ID: 1083893557

View in Genome Browser
Species Human (GRCh38)
Location 11:65608891-65608913
Sequence CAGGCCACTGCACCTGGCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1219
Summary {0: 1, 1: 1, 2: 14, 3: 128, 4: 1075}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083893552_1083893557 -2 Left 1083893552 11:65608870-65608892 CCTCCCAAAGTGCTGGGATTACA 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
Right 1083893557 11:65608891-65608913 CAGGCCACTGCACCTGGCCGAGG 0: 1
1: 1
2: 14
3: 128
4: 1075
1083893543_1083893557 27 Left 1083893543 11:65608841-65608863 CCCAACCTCAGGTGATCTGCCCG 0: 679
1: 9625
2: 37630
3: 74218
4: 106059
Right 1083893557 11:65608891-65608913 CAGGCCACTGCACCTGGCCGAGG 0: 1
1: 1
2: 14
3: 128
4: 1075
1083893544_1083893557 26 Left 1083893544 11:65608842-65608864 CCAACCTCAGGTGATCTGCCCGC 0: 1589
1: 6314
2: 10326
3: 11136
4: 7694
Right 1083893557 11:65608891-65608913 CAGGCCACTGCACCTGGCCGAGG 0: 1
1: 1
2: 14
3: 128
4: 1075
1083893550_1083893557 4 Left 1083893550 11:65608864-65608886 CCTCGGCCTCCCAAAGTGCTGGG 0: 114360
1: 259489
2: 214307
3: 130302
4: 170463
Right 1083893557 11:65608891-65608913 CAGGCCACTGCACCTGGCCGAGG 0: 1
1: 1
2: 14
3: 128
4: 1075
1083893548_1083893557 7 Left 1083893548 11:65608861-65608883 CCGCCTCGGCCTCCCAAAGTGCT 0: 87986
1: 182858
2: 138884
3: 74939
4: 51691
Right 1083893557 11:65608891-65608913 CAGGCCACTGCACCTGGCCGAGG 0: 1
1: 1
2: 14
3: 128
4: 1075
1083893554_1083893557 -5 Left 1083893554 11:65608873-65608895 CCCAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 1083893557 11:65608891-65608913 CAGGCCACTGCACCTGGCCGAGG 0: 1
1: 1
2: 14
3: 128
4: 1075
1083893555_1083893557 -6 Left 1083893555 11:65608874-65608896 CCAAAGTGCTGGGATTACAGGCC 0: 4832
1: 222861
2: 273207
3: 187102
4: 182881
Right 1083893557 11:65608891-65608913 CAGGCCACTGCACCTGGCCGAGG 0: 1
1: 1
2: 14
3: 128
4: 1075
1083893547_1083893557 8 Left 1083893547 11:65608860-65608882 CCCGCCTCGGCCTCCCAAAGTGC 0: 84291
1: 218536
2: 234154
3: 158283
4: 172560
Right 1083893557 11:65608891-65608913 CAGGCCACTGCACCTGGCCGAGG 0: 1
1: 1
2: 14
3: 128
4: 1075
1083893545_1083893557 22 Left 1083893545 11:65608846-65608868 CCTCAGGTGATCTGCCCGCCTCG 0: 2595
1: 17355
2: 48266
3: 83817
4: 97243
Right 1083893557 11:65608891-65608913 CAGGCCACTGCACCTGGCCGAGG 0: 1
1: 1
2: 14
3: 128
4: 1075

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083893557 Original CRISPR CAGGCCACTGCACCTGGCCG AGG Intronic
900006225 1:54920-54942 CAAGCCATTGCACCTGACCCTGG + Intergenic
900108984 1:997815-997837 CAGGCCAGTGACCCTGGGCGGGG - Intergenic
900330521 1:2132216-2132238 TGGGCCACTGCACATGGCTGAGG + Intronic
900416887 1:2539470-2539492 CTGCACACTGCACCTGGCCAGGG - Intergenic
900416991 1:2539918-2539940 CTGCACACTGCACCTGGCCAGGG + Intergenic
900428391 1:2590844-2590866 CAGGCCTCTGCGCCTGGCCTAGG - Exonic
900994501 1:6113139-6113161 TGGGCCACTGCACCTGGCCGAGG - Intronic
901125693 1:6927021-6927043 TGAGCCACTGCACCTGGCCTCGG + Intronic
901345777 1:8540394-8540416 TGAGCCACTGCACCTGGCCGGGG + Intronic
901411375 1:9086672-9086694 TCAGCCACTGCACCTGGCTGAGG + Intronic
901422204 1:9158700-9158722 TGAGCCACTGCACCTGGCCCAGG - Intergenic
901502658 1:9662970-9662992 TGAGCCACTGCACCTGGCAGCGG + Intronic
901596157 1:10386829-10386851 TGGGCCACTGCGCCTGGCCCGGG + Intergenic
901630853 1:10647516-10647538 CAGTCCACCCCACCTGGCCCTGG + Intronic
901665956 1:10826223-10826245 TGAGCCACTGCACCCGGCCGGGG - Intergenic
901719197 1:11181932-11181954 TGAGCCACTGCACCTGGCCTCGG - Intronic
901822905 1:11841628-11841650 CGGGCCTCGGCACCTGGCCCTGG + Exonic
902131787 1:14267914-14267936 CATGCCACTGCACTTGGGCCTGG + Intergenic
902287873 1:15418271-15418293 TGAGCCACTGCACCTGGTCGAGG + Intronic
902431870 1:16369603-16369625 TGAGCCACAGCACCTGGCCGCGG - Intronic
902581631 1:17411291-17411313 TGAGCCACTGCACCTGGCCAAGG - Intronic
902586738 1:17444011-17444033 TGAGCCACTGCGCCTGGCCGCGG - Intergenic
902590002 1:17466975-17466997 TGGGCCACTGCACCTGGCCCTGG + Intergenic
903439942 1:23380160-23380182 TGAGCCACTGCACCTGGCCTCGG - Intergenic
903591754 1:24461581-24461603 CGAGCCACTGCACCCGGCCAAGG - Intronic
903593836 1:24479029-24479051 TGAGCCACTGCACCTGGCCTGGG - Intergenic
903694108 1:25194990-25195012 GCAGCCTCTGCACCTGGCCGAGG + Intergenic
903822069 1:26111014-26111036 GAGGCGCCTGCACCTGGCTGCGG - Intergenic
904097742 1:27994681-27994703 CCAGCCACTGCACCTGGCCAGGG - Intronic
904098754 1:28003689-28003711 CATGCCACTGCACCTGGCTGGGG + Intronic
904670985 1:32165403-32165425 TGAGCCACTGCACCTGGCCCAGG - Intronic
904684475 1:32250505-32250527 AAGGCCACAGCCCCTGGCAGAGG - Intergenic
905115153 1:35632608-35632630 TGAGCCACTGCACCTGGCCAAGG - Intronic
905162223 1:36046406-36046428 TGAGCCACCGCACCTGGCCGAGG - Intronic
905172110 1:36115429-36115451 CAGGCCACTGCACCCAGGCTGGG + Intronic
905379476 1:37550810-37550832 TGAGCCACTGCACCTGGCCTTGG - Intronic
905999140 1:42408702-42408724 TGAGCCACTGCACCTGGCCTGGG + Intronic
906118031 1:43368204-43368226 CAGGCCGCTGCAACTGGCCAGGG - Intergenic
906222890 1:44096223-44096245 TGAGCCACTGCACCTGGCCTTGG + Intergenic
906223202 1:44099494-44099516 TGAGCCACTGCACCTGGCCCAGG - Intergenic
906394094 1:45445501-45445523 TGAGCCACTGCACCTGGTCGTGG - Intronic
906472701 1:46144484-46144506 TGAGCCACCGCACCTGGCCGAGG - Intronic
907196457 1:52691132-52691154 TGAGCCACTGCACCTGGCCAAGG - Intronic
907349997 1:53821148-53821170 TGAGCCACTGCACCTGGCCTGGG - Intronic
907431132 1:54412178-54412200 CAGGCCACCACGCCTGGCCGAGG - Intronic
907783070 1:57584966-57584988 TAAGCCACCGCGCCTGGCCGAGG - Intronic
908546666 1:65168889-65168911 TGGGCCACTACACCTGGCCTAGG - Intronic
909006050 1:70277902-70277924 TGAGCCACTGCACCTGGCCCAGG - Intronic
909420330 1:75457572-75457594 TGAGCCACTGCACCTGGCCTCGG - Intronic
909497304 1:76292578-76292600 CAGGCCACTGGTTCTGGCTGTGG - Intronic
910923206 1:92371741-92371763 TGAGCCACTGCACCTGGCCCAGG - Intronic
910961026 1:92763223-92763245 CACACCACTGCACTTGGCCTGGG + Intronic
911374166 1:97030225-97030247 TGAGCCACTGCACCTGGCCATGG + Intergenic
912470009 1:109900395-109900417 CAGGCCTCTGCACCAGGATGGGG - Intergenic
912636964 1:111305038-111305060 CAGGTCACTGCACTTGGCTTTGG + Intronic
912998979 1:114560714-114560736 CGAGCCACTGCTCCTGGCCAAGG + Intergenic
913479377 1:119272477-119272499 CGAGCCACTGCGCCTGGCCCTGG - Intergenic
913697929 1:121345932-121345954 TAAGCCACTGCACCCGGCCCTGG + Intronic
914139622 1:144934119-144934141 TAAGCCACTGCACCCGGCCCTGG - Intronic
914462724 1:147899546-147899568 TGAGCCACTGCACCTGGCCCAGG - Intergenic
914891470 1:151627709-151627731 TAAGCCACTGCGCCTGGCCAAGG + Intronic
915187871 1:154122773-154122795 TGAGCCACTGCACCTGGCCCTGG - Intronic
915192317 1:154162085-154162107 TGAGCCACTGCACCTGGCCATGG - Intronic
915370214 1:155343262-155343284 TGAGCCACTGCACTTGGCCGAGG + Intronic
915408783 1:155683962-155683984 TGAGCCACTGCACCTGGCCCAGG - Intronic
916056011 1:161069409-161069431 CAGGCCACTGCCCCTTCCCCAGG + Intronic
916092502 1:161318748-161318770 TGAGCCACTGCACCTGGCCTTGG - Intronic
916150196 1:161780654-161780676 TGAGCCACTGCACCCGGCCGAGG + Intronic
916171657 1:162005606-162005628 TGGGCCACTGTACCTGGCCCTGG - Intronic
