ID: 1083891855

View in Genome Browser
Species Human (GRCh38)
Location 11:65599543-65599565
Sequence CAGGGCGCGGGCGTTGGCGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 161}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083891855 Original CRISPR CAGGGCGCGGGCGTTGGCGT GGG Exonic
900349401 1:2227678-2227700 CTGGGCGCGGGCGGAGGCGGAGG - Intergenic
901325196 1:8361201-8361223 GAGGGCGTGGGCCCTGGCGTGGG + Exonic
902335017 1:15749640-15749662 CAGGGCGTGGTCGCTGGGGTTGG + Intergenic
902823172 1:18955913-18955935 CAGGGCCACGGCATTGGCGTTGG + Exonic
904093987 1:27963565-27963587 CAGGGCGAGGAAGTCGGCGTAGG - Exonic
905174051 1:36125280-36125302 CGGGGCGCGGGCCTTGGCCGTGG - Intergenic
913576461 1:120180316-120180338 CAGGGCGCAGGCCCTGGCGGGGG + Intergenic
916107357 1:161441472-161441494 AAGGGCGCAGGCGTTCGCGCCGG + Intergenic
916108942 1:161448890-161448912 AAGGGCGCAGGCGTTCGCGCCGG + Intergenic
916110530 1:161456271-161456293 AAGGGCGCAGGCGTTCGCGCCGG + Intergenic
916112115 1:161463681-161463703 AAGGGCGCAGGCGTTCGCGCCGG + Intergenic
916113702 1:161471062-161471084 AAGGGCGCAGGCGTTCGCGCCGG + Intergenic
921850472 1:219928207-219928229 CTCGGCGCGGGCGTAGCCGTAGG + Exonic
1064245681 10:13666048-13666070 CGGGGCCCGGGCGTGGGAGTGGG + Intronic
1067370612 10:45678620-45678642 CAGGGTGCGGGCCTTGGCCAGGG + Intergenic
1069823580 10:71242084-71242106 CAGGGGGCTGGGGTTGGCCTAGG - Intronic
1070783828 10:79151831-79151853 CAGGGTGGGGGCATTGGCGGTGG + Intronic
1071086829 10:81875254-81875276 CCGGGCGCGGGCGCGGGCGCGGG - Intergenic
1071847433 10:89535381-89535403 CGGGGCGCTGGCGCTGTCGTTGG - Intronic
1075207076 10:120457177-120457199 CAGGCCGCGGGCGGGGGCGGAGG - Exonic
1076462326 10:130655823-130655845 CAGGGCGTGGACGTTGTGGTGGG - Intergenic
1076639085 10:131901521-131901543 CGGGGCACGGGCGGAGGCGTCGG + Intronic
1077214542 11:1389987-1390009 CGGGGCGCGGGCCTCGGCGGCGG + Intronic
1077405362 11:2380111-2380133 CAGGGCGTGGGTGTTGGCCAGGG + Intronic
1083234464 11:61342821-61342843 CAGGGAGCGGACGGTAGCGTCGG - Exonic
1083440292 11:62671785-62671807 CTGGGCGCAGGGGCTGGCGTGGG + Exonic
1083891855 11:65599543-65599565 CAGGGCGCGGGCGTTGGCGTGGG + Exonic
1086590524 11:88509328-88509350 CTGGGCGCTGGCGCTGGCGCAGG - Exonic
1087683740 11:101241230-101241252 AAGGGTGCGGGCCATGGCGTGGG - Intergenic
1087761809 11:102110657-102110679 CAGGGCGGGGGCGGAGGCGCCGG + Exonic
1088935901 11:114400232-114400254 CAGACCGCGGGCGTCAGCGTTGG - Exonic
1089667328 11:120028843-120028865 CAGGGCACTGGCGTTGGGGGAGG - Intergenic
1091434230 12:460569-460591 AAGGGCGCGGGGGTGGGCGGCGG + Intronic
1091599426 12:1908897-1908919 CCTGGCGTGGGAGTTGGCGTGGG - Intronic
1094155549 12:27333458-27333480 CTGGGCGCCCGCGTCGGCGTCGG + Intronic
1095261665 12:40105633-40105655 CAGAGCGCGGGCGCGGGCGGCGG - Exonic
1102128079 12:110501912-110501934 CAGGGCCCAGGCGCTGGCCTGGG - Intronic
1103935879 12:124476243-124476265 GAGGGCCTGGGCGGTGGCGTGGG - Intronic
1103954223 12:124567506-124567528 CAGGGCGCGGGCGCAGGGCTCGG + Intronic
