378-96108400 GTGCTGAGCTGGGAGTGGGGAGG + Exonic
1057897136 9:98918077-98918099 GGGCTGTTCTGGGAGCTGGGTGG + Intergenic
1058687140 9:107489134-107489156 GCGCGGCGCTGGGAGCAGGGAGG - Intronic
1059497177 9:114719466-114719488 GGGAAGCCCTGGGATTTGGGAGG - Intergenic
1059634195 9:116155479-116155501 GGGCGGCGCTGGAAGAGAGGAGG + Intronic
1059829860 9:118083285-118083307 GGGCTGTGCTGGGAGGTGGTGGG - Intergenic
1059995245 9:119902771-119902793 GGGCGGTGATGGGGGTGGGGAGG - Intergenic
1060454894 9:123782851-123782873 GGGGGGAGCTGGGGGTTGGTAGG - Intronic
1061244133 9:129392540-129392562 GGGCGGGGAGGAGAGTTGGGAGG - Intergenic
1061559491 9:131393855-131393877 GGAGGGGGCTGGGAGTGGGGAGG - Intergenic
1062056722 9:134472733-134472755 GAGGGGCCCTGGGAGTGGGGTGG - Intergenic
1062129508 9:134885026-134885048 GGGTGACACTGGGAGGTGGGAGG + Intronic
1062282286 9:135757397-135757419 GGGTGCAGCTGGGACTTGGGGGG + Intronic
1062287001 9:135777796-135777818 AGGAGGAGCTGGGAGTTGGGTGG - Intronic
1062287018 9:135777863-135777885 GGGAGAAGCTGGGAGTGGGGAGG - Intronic
1062287029 9:135777897-135777919 GGGAGGAGCTGGGAGTGAGGGGG - Intronic
1062311606 9:135940927-135940949 GGGTGGTGCTGGGAGCTGTGTGG - Intronic
1062332975 9:136052631-136052653 GGAGGGCGCTGGGAGTGGGATGG - Intronic
1062370464 9:136236182-136236204 GTGCGGAGCAGGGAGTGGGGAGG - Intronic
1062405772 9:136395548-136395570 GGGGGGCTCTGGGGGTGGGGAGG + Intronic
1062458750 9:136654130-136654152 GGCAGGTGCTGGGAGGTGGGGGG - Intergenic
1062549087 9:137077800-137077822 CGGCGGCGCTGGGAGGAGGAAGG + Exonic
1062556343 9:137114854-137114876 GCGGGGCGCGGGGTGTTGGGGGG - Intronic
1203745293 Un_GL000218v1:37963-37985 GGGCAGCTCTGTGAGCTGGGTGG - Intergenic
1203564816 Un_KI270744v1:81521-81543 GGGCAGCTCTGTGAGCTGGGTGG + Intergenic
1185479738 X:437481-437503 AGGCGGCTCTGGGAGTGGGTGGG - Intergenic
1186275991 X:7938792-7938814 GGGTGGCGGGGGGAGTTGAGGGG + Intergenic
1190265703 X:48826395-48826417 GCGCGGCGCAGGGGGGTGGGCGG + Intergenic
1190708230 X:53048377-53048399 GGGCGGGGCGGGGAGCGGGGGGG - Intergenic
1190879416 X:54482404-54482426 GGGCGGGGGAGGGAGATGGGCGG - Intronic
1192244556 X:69361785-69361807 GGGCAGGGGTGGGAGATGGGAGG + Intergenic
1194244576 X:91494899-91494921 GGGAGGTGCTGGGATTAGGGGGG - Intergenic
1194411763 X:93566120-93566142 GGGTGGGGGTGGGCGTTGGGCGG + Intergenic
1194600415 X:95913803-95913825 GGGGGGCGGGGGGAGGTGGGGGG - Intergenic
1195884599 X:109625338-109625360 GGGCGAGGCTGGGAGACGGGCGG + Intronic
1195923318 X:110003026-110003048 GGGTGGAGCTGGGGGTTCGGGGG + Intronic
1196866906 X:120078495-120078517 GGGCGGGGGAGGGAGTAGGGCGG + Intergenic
1196876193 X:120157787-120157809 GGGCGGGGGAGGGAGTAGGGCGG - Intergenic
1197695021 X:129540645-129540667 GGGCGGCGGTGGGGGGGGGGTGG + Intronic
1198480271 X:137034112-137034134 GAGCGGGGCTGGCAGGTGGGGGG + Intergenic
1199470509 X:148190619-148190641 GGGCGGGGGAGGGGGTTGGGAGG + Intergenic
1199600791 X:149540154-149540176 GGGCGGGGCTCGGGGTGGGGCGG - Intergenic
1199600828 X:149540258-149540280 GGGCGGGGCTGGGAGAGGCGGGG - Intergenic
1199649499 X:149938923-149938945 GGGCGGGGTTGAGAGTGGGGCGG + Intergenic
1199724353 X:150566695-150566717 GGGAGGAGCTGGGGGTTAGGAGG - Intergenic
1200256503 X:154585602-154585624 GGGTGGGGGTGGGGGTTGGGAGG + Intronic
1200261266 X:154618801-154618823 GGGTGGGGGTGGGGGTTGGGAGG - Intronic
1200886808 Y:8279576-8279598 GGGCGGGGCGGGGACGTGGGAGG + Intergenic
1201158614 Y:11152982-11153004 GGGCAGCTCTGTGAGCTGGGTGG - Intergenic
1201904467 Y:19075993-19076015 GGTCGGAGGAGGGAGTTGGGAGG - Intergenic