916449240 1:164903921-164903943 TAAGCCACTGCACCGGGCCTAGG + Intergenic
916531426 1:165660341-165660363 TGAGCCACTGCACCTGGCCTAGG - Intronic
916693410 1:167212903-167212925 CACACCACTGCACTTGGCCTGGG + Intergenic
916716312 1:167449637-167449659 TGAGCCACTGCACCTGCCCGTGG - Intronic
916926374 1:169525211-169525233 TGAGCCACTGCACCTGGCCATGG - Intronic
917015165 1:170522457-170522479 CAGGCCACAGCATGTGGCAGGGG + Intergenic
917106052 1:171493031-171493053 TGAGCCACTGCGCCTGGCCGGGG + Intronic
917121323 1:171647240-171647262 TGAGCCACTGCACCTGGCCAGGG - Intronic
917138517 1:171811093-171811115 TGAGCCACTGCACCTGGCCTAGG + Intronic
917188344 1:172387372-172387394 CGAGCCACCGCACCCGGCCGGGG - Intronic
917554063 1:176066007-176066029 TGAGCCACCGCACCTGGCCGGGG + Intronic
917796006 1:178533289-178533311 GAAGCCACTGCACCCGGCCCTGG + Intronic
917866230 1:179198408-179198430 ATGGCCACTGCGCCTGGCCTGGG - Intronic
917968917 1:180195057-180195079 CAGGCGCCTGCACTTGGTCGTGG + Intronic
918039220 1:180902112-180902134 TGAGCCACTGCACCTGGCCAAGG - Intergenic
918165593 1:181943951-181943973 TGAGCCACTGCACCTGGCCAAGG + Intergenic
918173202 1:182018323-182018345 TAAGCCACTGCACCCGGCCTAGG - Intergenic
918186365 1:182130963-182130985 TGAGCCACTGCACCTGGCCATGG - Intergenic
918253555 1:182726385-182726407 TGAGCCACCGCACCTGGCCGTGG - Intergenic
919990529 1:202705974-202705996 TGAGCCACTGCACCTGGCCTGGG + Intronic
920146608 1:203866985-203867007 TGAGCCACTGCACCTGGCCTAGG - Intronic
920194394 1:204217187-204217209 CAGGCCCCTGCAGGTGGCCAGGG + Intergenic
920418130 1:205812494-205812516 CAGGCCACTGAACCTGAGAGGGG + Intronic
920485326 1:206364582-206364604 TAAGCCACTGCACCCGGCCCTGG + Intronic
921026541 1:211288166-211288188 CATGCCACTGCACTTAGCCTGGG + Intronic
921142030 1:212317702-212317724 TAAGCCACTGAACCTGGCCCTGG - Intronic
921211416 1:212902678-212902700 TGAGCCACTGCACCTGGCCAGGG + Intergenic
922402670 1:225276612-225276634 CAAGCCACCACACCTGGCCCAGG - Intronic
922475019 1:225900675-225900697 TGAGCCACTGCACCTGGCCAGGG + Intronic
922488203 1:225993326-225993348 TGAGCCACTGCACCTGGCCTGGG - Intronic
922501880 1:226103287-226103309 TAGGCCACTGCACCCGGCCGGGG + Intergenic
922517270 1:226217169-226217191 TGAGCCACTGCACCTGGCCCAGG + Intergenic
922762017 1:228139201-228139223 TGAGCCACTGCACCTGGCCACGG - Intergenic
922796518 1:228342240-228342262 AAGGCCACAGCCCCTGGCCCCGG - Intronic
922964573 1:229677960-229677982 TAAGCCACTGCACCCGGCCTGGG + Intergenic
923564995 1:235069943-235069965 CCGGCCACTGACGCTGGCCGGGG - Intergenic
923619776 1:235569108-235569130 TGAGCCACTGCACCTGGCCTGGG + Intronic
923983878 1:239357302-239357324 TAAGCCACTGCCCCTGGCTGAGG + Intergenic
924056025 1:240124947-240124969 TGAGCCACTGCGCCTGGCCGTGG + Intronic
1063261337 10:4392621-4392643 TAAGCCACCGCACCTGGCTGGGG + Intergenic
1063267998 10:4475377-4475399 TGAGCCACTGCACCTGGCCTGGG - Intergenic
1063619657 10:7634419-7634441 CCGTCCACTGCACCTGGCTCTGG + Intronic
1063677008 10:8149617-8149639 TGAGCCACTGCACCTGGCCTTGG - Intergenic
1063681295 10:8190084-8190106 TGGGCCACTGCACCCGGCCGTGG - Intergenic
1064172753 10:13048473-13048495 TGAGCCACTGCACCTGGCCAGGG + Intronic
1064196631 10:13248929-13248951 TAAGCCACTGCACCCGGCCTGGG + Intergenic
1064389919 10:14933351-14933373 TAAGCCACAGCACCTGGCTGAGG - Intronic
1065142478 10:22732451-22732473 CATGCCACTGCATCTAGCCTGGG - Intergenic
1065286061 10:24188820-24188842 TGAGCCACTGCACCCGGCCGAGG - Intronic
1065291259 10:24232076-24232098 TGAGCCACTGCACGTGGCCGAGG + Intronic
1065476591 10:26144890-26144912 TGGGCCACTGCACCTGGCTGAGG - Intronic
1065572332 10:27083929-27083951 TGGGCCACTGCACCCGGCCTAGG - Intronic
1065577182 10:27133000-27133022 CAGGCCACAGCACAGGGCCCAGG + Intronic
1065720445 10:28623908-28623930 TAAGCCACTGCACCTGGCCCAGG - Intergenic
1065969453 10:30794908-30794930 TGAGCCACTGCACCTGGCCCGGG + Intergenic
1066060812 10:31722042-31722064 TGAGCCACTGCACCTGGCCAAGG - Intergenic
1066087190 10:31982601-31982623 TAAGCCACCGCGCCTGGCCGAGG - Intergenic
1066170006 10:32832216-32832238 TGAGCCACTGCACCTGGCCTTGG - Intronic
1066223197 10:33356093-33356115 TGAGCCACTGCACCTGGCCGAGG + Intergenic
1066358830 10:34711234-34711256 TGAGCCACTGCACCTGGCCTAGG - Intronic
1066389469 10:34967125-34967147 TGAGCCACTGCACCCGGCCGAGG - Intergenic
1066428274 10:35329266-35329288 TGAGCCACTGCACCCGGCCGGGG - Intronic
1067062834 10:43086796-43086818 CAGGCCGCTGCAGCTGGTCTGGG + Intronic
1067109085 10:43386709-43386731 CAGGCCACTGTAAGTGGCCTGGG + Exonic
1067711672 10:48655728-48655750 CAGGCCAGTGCACCCTGCCCGGG + Intronic
1067936609 10:50617854-50617876 TGAGCCACTGCACCTGGCCCTGG + Intronic
1068242750 10:54325463-54325485 TGAGCCACTGCACCTGGCAGTGG - Intronic
1068879787 10:62036106-62036128 CGAGCCACTGCACCTGGCCAAGG + Intronic
1069311033 10:67036640-67036662 GGAGCCACTGCACCTGGCCAGGG + Intronic
1069387380 10:67896425-67896447 TAGGCCACTGCACCCGGCCTTGG + Intronic
1069422584 10:68260540-68260562 CAGCCCATTGGACCTGGCCAGGG - Intergenic
1069438475 10:68407110-68407132 CAGTCCACCCCGCCTGGCCGCGG + Exonic
1069530198 10:69212518-69212540 TGAGCCACTGCACCTGGCCTTGG - Intergenic
1069618479 10:69821391-69821413 GAGGAGACTGCACCTGGCCAAGG - Intronic
1069720373 10:70545719-70545741 TGAGCCACTGCACCTGGCTGGGG + Intronic
1069837009 10:71315603-71315625 CAAGCCACTGCGCCCGGCCAGGG + Intergenic
1070185954 10:74062782-74062804 TAAGCCACTGCACCCGGCCAAGG - Intronic
1070244998 10:74722538-74722560 AATGCCACTGCACCTGGCCAAGG - Intergenic
1070291284 10:75116851-75116873 CACGCCACTGCACCAGGCTTCGG - Intronic
1070723276 10:78771402-78771424 TGAGCCACTGCGCCTGGCCGTGG + Intergenic
1071569885 10:86691033-86691055 CAGCCCACTCACCCTGGCCGGGG - Intronic
1071951485 10:90708033-90708055 TGAGCCACTGCACCTGGCCCGGG - Intergenic
1072034757 10:91553516-91553538 TGAGCCACTGCACCTGGCCCAGG + Intergenic
1072074110 10:91951107-91951129 TGAGCCACTGCACCTGGCCCAGG + Intronic
1072147968 10:92659466-92659488 GGAGCCACTGCACCTGGCCAGGG + Intergenic
1072281128 10:93866337-93866359 TGAGCCACTGCACCTGGCCAGGG - Intergenic
1072286504 10:93920903-93920925 TGAGCCACTGCACCTGGCAGAGG + Intronic
1072428870 10:95353787-95353809 TGAGCCACTGCACCTGGCCACGG + Intronic
1073301217 10:102472012-102472034 TGAGCCACTGCACCTGGCAGTGG - Intronic
1073343741 10:102766156-102766178 TGAGCCACTGCACCTGGCCCTGG - Intronic
1073474441 10:103743652-103743674 TGAGCCACTGCACCTGGCCCAGG + Intronic
1074245066 10:111681321-111681343 TGAGCCACTGCACCTGGCCCTGG + Intergenic
1074898729 10:117798669-117798691 TGAGCCACTGCACCTGGCCTTGG + Intergenic
1075019449 10:118940248-118940270 TGAGCCACTGCACCTGGCCATGG + Intergenic
1075094783 10:119463912-119463934 TGAGCCACTGCACCTGGCAGGGG + Intergenic
1075645681 10:124094350-124094372 CAGGCCACTGCGGCAGGCCGTGG - Intergenic
1075760598 10:124852850-124852872 TGAGCCACTGCACCTAGCCGAGG + Intergenic
1075852317 10:125599346-125599368 CAGGCCACCACACCTGCCCTGGG + Intronic
1076101689 10:127785410-127785432 TGAGCCACTGCACCCGGCCGAGG + Intergenic
1076578529 10:131490545-131490567 TGAGCCACTGCACCTGGCCAAGG - Intergenic
1076664598 10:132079080-132079102 CAGGCCTCGGCAGCTGGCTGTGG - Intergenic