1104487442 12:129163658-129163680 CAGGGAGCGGGAGTTGGTGCTGG - Intronic
1104854569 12:131895713-131895735 GGGGGCGTGGGCGTGGGCGTGGG + Intronic
1104980574 12:132571546-132571568 CAGGGGGCGGGGGCGGGCGTGGG + Intronic
1105044052 12:132986817-132986839 CAGCGCGCGAACGTGGGCGTGGG + Exonic
1105278374 13:18949148-18949170 CAGGGCCCGGGAGGTGGCATTGG - Intergenic
1107467546 13:40664822-40664844 GCGGGCGCGGGCGGTGGCGGTGG - Intronic
1113656008 13:112068121-112068143 ATGGGCGTGGGCGTGGGCGTGGG + Exonic
1113792143 13:113034636-113034658 CAGGGCAAGGGCGAGGGCGTGGG - Intronic
1115576139 14:34714311-34714333 GAGGGCCCGGGCGTCGGCGCAGG - Intronic
1115851916 14:37595633-37595655 AAGGCCGGGGGCGGTGGCGTCGG + Intronic
1118607559 14:67514983-67515005 GAGGGCGCGGGCGATGGGGACGG - Intronic
1122264205 14:100539130-100539152 CAGGTCGCGGGCGGAGGCATCGG + Exonic
1122975296 14:105168447-105168469 CCGGGCGCGGGCGGCGGCGGCGG - Exonic
1125476464 15:40051025-40051047 GAGGGGGCGGGTGTTGGCCTGGG + Intergenic
1125603635 15:40928393-40928415 CAGGGCGCGGCCGGGGGCTTGGG + Intergenic
1126823719 15:52529113-52529135 CAGGGCGGCGGCGGTGGCGGCGG - Intergenic
1130622002 15:85473239-85473261 CTGGGCGCGGGTGTGGGGGTGGG + Intronic
1131006731 15:88984673-88984695 CAGGGCGTGGGGGTTGCGGTGGG - Intergenic
1131272387 15:90955177-90955199 CAGGGCCCCGGCGTAGGCCTCGG + Intronic
1132748657 16:1447362-1447384 CAGGGCATGGGCATGGGCGTGGG - Intronic
1132785475 16:1654933-1654955 CAGGGCGTGGGCGTGGGTGCTGG - Intronic
1132942412 16:2514583-2514605 CAGTGCGCGGGCGGCGGCGCGGG + Intronic
1136111082 16:28063823-28063845 CCGGGCGCGGGCGGGGGCCTGGG + Intergenic
1136771272 16:32843679-32843701 AAGGGCCCGGGCCTTGGCGAGGG + Intergenic
1137983720 16:53090824-53090846 CAGGGCATGGGGGTTGGGGTGGG - Intronic
1138328053 16:56191647-56191669 CAGCGCGCGGGGGTCGGCGAAGG + Intronic
1142156147 16:88533624-88533646 CAGGGCGCGGGCGCGGGCGCCGG + Exonic
1143705808 17:8697081-8697103 AAGAGCGGGGGCGTTGGCGAGGG + Intergenic
1144828769 17:18120733-18120755 CTGGGCGCGGGCTGTGGCGCGGG - Exonic
1147313084 17:39606466-39606488 CCGGGCGCAGGCGGTGGCGGTGG + Exonic
1149658298 17:58321697-58321719 CAGGGCCTGGGCGGTGGCCTGGG - Intronic
1149691138 17:58577888-58577910 GTGGGCGTGGGCGTGGGCGTGGG + Intronic
1151780275 17:76240671-76240693 CGCGGCGGGGGCGTGGGCGTGGG + Intergenic
1152175163 17:78782355-78782377 CAGGGGGCGGGCGCAGGCGCAGG - Intergenic
1152570517 17:81119463-81119485 AAGGGAGCGGGCGTGGGCGTGGG + Exonic
1152697428 17:81804097-81804119 CAGGGCGAGGGCGGCGGCGGAGG - Intergenic
1154326570 18:13395580-13395602 GTGGGGGCGGGAGTTGGCGTGGG + Intronic
1154326577 18:13395598-13395620 GTGGGGGCGGGAGTTGGCGTGGG + Intronic
1154326583 18:13395616-13395638 GTGGGGGCGGGAGTTGGCGTTGG + Intronic
1154326602 18:13395670-13395692 GTGGGGGCGGGAGTTGGCGTTGG + Intronic
1157223668 18:45844273-45844295 CAGGGAGCGGGCGATAACGTGGG + Intergenic
1157279103 18:46334191-46334213 CGGGGCGCGGGCGCGGGCGGCGG - Intronic
1157849084 18:51030601-51030623 CTGGGCTCGGGCGGTGGCGAGGG - Exonic
1160613911 18:80109582-80109604 CAGGCGGCGGGCGTGGGTGTGGG - Intronic
1160631262 18:80247578-80247600 CGGGGCGCGGGCGCGGGCGCCGG - Intergenic
1160991920 19:1863620-1863642 CCGAGCGCGGGCGTCGGCGGCGG - Intergenic
1161810966 19:6471224-6471246 TAGGCCGTGGGCGTTGGCTTAGG - Intronic
1162312161 19:9913958-9913980 CGGGGGGCGGGCGAGGGCGTGGG - Intronic
1163502972 19:17687243-17687265 CAGAGCGTGGGCCTGGGCGTGGG + Intronic
1163666397 19:18605998-18606020 CAGGGGGAGGGCGGTGGCGCCGG + Intronic
1165080011 19:33301714-33301736 CTGGGCACGGGCGTGGGCGGCGG + Exonic
1166042909 19:40214026-40214048 CTGGGCGAGGGCGTGGGTGTGGG - Exonic
1167239384 19:48334158-48334180 CAGCGCGCAGGCGTTGGAGCTGG - Exonic
1167578332 19:50328319-50328341 CAGGACGCGGGCGGCGGCGCCGG - Exonic
1168267507 19:55230735-55230757 CAGGGCGGGGGGGTGGGGGTGGG - Intronic
927652439 2:24920453-24920475 GCGGGCGCGGGCGCGGGCGTGGG + Intergenic
927652441 2:24920459-24920481 GCGGGCGCGGGCGTGGGCGGTGG + Intergenic
929133581 2:38602463-38602485 CGGGGCGGGGGCGATGGCGGCGG - Exonic
930867519 2:56136559-56136581 GCGGGCGGGGGCATTGGCGTTGG - Intergenic
931241873 2:60461302-60461324 CGGGGCGCGGTCGTGGGCGTGGG - Exonic
931517822 2:63059906-63059928 CAGGGTGAGGGCGCTGGCGTTGG + Intergenic
934966808 2:98730961-98730983 GAGGGCGCGGGAGTTGGGGGCGG - Intronic
937932882 2:127219708-127219730 CGGGGCGGGGGCGTTGGGGAGGG - Intronic
938338996 2:130523052-130523074 GGGGGCGCGGGAGTTGGCGCCGG + Intronic
938350842 2:130597698-130597720 GGGGGCGCGGGAGTTGGCGCCGG - Intronic
944495904 2:200306964-200306986 CAGGGCGCGGGCGGACGCGGAGG + Intronic
948115825 2:235493985-235494007 CGGGGCGCGGGCGCGGGCGCGGG + Intergenic
949012143 2:241686941-241686963 CAGGGCGCAGGCGCGGGTGTCGG - Exonic
1169065639 20:2692996-2693018 CGGGGCGCTGGCGCTGGCGGCGG + Exonic
1172245782 20:33443953-33443975 CAGGGGGCGGGGCTTCGCGTCGG + Intergenic
1174870167 20:54174187-54174209 CTGGGCGCGGGAGGTGGGGTGGG + Intergenic
1175421938 20:58840243-58840265 CTGGGCACGGGCGTTGGAGGTGG - Intronic
1175460700 20:59149939-59149961 AAGGGGGCTGGCGCTGGCGTTGG - Intergenic
1175562145 20:59939759-59939781 GACGGCGCTGGCGTTGGCGGCGG + Exonic
1175895712 20:62334753-62334775 CAGGGCGAGGGCGAGGGCGAGGG + Intronic
1179563948 21:42234866-42234888 CCCGGCGCGGGCGGTGGCGGCGG - Intronic
1179826191 21:43967916-43967938 CAGGGGGAGGGCGTTGGCACTGG - Intronic
1179875630 21:44265952-44265974 CAGGGCGGGTGCCCTGGCGTAGG + Intergenic
1180596290 22:16975637-16975659 CAGGGCTCGGGCGTTGTGCTGGG - Intronic
1180843635 22:18970431-18970453 CAGGGCGCGGGAGGCGGCGGCGG - Intergenic
1182550971 22:31100555-31100577 CGGGGTGGGGGCGATGGCGTTGG - Intronic
1183069589 22:35386932-35386954 CAGGTAGCGGGTGTAGGCGTGGG - Exonic
1183196740 22:36358672-36358694 CAGGGCACGGGCAGTGGTGTTGG - Intronic
1184337513 22:43862442-43862464 CGGGGCGCGGGCGCGGGCGCGGG - Exonic
1184863071 22:47187786-47187808 CAGGGCGCCGGCCTTGGAGGGGG + Intergenic
1185343051 22:50300061-50300083 GAGGGCGCGGGCGGTGGCCGTGG - Intronic
950729785 3:14947604-14947626 CAGCGCGCGGGCGGCGGCGGCGG + Intronic