1077058176 11:606015-606037 AGGGCCACTGCTCCTGCCCGAGG - Intronic
1077180280 11:1209169-1209191 CCGGCCTCAGCACCTGGCCATGG + Intergenic
1077436425 11:2541523-2541545 CAGGTCCCTGGACCTGGCGGTGG + Intronic
1077520928 11:3034063-3034085 CGAGCCACTGCACCTGGTCTGGG + Intronic
1077707399 11:4500020-4500042 CACGCCACTGTACCTGGCTGAGG + Intergenic
1078194069 11:9120269-9120291 TGAGCCACTGCACCTGGCCCAGG + Intronic
1078248170 11:9595288-9595310 CGAGCCACTGCACCTGGCCTGGG + Intergenic
1078257824 11:9675012-9675034 TGAGCCACTGCACCTGGCCTAGG - Intronic
1078455769 11:11473779-11473801 TGAGCCACTGCACCTGGCCTTGG - Intronic
1078645342 11:13136921-13136943 TGAGCCACTGCGCCTGGCCGAGG - Intergenic
1078953713 11:16165612-16165634 TGAGCCACTGCACCTGGCCTAGG - Intronic
1079999770 11:27334076-27334098 CAGGCCACTGCACCTGGCTCTGG + Intronic
1080024097 11:27595863-27595885 TGAGCCACTGCACCTGGCCAAGG - Intergenic
1080283612 11:30585446-30585468 CTCGTCACTGCACCTGGCCTCGG + Intronic
1080518067 11:33041465-33041487 TGAGCCACTGCACCTGGCCCAGG - Intronic
1080629564 11:34061489-34061511 TGAGCCACTGCACCTGGCCTAGG + Intronic
1081523201 11:43902878-43902900 TGAGCCACTGCACCTGGCCCAGG + Intronic
1081926385 11:46832806-46832828 CATGCCACTACACCTGGCTATGG - Intronic
1081961629 11:47141959-47141981 TAAGCCACTGCACCTGGTCGTGG - Intronic
1081974300 11:47221862-47221884 CGAGCCACTGCACCCGGCCTGGG + Intronic
1082209811 11:49485194-49485216 TGAGCCATTGCACCTGGCCGTGG + Intergenic
1082821892 11:57549749-57549771 GAAGCCACAGCACCTGGCCTGGG + Intronic
1082825041 11:57571423-57571445 CGAGCCACCGCACCTGGCCCAGG - Intergenic
1083343937 11:61976611-61976633 CAAGCCACTGGAGTTGGCCGAGG + Intergenic
1083543008 11:63527815-63527837 TGAGCCACTGCACCTGGCCTGGG - Intergenic
1083579536 11:63816047-63816069 TGAGCCACCGCACCTGGCCGTGG + Intronic
1083597521 11:63925533-63925555 TGAGCCACTGCACCTGGCCTTGG - Intergenic
1083698443 11:64457917-64457939 CAGACCCCTTCACCTGGCCAGGG + Intergenic
1083859831 11:65414152-65414174 CAAGCCACTGTGCCTGGCCTGGG - Intergenic
1083874033 11:65510655-65510677 TGAGCCACTGCACCTGGCCCGGG + Intergenic
1083893557 11:65608891-65608913 CAGGCCACTGCACCTGGCCGAGG + Intronic
1084113270 11:67027037-67027059 AAGGCCACTGCAGCTAGCCAGGG + Intronic
1084159784 11:67340895-67340917 TGAGCCACTGCACCTGGCCATGG + Intronic
1084175876 11:67421929-67421951 CACGCCACTGCACCCAGCCTGGG - Intronic
1084323387 11:68385772-68385794 CAGGCCCCAGCACCGTGCCGGGG - Intronic
1084340238 11:68493738-68493760 TGAGCCACTGCACCTGGCCAAGG + Intronic
1084684152 11:70684065-70684087 TGAGCCACTGCACCTGGCCCTGG + Intronic
1084928281 11:72532155-72532177 TGAGCCACCGCACCTGGCCGTGG + Intergenic
1085009266 11:73126056-73126078 TGAGCCACCGCACCTGGCCGTGG - Intronic
1085100085 11:73793347-73793369 TGAGCCACTGCACCTGGCCATGG + Intronic
1085364527 11:75927350-75927372 TGAGCCACTGCACCTGGCCAGGG + Intronic
1085694896 11:78695644-78695666 TGAGCCACTGCACCTGGCTGTGG + Intronic
1086108548 11:83173409-83173431 CAGGCCACTGCACTTAGGCCTGG + Intronic
1086639854 11:89140338-89140360 TGAGCCACTGCACCTGGCCCTGG - Intergenic
1087032636 11:93720878-93720900 TAAGCCACCGCACCTGGCCCTGG + Intronic
1087471818 11:98584892-98584914 TGAGCCACTGCACCTGGCCCAGG + Intergenic
1087754678 11:102042575-102042597 TGAGCCACTGCGCCTGGCCGTGG - Intergenic
1088272842 11:108052543-108052565 TGAGCCACTGCACCTGGCCCAGG + Intronic
1088321375 11:108557629-108557651 CGAGCCACTGCGCCTGGCCCTGG + Intronic
1088459399 11:110066843-110066865 TGAGCCACTGCACCTGGCCTAGG - Intergenic
1088571437 11:111227611-111227633 CATGCCACTGCACCCAGCCTGGG - Intergenic
1088677124 11:112205496-112205518 CATGCCACTGCACCCAGCCTGGG - Intronic
1089955576 11:122568091-122568113 TGAGCCACTGCACCTGGCCAAGG - Intergenic
1090161744 11:124502431-124502453 TGAGCCACTGCACCTGGCCATGG - Intergenic
1090268486 11:125369758-125369780 AAGCCCACTGCACCTTGCCCAGG - Intronic
1090695972 11:129242433-129242455 TGAGCCACTGCACCTGGCCTAGG - Intronic
1090824896 11:130378108-130378130 TGAGCCACTGCACCTGGCCAAGG - Intergenic
1092408625 12:8237860-8237882 TGAGCCACTGCACCTGGCCTAGG - Intergenic
1092614968 12:10208735-10208757 TGCGCCACTGCACCTGGCCCAGG - Intergenic
1093928409 12:24931187-24931209 TGAGCCACTGCACCTGGCCCAGG + Intronic
1093969267 12:25360050-25360072 CACGCCACTGCACTTGGGCCTGG - Intergenic
1094159601 12:27376715-27376737 TAAGCCACTGCGCCAGGCCGAGG - Intronic
1094758201 12:33496419-33496441 AAAGCCACTGCGCCTGGCCATGG - Intergenic
1094807114 12:34105552-34105574 CAGGCCCCTCCCCCTGCCCGGGG + Intergenic
1095462921 12:42461162-42461184 TGAGCCACTGCACCTGGCCTGGG + Intronic
1095519732 12:43049272-43049294 TAAGCCACTGCACCTAGCCAAGG + Intergenic
1095689584 12:45071648-45071670 TGAGCCACTGCACCCGGCCGTGG + Intergenic
1096299012 12:50409475-50409497 TGAGCCACTGCACCTGGCCCTGG - Intronic
1096379490 12:51144071-51144093 TATGCCACTGCACTTGGCCTGGG - Intronic
1096398719 12:51287622-51287644 TAAGCCACTGCACCCGGCCTAGG + Intronic
1096411465 12:51379736-51379758 CATGCCCCTGCGCCTGGCCATGG - Exonic
1096537462 12:52284471-52284493 TGAGCCACTGCACCTGGCCTAGG + Intronic
1097025923 12:56055480-56055502 TGAGCCACTGCACCTGGCAGTGG - Intergenic
1097028242 12:56074355-56074377 TGAGCCACTGCACCTGGCCCAGG + Intergenic
1097258382 12:57697760-57697782 CAGGAGACTGCACCAGGCAGAGG - Intronic
1097955231 12:65478603-65478625 CATGCCACTGCACTTAGCCTGGG - Intronic
1097955828 12:65484324-65484346 CAGGGTCCTGCACCTGGCCCAGG + Intronic
1098310838 12:69147648-69147670 TAAGCCACCGCGCCTGGCCGAGG - Intergenic
1098349814 12:69546672-69546694 TGAGCCACTGCACCTGGCCAAGG + Intronic
1098787333 12:74776364-74776386 GGAGCCACTGCACCTGGCCCTGG - Intergenic
1099034237 12:77565306-77565328 CAGGCCACTTCACCTTGCCTGGG + Intergenic
1099822150 12:87725908-87725930 CACGCCACTGCACCCAGCCTGGG + Intergenic
1100142116 12:91631886-91631908 TGAGCCACTGCACCTGGCCGAGG + Intergenic
1100484184 12:95008897-95008919 TGAGCCACTGCACCTGGCCAAGG - Intergenic
1100510311 12:95264718-95264740 CGAGCCCCTGCACCTGGCCAGGG + Intronic
1100523237 12:95396503-95396525 TGAGCCACTGCACCTGGCCAAGG + Intergenic
1100524815 12:95409451-95409473 TAAGCCACTGCACCTGACTGAGG - Intergenic
1100640111 12:96474400-96474422 CATGCCACTGCACTATGCCGCGG + Intergenic
1100642206 12:96492707-96492729 TAAGCCACTGCACCAGGCCAAGG - Intronic
1101232354 12:102754441-102754463 TAAGCCACTGCGCCTGGCCTTGG - Intergenic
1101327184 12:103726203-103726225 TGAGCCACTGCACCTGGCCTAGG - Intronic
1101489117 12:105195769-105195791 TGAGCCACTGCACCTGGCCCTGG - Intronic
1101709382 12:107250617-107250639 TGAGCCACTGCACCTGGCCAAGG + Intergenic
1101811514 12:108111944-108111966 TGAGCCACTGCACCTGGCCCTGG - Intergenic
1101900921 12:108790565-108790587 TGAGCCACTGCACCTGGCCCAGG + Intronic
1102179254 12:110899601-110899623 TGAGCCACTGCACCTGGCCAGGG + Intronic
1102511913 12:113421706-113421728 TGAGCCACTGCACCTGGCCAAGG - Intronic
1102690026 12:114753241-114753263 CAGCTCACTCCACCTGGCCCAGG - Intergenic
1102857596 12:116307583-116307605 TGAGCCACTGCACCCGGCCGAGG + Intergenic
1103377243 12:120466816-120466838 TAAGCCACTGCGCCTGGCCTTGG + Intronic
1103609107 12:122110568-122110590 TGAGCCACTGCACCTGGCCTGGG + Intronic
1103632922 12:122277239-122277261 TGAGCCACTGCACCTGGCCCAGG + Intronic
1103643898 12:122375598-122375620 TGAGCCACTGCACCTGGCCTTGG + Intronic
1103995167 12:124824939-124824961 TGAGCCACTGCACCTGGCCTGGG - Intronic
1104205331 12:126633099-126633121 TGAGCCACTGCACCTGGCCTTGG + Intergenic
1104432661 12:128729229-128729251 TGAGCCACTGCACCTGGCTGTGG - Intergenic
1104504858 12:129321840-129321862 TGAGCCACTGCACCCGGCCGAGG + Intronic
1104674418 12:130703097-130703119 CAGGTCACTGCAGCAGGCCAGGG + Intronic
1104815879 12:131645101-131645123 CAGGCCCCTGCCCCAGGCCCAGG - Intergenic
1104885306 12:132104050-132104072 CAGGCCACTGGACATGGCGCTGG - Exonic
1105517759 13:21105372-21105394 GCGGCCACTGCACCTAGCCTGGG + Intergenic
1105607122 13:21935221-21935243 CTGGCATCTGCACCTGGCCTCGG + Intergenic
1105830552 13:24160525-24160547 AGAGCCACTGCGCCTGGCCGGGG + Intronic
1106131053 13:26939720-26939742 TGAGCCACTGCACCTGGCCAGGG - Intergenic
1106159852 13:27191308-27191330 GTAGCCACTGCACCTGGCCCAGG + Intergenic
1106266549 13:28115146-28115168 AGAGCCACTGCACCTGGCCAAGG + Intergenic
1106269835 13:28141741-28141763 GGAGCCACCGCACCTGGCCGAGG + Intronic
1106311221 13:28556246-28556268 CAATCCACTGCACTTGGCCCAGG + Intergenic
1106379229 13:29220282-29220304 TGAGCCACTGCACCTGGCCCTGG + Intronic
1106919361 13:34547248-34547270 TGAGCCACTGCACCTGGCCCAGG - Intergenic
1107554591 13:41506822-41506844 TGAGCCACTGCACCTGGCCCTGG + Intergenic
1107936669 13:45351268-45351290 TGAGCCACTGCACCTGGCAGAGG + Intergenic
1107958383 13:45539175-45539197 TGAGCCACTGCACCTGGCCTGGG + Intronic
1108454788 13:50602140-50602162 TGAGCCACTGCACCTGGCCTGGG + Intronic
1109563365 13:64078721-64078743 CAGGCCACAGCTGCTGGCCGGGG - Intergenic
1110213799 13:73003996-73004018 TCAGCCACTGCACCTGGCCTGGG + Intronic
1110389307 13:74955771-74955793 TGAGCCACTGCACCTGGCCTGGG - Intergenic
1110507198 13:76300836-76300858 CACTCAGCTGCACCTGGCCGAGG - Intergenic
1110798700 13:79670125-79670147 CAAGCCACTGCACTTAGCCTGGG + Intergenic
1111402621 13:87761079-87761101 CAGGTCACTGCCCCTGGCCTAGG + Intergenic
1111530981 13:89537710-89537732 TGAGCCACTGCACCTGGCCCTGG + Intergenic
1112783038 13:102922983-102923005 CATGCCACTGCACCTGAGCCTGG - Intergenic
1113784799 13:112996804-112996826 CCGCCCACGGCACCTGGACGGGG + Intronic
1113835916 13:113328359-113328381 CAGGCGTCTGCACATGGCTGTGG + Intronic
1113853956 13:113433824-113433846 CAGGCCGATGCACATGGCCTTGG + Exonic
1114458998 14:22875145-22875167 CAGCCCTCTGCAGCTGCCCGGGG + Exonic
1114480094 14:23027858-23027880 TGAGCCACTGCGCCTGGCCGGGG - Intronic
1115204473 14:30887108-30887130 TGAGCCACTGCACCTGGCCAAGG - Intronic
1115327313 14:32154430-32154452 TGAGCCACTGCACCTGGCCCAGG + Intronic
1116842430 14:49832980-49833002 TGGGCCACTGCACCCGGCCCAGG - Intronic
1116875235 14:50105345-50105367 TGAGCCACTGCACCTGGCCTAGG - Intergenic
1116922502 14:50594709-50594731 TAAGCCACTGCACCCGGCCCTGG - Intronic
1117102407 14:52363919-52363941 CAAGCCACTGCACCCAGCCGAGG + Intergenic
1117361828 14:54982879-54982901 TGAGCCACTGCACCTGGCCCAGG - Intronic
1117398032 14:55330745-55330767 CACGCCACTGCACTCGGCCTGGG + Intronic
1117583500 14:57176761-57176783 CAGGCTACTGCGCCTAGCCAAGG - Intergenic
1117975099 14:61289421-61289443 TAAGCCACTGCACCTGGCCTTGG - Intronic
1118225279 14:63893273-63893295 CGAGCCACCGCACCTGGCCAAGG - Intronic
1118397655 14:65351204-65351226 CGCGCCACTGCACCTAGCCTGGG - Intergenic
1118485581 14:66211635-66211657 CAGGCCTCTGCAACTGGCTGTGG + Intergenic
1118557299 14:67039508-67039530 CAAGCCACTGCACCTGGCCTGGG - Intronic
1118989364 14:70783998-70784020 TGAGCCACTGCGCCTGGCCGTGG - Intronic
1119231884 14:72986602-72986624 CACGCCACTGCACCCAGCCTGGG - Intronic
1119241393 14:73063103-73063125 TGAGCCACTGCACCTGGCCCAGG + Intronic
1119249630 14:73140490-73140512 CGAGCCACTGCACCTGGCCAAGG + Intronic
1119382786 14:74239635-74239657 GAACCCAGTGCACCTGGCCGGGG - Exonic
1119458206 14:74774825-74774847 TGAGCCACTGCACCTGGCCGAGG + Intronic
1119501284 14:75129717-75129739 TGAGCCACTGCACCTGGCCAAGG + Intergenic
1119513178 14:75227658-75227680 CGTGCCACTGCACCTAGCCTGGG + Intergenic
1119515552 14:75245540-75245562 TGAGCCACTGCATCTGGCCGAGG - Intronic
1119839445 14:77780766-77780788 TGAGCCACTGCACCTGGCCAAGG + Intergenic
1120012722 14:79435676-79435698 CATGCCACTGCACTTAGCCTGGG - Intronic
1120877249 14:89386384-89386406 CAGGCCTCTGCGGCTGTCCGTGG - Intronic
1120890069 14:89483689-89483711 TGAGCCACTGCACCTGGCCTGGG + Intronic
1121110666 14:91310691-91310713 CGAGCCACTGCACCCGGCCTTGG + Intronic
1121194652 14:92059535-92059557 CAGGCCACCACACCCGGCCTTGG - Exonic
1122130037 14:99599604-99599626 TGAGCCACTGCACCTGGCCTTGG - Intronic
1122234881 14:100325863-100325885 AAGGCCCCTGCACCTGTCCACGG + Intronic
1122268082 14:100556058-100556080 CAGGCCACCCCTCCTGGCTGAGG - Intronic
1122597350 14:102902685-102902707 CAGGCCACAGCACCTGTGCGGGG - Intronic
1122760293 14:104019939-104019961 CTGGCCACTGCACCAGCCCGAGG - Intronic
1122953290 14:105057970-105057992 TAAGCCACCGCACCTGGCCTAGG + Intronic
1123052485 14:105552378-105552400 TGAGCCACTGCACCCGGCCGAGG + Intergenic
1123175166 14:106410017-106410039 CAGGACACTGACCCTGGCCCAGG + Intergenic
1123500143 15:20874543-20874565 CTAGCCACTGCACCTGGCTGAGG - Intergenic
1123557391 15:21448243-21448265 CTAGCCACTGCACCTGGCTGAGG - Intergenic
1123593616 15:21885494-21885516 CTAGCCACTGCACCTGGCTGAGG - Intergenic
1123973460 15:25530511-25530533 CATGCCACTGCACCCTGCCTGGG - Intergenic
1124004391 15:25784639-25784661 TGAGCCACTGCACCTGGCCAGGG - Intronic
1124110762 15:26783980-26784002 CATGCCACTGCACTTGGCCTGGG - Intronic
1124252492 15:28116048-28116070 CAGTCCTCAGCACGTGGCCGGGG + Intronic
1124574617 15:30896589-30896611 CACGCCACTGCACCCTGCCTGGG + Intergenic
1124780614 15:32628091-32628113 TGAGCCACTGCACCTGGCCAAGG + Intronic
1124937869 15:34189305-34189327 TGAGCCACTGCACCTGGCCCTGG + Intronic
1125124375 15:36202394-36202416 CACGCCACTGCACCCAGCCTGGG - Intergenic
1125812104 15:42550236-42550258 CGGGCCACTGCACTTAGCCTGGG + Intronic
1125846248 15:42857230-42857252 TGAGCCACTGCACCTGGCCCTGG - Intronic
1125880373 15:43188791-43188813 TAAGCCACTGCACCCGGCCTAGG - Intronic
1126034310 15:44533012-44533034 CATGCCACTGCACCCAGCCTGGG - Intergenic
1126150602 15:45520556-45520578 TGAGCCACTGCACCCGGCCGGGG + Intronic
1127072715 15:55301966-55301988 CAGGCCACTGCCCCCGGCCGTGG - Intronic
1127297468 15:57621493-57621515 TGAGCCACCGCACCTGGCCGGGG + Intronic
1127628551 15:60804004-60804026 TGAGCCACTGCACCTGGCCCTGG - Intronic
1127892991 15:63271286-63271308 CATGCCACTGCACCCAGCCTGGG + Intergenic
1127961415 15:63893648-63893670 CATGCCACTGCACTTAGCCTGGG - Intergenic
1128036386 15:64530012-64530034 TGAGCCACTGCACCTGGCCTTGG + Intronic
1128064136 15:64754025-64754047 TGAGCCACTGCACCTGGCCGAGG - Intronic
1128114331 15:65095872-65095894 GAGTCCAGTGCTCCTGGCCGAGG + Intronic
1128139093 15:65286429-65286451 CAGGTCACTGCGCGTTGCCGGGG + Exonic
1128351123 15:66890050-66890072 TGAGCCACTGCACCTGGCCCAGG - Intergenic
1128442842 15:67729485-67729507 TAAGCCACTGCACCTGGCCATGG - Intronic
1128750872 15:70148169-70148191 AGAGCCACTGCGCCTGGCCGAGG - Intergenic
1128924300 15:71640362-71640384 TGAGCCACTGCACCTGGCCTAGG + Intronic