954131366 3:48562807-48562829 CAGGATGCGGGCGTTGGTGGTGG + Exonic
954459218 3:50617070-50617092 CAGGGAGCGGGGGGTGGAGTGGG + Intronic
955687413 3:61561493-61561515 CAGGGGGCGCGCGGTGGCGGCGG - Intergenic
961551729 3:127673414-127673436 CAGGGCGCGGGTATAGGCCTGGG + Intronic
961666532 3:128496471-128496493 CAAGGCGCGGGCGGTGGTGGCGG + Intergenic
968879719 4:3292861-3292883 CGGGGCGAGGGCCTTCGCGTCGG - Intergenic
983919809 4:173333826-173333848 CGGGGCGCGGGCGGGGGCGCGGG - Intronic
988399455 5:30743119-30743141 CAGGGCTCTGGCGGTGGAGTTGG - Intergenic
1001325120 5:170718544-170718566 CAGGGAGGGGGCTTCGGCGTTGG - Intronic
1006181312 6:32154882-32154904 CAGGGAGCTGGTGCTGGCGTGGG + Intronic
1006891593 6:37433522-37433544 CAGGGAGCCGGCGTTGGGGGTGG - Intronic
1006941410 6:37754077-37754099 CAGGGAGCGGGGGGTGGCCTGGG + Intergenic
1007092295 6:39191724-39191746 CAGGGCGTGGTAGTTGGCGCTGG + Exonic
1007248998 6:40482927-40482949 CAGGGAGCTGGCAGTGGCGTGGG - Intronic
1008013256 6:46491026-46491048 CAGGGCGGGGGCGGGGGCGGGGG - Intronic
1013836562 6:114342231-114342253 CAGGGCGCGGGGGTCGGCGGCGG + Exonic
1014798419 6:125750097-125750119 CAGAGCGCAGGAGTTGGCGAGGG + Intronic
1016340919 6:143060816-143060838 CCGGGCGCGGGCGCGGGCGCGGG - Intronic
1019472818 7:1230235-1230257 GAGGGCGCGGGGGAGGGCGTGGG + Intergenic
1023881994 7:44325873-44325895 CAGGGCGCGGGTGTGTGTGTGGG - Intronic
1024043823 7:45574465-45574487 CGGGGCGCGGGCGGCGGCGCCGG - Intronic
1024993803 7:55255668-55255690 CAGGGCGCGGGCTCTGGGGCTGG - Intronic
1030197490 7:106867374-106867396 CAGAGCGTGGGCTTTGGAGTCGG - Intronic
1032383366 7:131505658-131505680 CAGAGCGTGGGCTTTGGAGTCGG - Intronic
1032614987 7:133458860-133458882 CAGGGCGGGGGTGTGGGGGTGGG - Intronic
1033210090 7:139453978-139454000 CAGGCCGCGAGCATGGGCGTGGG + Intronic
1033365948 7:140672911-140672933 CAGGGCGCGGGCGCAGGCGGGGG - Intronic
1035169566 7:157010040-157010062 CTGGGCGCGGGCGGCGGCGGCGG - Exonic
1036930608 8:12951972-12951994 CAGGGTGCGCGCGTGGCCGTGGG - Intronic
1037802459 8:22043064-22043086 CAGGGCGGGGGCGGGGGCCTGGG + Intronic
1040481488 8:47831533-47831555 CAGGGCGCGGGCCTTGAGGTAGG + Intronic
1043501975 8:80867194-80867216 CAGGGAGCGGGGGTTGGCCCAGG + Intronic
1049793723 8:144485934-144485956 CAGGGTGTGGGCGTTGAGGTCGG + Intronic
1060588504 9:124801565-124801587 CAGGGCGCGGGGCTTGGCTGTGG - Exonic
1062458665 9:136653581-136653603 CGGGGCGGGGGCTGTGGCGTGGG + Intergenic
1062579229 9:137222153-137222175 AGGGGCGCGGGCGCGGGCGTGGG + Intergenic
1185750966 X:2609357-2609379 CAGCGCGCGGGCGAAGGCGGCGG - Intergenic
1185778982 X:2829369-2829391 CGGGGCGCGGGCGTAGGGCTGGG + Intronic
1187154619 X:16712011-16712033 CCGGGTGCGGGCGCTGGCGCGGG + Exonic
1187420306 X:19128128-19128150 CAGGGCTTGGGGGTTGGAGTAGG + Intergenic
1198533488 X:137566463-137566485 CAGGGAGGGGGTGTTGGCGGGGG - Exonic
1198534718 X:137574563-137574585 CAGGGCGCGGGAGTGGGGGTGGG - Intronic
1200058754 X:153474731-153474753 GGGGGCGCGGGCGCTGGCGCGGG + Intronic
1200283600 X:154799928-154799950 CGGGGGGCGGGCGGTGGCGGGGG + Intronic