1129020086 15:72509032-72509054 CAGGCCACTGCACCCAGCCTGGG - Intronic
1129044811 15:72725350-72725372 TGAGCCACTGCACCTGGCCTTGG + Intronic
1129058461 15:72839371-72839393 CACGCCACTGCACCTGCACCCGG + Intergenic
1129139239 15:73582120-73582142 CAAGACACTGCGCCTGGCCTTGG + Intronic
1129232299 15:74203474-74203496 CAGGCCACTGTCCCTGGTGGAGG + Intronic
1129386303 15:75198033-75198055 TGAGCCACTGCACCTGGCCAGGG + Intronic
1129446508 15:75622664-75622686 CAGAGCACTGGACCTGGCCTGGG - Intronic
1129532519 15:76280045-76280067 CACACCACTGCACCTGGCCTGGG + Intronic
1129537583 15:76326785-76326807 CATGCCACTGCACTTGGCCTGGG - Intergenic
1129622406 15:77160392-77160414 CGAGCCACTGAACCTGGCCAGGG - Intronic
1129666592 15:77582737-77582759 CAGCCCCCTGCAACTGGCCTAGG - Intergenic
1129854893 15:78816500-78816522 TAAGCCACGGCACCTGGCCAAGG + Intronic
1130001863 15:80054788-80054810 TAAGCCACCGCGCCTGGCCGAGG + Intergenic
1130104291 15:80917989-80918011 TGAGCCACTGCACCTGGCCCAGG - Intronic
1130137028 15:81190042-81190064 CAGGCCAGGGCCCCTGGCCAGGG + Intronic
1130614601 15:85392687-85392709 CACGCCACTGCACCTGGCTCTGG + Intronic
1131079812 15:89525519-89525541 TGAGCCACTGCACCTGGCCTTGG - Intergenic
1131082631 15:89549300-89549322 TGAGTCACTGCACCTGGCCGAGG + Intergenic
1131243044 15:90764796-90764818 CAAGCCACTGCGCCCGGCCTAGG - Intronic
1131429655 15:92376680-92376702 TGAGCCACTGCACCTGGCCCAGG - Intergenic
1132162691 15:99557477-99557499 TGAGCCACTGCACCTGGCCCTGG - Intergenic
1132288046 15:100679989-100680011 TAAGCCATTGCACCTGGCCGAGG + Intergenic
1132420940 15:101667875-101667897 TGAGCCACTGCACCTGGCCCTGG + Intronic
1132447295 15:101936038-101936060 CAAGCCATTGCACCTGACCCTGG - Intergenic
1202965737 15_KI270727v1_random:175416-175438 CTAGCCACTGCACCTGGCTGAGG - Intergenic
1132456264 16:24859-24881 CAGGCCACTGCATTTAGCCTGGG + Intergenic
1132465979 16:77685-77707 GAGGCCCCCGCCCCTGGCCGGGG - Intronic
1132542754 16:518940-518962 CAGGCTACAGCAACTGGACGAGG + Exonic
1132546746 16:536705-536727 TGAGCCACTGCACCTGGCCTGGG + Intronic
1132714061 16:1282021-1282043 TAAGCCACTGCGCCTGGCCTCGG - Intergenic
1133301389 16:4784824-4784846 TAAGCCACCGCACCTGGCCCTGG - Intronic
1133520059 16:6548790-6548812 CAAGCCACTGCACCCAGCCAAGG - Intronic
1133752974 16:8738926-8738948 TGAGCCACTGCACCTGGCCAAGG + Intronic
1133771962 16:8871878-8871900 TGAGCCACAGCACCTGGCCGTGG - Intergenic
1133794547 16:9035356-9035378 TGAGCCACTGCACCTGGCTGAGG + Intergenic
1133995517 16:10745039-10745061 TGAGCCACTGCACCTGGCCAAGG + Intronic
1134178576 16:12029027-12029049 TAAGCCACTGCGCCTGGCCTTGG + Intronic
1134357006 16:13491771-13491793 TGAGCCACTGCACCTGGCCTGGG + Intergenic
1134488761 16:14679805-14679827 CATGCCACTGCACCCAGCCTGGG + Intronic
1134489629 16:14686820-14686842 TGAGCCACTGCATCTGGCCGTGG - Intronic
1134569029 16:15275576-15275598 TGAGCCACTGCACCTGGCTGAGG - Intergenic
1134680269 16:16120183-16120205 CAGCCCAGTACACCTGGCCCAGG + Intronic
1134733406 16:16480784-16480806 TGAGCCACTGCACCTGGCTGAGG + Intergenic
1134768722 16:16785353-16785375 TAAGCCACTGCACCTAGCCTGGG + Intergenic
1134934093 16:18231498-18231520 TGAGCCACTGCACCTGGCTGAGG - Intergenic
1135094476 16:19554019-19554041 TGAGCCACTGCACCTGGCCCAGG - Intergenic
1135244575 16:20844619-20844641 CAGGCCTCTGCACCTAACCAAGG - Exonic
1135266434 16:21030355-21030377 CAGGCCACTTCACATGGCTTGGG - Intronic
1135292536 16:21252214-21252236 TGAGCCACTGCACCTGGCCTAGG + Exonic
1135582459 16:23640353-23640375 CCCGCCACTGCACCTGGCCTTGG - Intronic
1135783682 16:25328631-25328653 CAGGCCACTGCACTTGAGCCTGG + Intergenic
1135923141 16:26669146-26669168 TGAGCCACTGCACCTGGCCTAGG - Intergenic
1136017109 16:27407540-27407562 TGAGCCACCGCACCTGGCCGAGG - Intronic
1136254710 16:29030260-29030282 TGGGCCACTGCACCTGGCCCTGG + Intergenic
1136448745 16:30340202-30340224 CATGCCCCTGCACCTGGGCCAGG + Intergenic
1136466612 16:30448546-30448568 TGAGCCACTGCACCTGGCTGAGG + Intergenic
1136521118 16:30796457-30796479 TGAGCCACTGCACCTGGCCAGGG + Intergenic
1137254885 16:46766699-46766721 TGAGCCACTGCGCCTGGCCGAGG - Intronic
1137537919 16:49341577-49341599 CATGCCACTGCACTTAGCCTGGG + Intergenic
1137650055 16:50112147-50112169 GTGACCACTGCACCTGGCCCTGG - Intergenic
1137923379 16:52514726-52514748 TAAGCCACCGCACCTGGCCCTGG - Intronic
1138024900 16:53514705-53514727 TAAGCCACTGCACCTGGCCATGG - Intergenic
1138118659 16:54380594-54380616 TGAGCCACTGCACCTGGCCTAGG - Intergenic
1138126269 16:54441296-54441318 CACGCCACTGCACCCAGCCTGGG - Intergenic
1138388308 16:56651750-56651772 CAGGTCACTGCTCATGGCCCAGG + Intronic
1138394912 16:56696371-56696393 GAGGCCACCACACCTGGCCAAGG + Intronic
1138601140 16:58055309-58055331 TGAGCCACTGCGCCTGGCCGAGG - Intergenic
1138659661 16:58509656-58509678 CAGGACACGGCCCCTGGCCCTGG - Intronic
1139435007 16:66931599-66931621 CTTGCCACTGCACCTGGGCCTGG + Intergenic
1139460656 16:67119562-67119584 CACGCCACTGCACTCGGCCTGGG - Intronic
1139565005 16:67769156-67769178 TGAGCCACTGCTCCTGGCCGGGG - Intronic
1139873177 16:70124077-70124099 TGAGCCACTGCACTTGGCCGAGG - Intronic
1140252983 16:73310947-73310969 TGAGCCACTGCACCTGGCTGGGG - Intergenic
1140446578 16:75033861-75033883 TGAGCCACTGCACCTGGCCAAGG - Intronic
1141071672 16:80962051-80962073 TGAGCCACTGCACCTGGCCCTGG - Intergenic
1141106745 16:81240420-81240442 TGAGCCACCGCACCTGGCCGTGG - Intronic
1141179133 16:81740456-81740478 TGAGCCACTGCACCTGGCCAGGG - Intronic
1141262428 16:82466218-82466240 TCAGCCACTGCACCTGGCCTGGG - Intergenic
1141970058 16:87475266-87475288 TGAGCCACTGCACCTGGCCCTGG - Intronic
1142514892 17:421207-421229 TGAGCCACTGCACCTGGCCAGGG - Intronic
1142642165 17:1290577-1290599 TGAGCCACTGCTCCTGGCCGAGG + Intronic
1142976846 17:3649974-3649996 CAAGCCACTGCACCCAGCTGTGG - Intronic
1143016105 17:3892134-3892156 CAGGCCACAGGACCGGGCCTTGG - Intronic
1143207408 17:5153935-5153957 TGAGCCACTGCACCTGGCCCTGG + Intronic
1143217560 17:5236323-5236345 TGAGCCACTGCACCTGGCCAAGG + Intergenic
1143307319 17:5957809-5957831 TAAGCCACCGCACCTGGCCGAGG + Intronic
1143307480 17:5958911-5958933 TGAGCCACTGCACCTGGCCTAGG + Intronic
1143518856 17:7434300-7434322 CGCGCCACTGCACCCGGCCTGGG - Intergenic
1143646453 17:8233484-8233506 TGAGCCACTGCACCTGGCCTGGG - Intronic
1144248921 17:13396206-13396228 CAGGCCAGTGCAGCAGGCCCAGG + Intergenic
1144794749 17:17883449-17883471 TAAGCCACCGCACCTGGCCCAGG - Intronic
1144827501 17:18114533-18114555 TGAGCCACTGCACCTGGCCCTGG + Intronic
1144911340 17:18684623-18684645 TGAGCCACTGCACCCGGCCGAGG - Intergenic
1144942424 17:18951000-18951022 TGAGCCACTGCTCCTGGCCGAGG + Intronic
1145073558 17:19832309-19832331 CATGCCACTGCACCCAGCCTGGG - Intronic
1145210824 17:21011720-21011742 CAGGCCACCGGGCCTGGCCTGGG - Intronic
1145229707 17:21164541-21164563 CCGAACACCGCACCTGGCCGAGG - Intronic
1145234272 17:21197749-21197771 CAGGAGACTGCTCCTGGGCGGGG + Exonic
1145251548 17:21299396-21299418 TGAGCCACTGCACCTGGCCTGGG - Intronic
1145360507 17:22208183-22208205 TGAGCCACTGCACCTGGCCAGGG + Intergenic
1145861588 17:28215636-28215658 TAAGCCACTGCACCTGGCCAGGG + Intergenic
1145967642 17:28931538-28931560 TGAGCCACTGCACCTGGCTGAGG + Intronic
1146118528 17:30166637-30166659 TGAGCCACTGCACCTGGCCAGGG - Intronic
1146189643 17:30753510-30753532 TGAGCCACTGCACCTGGCCCTGG + Intergenic
1146334534 17:31957826-31957848 TGAGCCACTGCACCTGGCCCTGG + Intronic
1146334541 17:31957859-31957881 TGAGCCACTGCACCTGGCCCTGG + Intronic
1146353242 17:32113240-32113262 TAAGCCACTGCACCTGGCCATGG + Intergenic
1147237222 17:39066865-39066887 TGAGCCACTGCACCTGGCCAAGG + Exonic
1147304779 17:39555708-39555730 TAAGTCACTGCACCTGGCCATGG - Intronic
1147633882 17:41950657-41950679 TGAGCCACTGCGCCTGGCCGAGG + Intronic
1147880355 17:43649588-43649610 TGAGCCACTGCACCTGGCCTAGG + Intronic
1148025374 17:44583958-44583980 TGAGCCACTGCACCTGGCCCAGG + Intergenic
1148197015 17:45721281-45721303 TGAGCCACTGCACCTGGCCAAGG + Intergenic
1148202291 17:45757197-45757219 TGAGCCACTGCACCTGGCCCAGG - Intergenic
1148544661 17:48508345-48508367 TAAGCCACTGCACCCGGCCTTGG + Intergenic
1148599778 17:48885350-48885372 CAGGCCACTGCGCCTGGCCCGGG - Intergenic
1148740804 17:49891206-49891228 CAAGCCACTTGACCTGTCCGAGG + Intergenic
1148869828 17:50650780-50650802 TGAGCCACTGTACCTGGCCGGGG - Intronic
1148944878 17:51252440-51252462 TGAGCCACTGCACCTGGCCTCGG - Intronic
1149622467 17:58056085-58056107 TGAGCCACTGCACCTGGCCTGGG + Intergenic
1149688603 17:58554419-58554441 CAAGCCACTGCTCCTGGCCTGGG - Intergenic
1149690406 17:58570912-58570934 TAAGCCACTGCATCTGGCCTGGG + Intronic
1149705089 17:58687614-58687636 TGAGCCACTGCACCCGGCCGTGG + Intronic
1149872945 17:60199910-60199932 TGAGCCACTGCACCTGGCCCTGG - Intronic
1150078761 17:62217466-62217488 CAAGCCACTGCACCCAGCCTGGG - Intergenic
1150425840 17:65076326-65076348 TAAGCCACTGCGCCTGGCCAGGG - Intergenic
1150480233 17:65503682-65503704 AGGGCCACTGCTCCTGCCCGCGG + Intergenic
1150555419 17:66249808-66249830 CAAGCCACCGCACCTGGCCCAGG + Intronic
1150648566 17:66995148-66995170 CACGCCACTGCCCCGGGTCGTGG + Intronic
1150901445 17:69282485-69282507 TAAGCCACTGCGCCCGGCCGAGG - Intronic
1151068381 17:71178924-71178946 TGAGCCACCGCACCTGGCCGTGG - Intergenic
1151159372 17:72151785-72151807 CAGGCCACTGCCACCGGCTGAGG + Intergenic
1151289160 17:73136413-73136435 TGAGCCACTGCACCTGGCCCAGG + Intergenic
1151469199 17:74307381-74307403 TAGCCCACTGCACCTGGCCCAGG - Intronic
1151495496 17:74455699-74455721 CAGGCCACTGCAGCTGCTGGTGG - Intergenic
1151526025 17:74668777-74668799 TGAGCCACTGCACCTGGCTGTGG - Intergenic
1151639354 17:75378100-75378122 TGAGCCACTGCACCTGGCCTGGG - Intronic
1151732008 17:75917245-75917267 CAGGCCACTGTGCCTGGCTAAGG + Intronic
1151855033 17:76714930-76714952 TGAGCCACTGCACCTGGCCTTGG + Exonic
1151896009 17:76981451-76981473 TGAGCCACTGCACCTGGCCAGGG - Intergenic
1151918028 17:77133154-77133176 TGAGCCACTGCACCTGGCTGCGG + Intronic
1151939976 17:77286344-77286366 GAGGGCAATGCACCTGGCAGCGG + Intronic
1152876940 17:82791858-82791880 CAGGCCGCACCACCTGGCCTGGG - Intronic
1152876948 17:82791888-82791910 CGGGCCACACCACCTGGCCTGGG - Intronic
1153236968 18:2997408-2997430 TGAGCCACTGCACCTGGCAGAGG + Intronic
1153565593 18:6414695-6414717 CAGGCCCCTCTACCTGCCCGGGG + Intronic
1154283966 18:13034522-13034544 TAAGCCACTGCGCCCGGCCGAGG - Intronic
1154317927 18:13320705-13320727 CCTGCCATTGCACCTGGCAGCGG - Intronic
1154458752 18:14557466-14557488 CTAGCCACTGCACCTGGCTGAGG - Intergenic
1154933396 18:21025434-21025456 TGAGCCACTGCACCTGGCCCTGG - Intronic
1154987169 18:21563629-21563651 TGAGCCACTGCACCTGGCCTGGG + Intronic
1155196857 18:23483898-23483920 TGAGCCACTGCGCCTGGCCGAGG - Intronic
1155220826 18:23684158-23684180 TGAGCCACTGCACCTGGCTGGGG - Intergenic
1155278135 18:24210141-24210163 TGAGCCACTGCACCTGGCCCTGG - Intronic
1155384634 18:25263859-25263881 TAAGCCACAGCACCTGGCCTAGG + Intronic
1156238942 18:35232918-35232940 CAGGCCACTGCACATAGCCTGGG + Intergenic
1156463517 18:37334677-37334699 CAGGACACCTCTCCTGGCCGTGG - Intronic
1158397330 18:57089559-57089581 TGAGCCACTGCACCTGGCCAAGG + Intergenic
1158496031 18:57955887-57955909 TGAGCCACTGCACCTGGCCTGGG + Intergenic
1158993463 18:62893326-62893348 TGAGCCACTGCACCTGGCTGAGG + Intronic
1159144860 18:64441612-64441634 TAAGCCACTGCACCTGGCCTAGG - Intergenic
1159344296 18:67179352-67179374 CATGCCACTGCACCCAGCCTGGG - Intergenic
1160135611 18:76268739-76268761 TGAGCCACTGCGCCTGGCCGAGG + Intergenic
1160637981 19:96495-96517 CAAGCCATTGCACCTGACCCTGG + Intergenic
1160730846 19:641001-641023 CAGGCCTCTGCCCCGGCCCGAGG - Intronic
1161047488 19:2143802-2143824 TGAGCCACCGCACCTGGCCGAGG - Intronic
1161053058 19:2175447-2175469 TGGGCCACTGCATCTGGCCAAGG + Intronic
1161169362 19:2805291-2805313 CTGGCCACTGGGCCTGGCCAGGG - Intronic
1161607640 19:5223532-5223554 AAGGCCACTGCACCCAGCTGCGG + Intronic
1161691638 19:5738486-5738508 CATGCCACTGCACTCGGCTGGGG + Intronic
1161924297 19:7289687-7289709 TGAGCCACTGCACCCGGCCGAGG + Intronic
1162220030 19:9168512-9168534 CATGCCATTGCACTTGGCCTGGG - Intergenic
1162244837 19:9391195-9391217 TAAGCCACTGCGCCTGGCTGAGG - Intergenic
1162297743 19:9824982-9825004 TGAGCCACTGCACCTGGCCTTGG + Intronic
1162416608 19:10542104-10542126 TGAGCCACTGCACCTGGCCAGGG - Intergenic
1162462042 19:10819026-10819048 CAGCCCCTTGCCCCTGGCCGAGG + Intronic
1162475140 19:10895386-10895408 CAAGCCACTGTGCCTGGCCTAGG + Intronic
1162554624 19:11379035-11379057 TAAACCACTGCACCTGGCCATGG - Intronic
1162610569 19:11746982-11747004 TGAGCCACTGCACCTGGCCATGG - Intergenic
1162719379 19:12653115-12653137 TGAGCCACTGCACCTGGCCTGGG + Intronic
1162926946 19:13935608-13935630 TGAGCCACTGCACCCGGCCGAGG + Intronic
1163173079 19:15546298-15546320 TGAGCCACTGCACCTGGCCCAGG - Intronic
1163317940 19:16554393-16554415 TAAGCCACTGCGCCTGGCCAAGG - Intronic
1163325034 19:16598049-16598071 TGAGCCACTGCACCTGGCCAGGG - Intronic
1163416885 19:17192308-17192330 TGAGCCACTGCACCTGGCTGTGG - Intronic
1163625079 19:18384615-18384637 TGAGCCACTGCACCTGGCCAGGG + Intronic
1163642331 19:18468858-18468880 CAGGCCACTGCCTGTGGCCTGGG + Intronic
1163659889 19:18570553-18570575 CACGCCACTGCACCCAGCCTGGG - Intergenic
1163694333 19:18756048-18756070 TAAGCCACTGCACCTGGCCTAGG - Intronic
1163755491 19:19104194-19104216 TGAGCCACTGCACCTGGCCAGGG + Intronic
1163786890 19:19279415-19279437 CAGGCCACAGCACCGTGCCCTGG - Intronic
1163828812 19:19538191-19538213 CAGGCCACGCCCCCTGGCCCTGG - Intergenic
1164449476 19:28348042-28348064 TGGGCCACTGCGCCTGGCCGAGG + Intergenic
1164474639 19:28565967-28565989 CGAGCCACTGTACCTGGCCAGGG + Intergenic
1164530858 19:29047203-29047225 TGAGCCACTGCACCTGGCTGAGG + Intergenic
1164747828 19:30628984-30629006 TGGGCCACTGCGCCTGGCCCAGG + Intronic
1165011931 19:32854869-32854891 TGAGCCACTGCACCTGGCCTTGG + Intronic
1165076211 19:33281312-33281334 CAGGCCAAGGCACCTGGCCCAGG + Intergenic
1165197259 19:34114235-34114257 TGAGCCACTGCACCTGGCCAGGG - Intergenic
1165213100 19:34251174-34251196 TGAGCCACTGCACCTGGCCTTGG - Intergenic
1165306531 19:35006040-35006062 TGAGCCACTGCACCTGGCCATGG - Intronic
1165323271 19:35099346-35099368 CATGCCATTGCACTTGGCCTGGG + Intergenic
1165390552 19:35536294-35536316 TGAGCCACTGCGCCTGGCCGGGG - Intronic
1165443643 19:35844839-35844861 TGAGCCACTGCACCTGGCCTGGG - Intronic
1165455979 19:35910913-35910935 TGAGCCACTGCACCTGGCTGAGG - Intergenic
1165562855 19:36695548-36695570 CATGCCACTGCACCTGCACTGGG - Intronic
1165596049 19:37011911-37011933 CAGGCCACTGCTCCTCCCAGGGG + Intronic
1165741346 19:38206993-38207015 GAGGCCACTGCACCTGGGCTAGG + Exonic
1165757991 19:38305152-38305174 CAGGCCACCGCCCCAGGGCGTGG - Exonic
1165883331 19:39058943-39058965 TGAGCCACTGCACCTGGCCAAGG + Intergenic
1165919614 19:39287227-39287249 CATGCCACTGCACCCAGCCTGGG + Intergenic
1166266028 19:41685072-41685094 TAGGCCGCTGCACCTGGAGGAGG + Intronic
1166458857 19:42968489-42968511 CAGGCCACTGCACTTCACCCTGG - Intronic
1166534195 19:43561875-43561897 TGAGCCACTGCACCTGGCCCAGG - Intronic
1166751600 19:45166490-45166512 AAAGCCACTGCACCTGGCCATGG + Intronic
1166866390 19:45840378-45840400 TGAGCCACTGCACCTGGCCAGGG - Intronic
1166940777 19:46363710-46363732 TGAGCCACTGCACCTGGCCTCGG + Intronic
1166964138 19:46517729-46517751 CAAGCCACTGCACCCGGCCATGG - Intronic
1167014725 19:46833491-46833513 CAAGCCACTGAACCTGGCTTGGG - Intergenic
1167121485 19:47519985-47520007 AGAGCCACTGCACCTGGCCATGG + Intergenic
1167316549 19:48766678-48766700 TGAGCCACTGCACCTGGCCCTGG + Intergenic
1167433013 19:49464117-49464139 CAGGCCACGGCACCTGCAAGGGG - Exonic
1167619768 19:50554276-50554298 TGGGCCACCGTACCTGGCCGAGG + Intronic
1167681659 19:50926689-50926711 TGAGCCACTGCACCTGGCCCAGG + Intergenic
1168017938 19:53588364-53588386 TGAGCCACTGCACCTGGCCTAGG - Intergenic
1168672988 19:58255460-58255482 TGAGCCACTGCACCTGGCTGGGG + Intronic
925761851 2:7192428-7192450 CGGGCCACCACACCTGGCCCAGG - Intergenic
925977698 2:9152515-9152537 TGAGCCACTGCACCTGGCCAGGG - Intergenic
925981033 2:9177621-9177643 TGAGCCACTGCACCCGGCCGGGG - Intergenic
926034318 2:9623488-9623510 TGAGCCACTGCACCCGGCCGTGG - Intronic
926064032 2:9822948-9822970 TAAGCCACGGCACCTGGCCAGGG + Intergenic
926103116 2:10133298-10133320 CTGGCCACTGCAGCTGGGCAGGG - Intergenic
926147541 2:10405747-10405769 CAGGGCGCTGCTCCTGCCCGAGG - Intronic
926287538 2:11501675-11501697 TGAGCCACTGCACCTGGCCAAGG + Intergenic
926377541 2:12248621-12248643 TGAGCCACTGCACCCGGCCGGGG - Intergenic
926536698 2:14121981-14122003 TGAGCCACTGCACCCGGCCGTGG + Intergenic
926647559 2:15305728-15305750 TGAGCCACTGCACCTGGCCTGGG + Intronic
926663418 2:15493382-15493404 TGAGCCACTGCACCTGGCCGAGG - Intronic
926758644 2:16256790-16256812 CACGTCACTCCACCTGGCAGGGG + Intergenic
926832549 2:16979316-16979338 TGAGCCACTGCACCTGGCCAAGG - Intergenic
926957553 2:18318015-18318037 CATGCCACTGCACCCAGCCTTGG + Intronic
927194694 2:20539412-20539434 CTGGACACTGCCCCTGGCCTGGG - Intergenic
927516799 2:23676463-23676485 TGAGCCACCGCACCTGGCCGAGG + Intronic
927522009 2:23704481-23704503 TGAGCCACTGCACCTGGCCTTGG - Intronic
927749612 2:25655750-25655772 CAGGCCAGTGTACCTGGTAGGGG - Intronic
927779959 2:25931171-25931193 TGAGCCACTGCACCTGGCAGGGG - Intronic
927974527 2:27327907-27327929 TGAGCCACTGCACCTGGCCGAGG + Intronic
928345521 2:30490472-30490494 TGAGCCACTGCACCTGGCCCGGG + Intronic
928544243 2:32314388-32314410 TAAGCCACCGCACCTGGCCAAGG - Exonic
929139114 2:38651784-38651806 TGAGCCACTGCACCTGGCCCTGG - Intergenic
929412716 2:41715455-41715477 TGAGCCACTGCACCTGGCCTGGG - Intergenic
929518557 2:42626577-42626599 TGGGCCACCGCACCTGGCCTAGG + Intronic
929529008 2:42733781-42733803 TGAGCCACTGCACCTGGCCCAGG + Intronic
929601922 2:43210003-43210025 TGAGCCACTGCACCTGGCCATGG + Intergenic
929695660 2:44113152-44113174 TAAGCCACTGCACCTGGCCAGGG + Intergenic
930190407 2:48453235-48453257 TGAGCCACTGCACCTGGCCTAGG + Intronic
931209665 2:60180422-60180444 CAGGCCACTGATCCTCACCGAGG - Intergenic
931352673 2:61505987-61506009 AGGGCCACTGTACCTGGCCATGG - Intronic
931738738 2:65222771-65222793 TAAGCCACTGCACCTGGCCTAGG - Intergenic
932414269 2:71564393-71564415 CAGGCCCCTGCACCTAGTCTAGG + Intronic
932489827 2:72113627-72113649 CAGGCCTCAGCACCAGGCTGAGG - Intergenic
933102796 2:78281968-78281990 CAAGGCCCTGCACCTGGCCCAGG - Intergenic
933473212 2:82754805-82754827 TAAGCCACTGTACCTGGCCTTGG - Intergenic
933722115 2:85404465-85404487 TGAGCCACTGCACCTGGCCTTGG - Intronic
933795349 2:85915085-85915107 CAGGCCACTGCACCTCCCCCAGG + Intergenic
934049077 2:88195112-88195134 TGGGCCACTGCACCTGGCCTCGG - Intergenic
934073106 2:88403483-88403505 CATGCCACTGCACTTAGCCTGGG + Intergenic
934995631 2:98956116-98956138 TGAGCCACTGCACCTGGCCAAGG + Intergenic
935155240 2:100478735-100478757 CCTCCCACTGCACCTGGCCAAGG + Intronic
935257725 2:101327338-101327360 TGAGCCACTGCGCCTGGCCGAGG - Intergenic
936231878 2:110709648-110709670 TGAGCCACTGCACCTGGCCATGG + Intergenic
936349332 2:111701067-111701089 TAAGCCACCGCACCTGGCCTAGG + Intergenic
936652037 2:114438906-114438928 TAGGCCACTGCACCCGACCTTGG + Intergenic
936665234 2:114587012-114587034 TAAGCCACTGCACCCGGCCTAGG - Intronic
937012260 2:118573109-118573131 TAAGCCACTGCACCTGGCCGAGG - Intergenic
937133724 2:119534254-119534276 TGAGCTACTGCACCTGGCCGAGG + Intergenic
937145786 2:119643072-119643094 TGAGCCACTGCACCTGGCCTGGG + Intronic
937904216 2:127044994-127045016 CAGGCCACAGCAACTGGCTCAGG + Intergenic
938039257 2:128062307-128062329 TAAGCCACTGCACCGGGCCGAGG + Intergenic
938128718 2:128692977-128692999 TGAGCCACTGCACCTGGCCTGGG + Intergenic
938657449 2:133448681-133448703 CATGCCACTGCACTTGGCCTGGG - Intronic
938775068 2:134534466-134534488 TGAGCCACTGCACCTGGCCAAGG - Intronic
938826596 2:135011829-135011851 CATGCCACCACACCTGGCTGAGG + Intronic
938888279 2:135676525-135676547 CGAGCCACTGCACCTGGCCCTGG - Intronic
939355488 2:141096302-141096324 TGAGCCACTGCGCCTGGCCGAGG - Intronic
940002408 2:148979554-148979576 TGAGCCACTGCACCTGGCCTTGG + Intronic
940350112 2:152675419-152675441 CGAGCCACTCCACCTGGCCAAGG - Intronic
940360975 2:152795252-152795274 TGAGCCACTGCACCTGGCCTTGG + Intergenic
940740022 2:157496915-157496937 TAAGCCACTGCGCCTGGCCTAGG - Intergenic
940818470 2:158324198-158324220 TGAGCCACTGCACCTGGCCCAGG + Intronic
941219082 2:162752613-162752635 TGAGCCACTGCACCTGGCAGGGG - Intronic
941931616 2:170946284-170946306 TGAGCCACTGCACCTGGCCATGG + Intronic
942290665 2:174467214-174467236 TGAGCCACTGCACCTGGCCAAGG - Intronic
942331999 2:174836151-174836173 CAGGCCACAGCACATGGAGGGGG - Intronic
943066146 2:183088704-183088726 TGAGCCACTGCACCTGGCCAAGG + Intronic
944064069 2:195600785-195600807 TGAGCCACTGCACCTGGCCAGGG + Intronic
944349090 2:198705775-198705797 TGGGCTACTGCACCTGGCCAAGG - Intergenic
944982239 2:205134479-205134501 CATGCCACTGCATCTAGCCTGGG + Intronic
945055270 2:205862950-205862972 TAAGCCACTGCATCTGGCCATGG + Intergenic
945155047 2:206829420-206829442 TGAGCCACTGCACCCGGCCGAGG + Intergenic
945939469 2:215933586-215933608 TAAGCCACTGCACCTGGTCAAGG - Intergenic
945952186 2:216049932-216049954 TGAGCCACTGCACCTGGCCTGGG - Intronic
946211998 2:218154671-218154693 TAAGCCACTGCACCCGGCCTGGG + Intergenic
946396238 2:219445006-219445028 CGGGCCACGGCACCTGGGGGTGG + Exonic
946446323 2:219742645-219742667 TGAGCCACTGTACCTGGCCGAGG + Intergenic
946491559 2:220153745-220153767 CGAGCCACTGAACCTGGCCTAGG - Intergenic
946739530 2:222788133-222788155 TGGGCCACTGCGCCCGGCCGTGG + Intergenic
947219723 2:227780774-227780796 TGAGCCACTGCACCTGGCCCAGG + Intergenic
947429602 2:230014777-230014799 TGAGCCACTGCACCTGGCCTGGG - Intergenic
947514441 2:230789827-230789849 TAGGCCACAGCACCAGGACGGGG - Intronic
947747818 2:232518217-232518239 TGAGCCACTGCACCTGGCCTCGG - Intergenic
947820679 2:233067059-233067081 TGAGCCACTGCACCTGGCCCTGG + Intronic
947976104 2:234367792-234367814 TGAGCCACTGCACCTGGCCAGGG + Intergenic
948200598 2:236127377-236127399 CAGGACACTGCACCTGGTTTTGG - Exonic
948335580 2:237204616-237204638 TGAGCCACTGCATCTGGCCGTGG + Intergenic
948382208 2:237558727-237558749 TAAACCACTGCACCTGGCCTTGG + Intergenic
948519042 2:238524032-238524054 CAGGCCTCTGACCATGGCCGTGG - Intergenic
948610591 2:239163911-239163933 CTGGCCACGGCACCTGGCGTGGG + Exonic
948625739 2:239266858-239266880 AAGGCCACAGCACCTGGGTGTGG - Intronic
948851031 2:240705941-240705963 CGAGCCACTGCTCCTGGCTGGGG - Intergenic
948852088 2:240713441-240713463 CAGGCCACTGCACCCATCCCAGG - Intergenic
948895781 2:240926255-240926277 CTGCTCACAGCACCTGGCCGTGG + Intronic
948929496 2:241122930-241122952 CATGCAACTGCACCGGGCAGAGG + Intronic
1168766660 20:386145-386167 TGGGCCACTGCACCTAGCCTTGG + Intronic
1168833091 20:858121-858143 AGAGCCACTGCACCTGGCTGAGG + Intergenic
1169395913 20:5228965-5228987 TGAGCCACTGCACCTGGCCTAGG - Intergenic
1169456732 20:5758700-5758722 TGAGCCACTGCACCTGGCCTTGG + Intronic
1170493315 20:16900065-16900087 TGAGCCACTGCACCTGGCCTGGG - Intergenic
1170572807 20:17641980-17642002 CAGGCCTCTGCTCTTGTCCGGGG - Intronic
1170573008 20:17642926-17642948 GAGGCCACTGCAGCTGGCTAGGG - Intronic
1171100548 20:22379658-22379680 CAGGCAACTGCCCATGGCCCTGG + Intergenic
1171196775 20:23206053-23206075 CAGGCTCCTGCACCTGGTCAGGG - Intergenic
1171949493 20:31408060-31408082 TGAGCCACTGCACCTGGCCTAGG + Intronic
1172164417 20:32890231-32890253 CAGGCCACAGCACCTACCAGAGG - Intronic
1172164679 20:32891975-32891997 TGAGCCACTGCACCTGGCCTGGG + Intronic
1172334786 20:34106201-34106223 TAAGCCACCGCACCTGGCCAGGG + Intronic
1172535711 20:35671604-35671626 CAAGCCACCGCACCTGGCCCAGG - Intronic
1172965382 20:38830589-38830611 CAGGCCTCAGCTCCTGGCCTGGG - Intronic
1173859977 20:46277003-46277025 TAGGCCACTGCACCCGGCCTGGG - Intronic
1174076030 20:47937634-47937656 TGAGCCACTGCACCTGGCCAAGG - Intergenic
1174307030 20:49620494-49620516 CAGGTCACTGCTCCTGGCCAAGG + Intergenic
1174376786 20:50131335-50131357 TGAGCCACCGCACCTGGCCGAGG - Intronic
1174438669 20:50530985-50531007 CAAGCCACTGCACCTGGCCAAGG + Intronic
1174440909 20:50552543-50552565 TGAGCCACTGCACCTGGCTGAGG - Intronic
1174818872 20:53710487-53710509 CGAGCCACTGCACCCGGCCTTGG + Intergenic
1174945231 20:54977770-54977792 TAAGCCACTGTACCTGGCCGAGG - Intergenic
1175109009 20:56632938-56632960 TCAGCCACTGCACCTGGCCATGG - Intronic
1175284703 20:57830313-57830335 CAGCCAACTGCACATGGCTGGGG + Intergenic
1175618566 20:60424046-60424068 TGAGCCACCGCACCTGGCCGAGG + Intergenic
1175652124 20:60734501-60734523 CAGGCCTCTGCTGCTGGCAGTGG - Intergenic
1175705949 20:61176711-61176733 CATGCCACTGCACCCAGCCTGGG + Intergenic
1175924664 20:62465909-62465931 GAGGCCGCGGCACCTGGCAGGGG + Exonic
1176019009 20:62953160-62953182 CAGGACAATGCCCCTGGCCTGGG - Intronic
1176149644 20:63583495-63583517 CAGGCCACTGCGCCCAGCCTTGG - Intergenic
1176296432 21:5075825-5075847 CGGGCCAGTGCTCCTGTCCGGGG + Intergenic
1176454798 21:6898882-6898904 CACGCCTCTGCACATGGCTGTGG + Intergenic
1176511585 21:7752432-7752454 TGAGCCACTGCACCTGGCCGGGG - Intronic
1176693741 21:9949113-9949135 TGAGCCACTGCACCTGGCCCTGG + Intergenic
1176832971 21:13763930-13763952 CACGCCTCTGCACATGGCTGTGG + Intergenic
1177029321 21:15962846-15962868 TGAGCCACTGCAACTGGCCGGGG - Intergenic
1177258040 21:18691814-18691836 TGAGCCACTGCACCTGGCCTTGG - Intergenic
1177524241 21:22271489-22271511 TCAGCCACTGCACCTGGCTGGGG + Intergenic
1177570505 21:22879585-22879607 TGAGCCACTGCACCTGGCCTAGG + Intergenic
1177698915 21:24611085-24611107 CATGCCACTGCACTTAGCCTGGG - Intergenic
1178342152 21:31794761-31794783 TGAGCCACTGCACCTGGCCCAGG + Intergenic
1178557148 21:33602121-33602143 TGAGCCACTGCACCTGGCCAGGG + Intronic
1178645699 21:34382960-34382982 TGAGCCACTGCACCTGGCCGGGG - Intronic
1178685828 21:34709987-34710009 TGAGCCACTGCACCTGGCCAAGG - Intronic
1178931451 21:36822136-36822158 TGAGCCACTGCACCTCGCCGAGG - Intronic
1179491061 21:41741854-41741876 CAGCCTGCTGCACCTGGCGGTGG - Exonic
1179627775 21:42658264-42658286 CAGGCCTCTGCACCCTGCTGGGG + Intronic
1179773376 21:43642010-43642032 TGGGCCACTGCACCTGGCCCTGG - Intronic
1179792483 21:43763599-43763621 TGAGCCACTGCACCTGGCCAAGG - Intergenic
1179860617 21:44186296-44186318 CGGGCCAGTGCTCCTGTCCGGGG - Intergenic
1180076217 21:45464421-45464443 CTGACCACTGCAGGTGGCCGTGG - Intronic
1180155087 21:45973762-45973784 CAGGCCAATGCACGCGGCCCCGG + Intergenic
1180642926 22:17313870-17313892 TGAGCCACTGCACCTGGCCTAGG - Intergenic
1180658419 22:17444341-17444363 TGAGCCACTGCACCTGGCCAAGG - Intronic
1180672252 22:17562204-17562226 CATGCCACTGTACCTAGCCTGGG - Intergenic
1180912031 22:19457527-19457549 TGGGCCACCGCGCCTGGCCGAGG - Intronic
1181111055 22:20603199-20603221 TGAGCCACTGCACCTGGCCAGGG - Intergenic
1181135059 22:20759325-20759347 TAAGCCACTGCACCTGGCCTGGG + Intronic
1181184275 22:21091228-21091250 CACGCCACTGCACCCAGCCTGGG - Intergenic
1181237429 22:21456055-21456077 TGAGCCACTGCACCTGGCCATGG - Intergenic
1181274544 22:21680241-21680263 TGAGCCACTGCACCTGGCCTTGG - Intronic
1181660724 22:24346286-24346308 TGAGCCACTGCGCCTGGCCGTGG + Intronic
1181697050 22:24598834-24598856 TGAGCCACTGCACCTGGCCATGG + Intronic
1181745968 22:24955062-24955084 TGAGCCACTGCGCCTGGCCGGGG + Intronic
1181845821 22:25707952-25707974 TGAGCCACTGCGCCTGGCCGGGG - Intronic
1181934852 22:26430711-26430733 CAGGCCCCTGCACCCGGAGGTGG - Intronic
1182015419 22:27035266-27035288 TAAGCCACTGCTCCTGGCCTGGG + Intergenic
1182214284 22:28702828-28702850 TAAGCCACTGCACCTGGCCCTGG + Intronic
1182244401 22:28944192-28944214 TGAGCCACTGCACCTAGCCGGGG - Intronic
1182284854 22:29240094-29240116 TGAGCCACTGCACCTGGCCTAGG + Intronic
1182381227 22:29890187-29890209 TGAGCCACTGCACCTGGCCCAGG + Intronic
1182449105 22:30407850-30407872 TGAGCCACTGGACCTGGCCGAGG + Intronic
1182740820 22:32566124-32566146 TGAGCCACTGCACCTGGCCAGGG + Intronic
1182848352 22:33450193-33450215 TGAGCCACTGCACCTGGCCGAGG + Intronic
1183138422 22:35913188-35913210 CCAGCCACTGCAACTGGCCACGG - Intronic
1183380571 22:37488726-37488748 AAGGCCACTGCCACTGCCCGCGG + Intergenic
1183453733 22:37910441-37910463 CAGGACACTGCAACAGGGCGAGG - Intronic
1183554560 22:38515192-38515214 TGAGCCACTGCACCTGGCCCCGG - Intergenic
1184159749 22:42691267-42691289 TAAGCCACTGCACCTGGCCCAGG - Intergenic
1184215037 22:43061039-43061061 CACGCCACCACACCTGGCTGGGG - Intronic
1184497120 22:44848426-44848448 GAGGCCACTGCCCCTGCCTGCGG - Intronic
1184684613 22:46090491-46090513 GAGGCCACTGAACCTGGCCGTGG - Intronic
1185098888 22:48826938-48826960 TGAGCCACTGCACCTAGCCGGGG - Intronic
949590400 3:5488078-5488100 CAGCCCAGGGCACCTGGCTGAGG + Intergenic
949743450 3:7262978-7263000 TGAGCCACTGCACCTGGCCTGGG + Intronic
949926392 3:9045716-9045738 CAGGCCACTGCACCAGGCCCAGG + Intronic
949928625 3:9060952-9060974 CAGGCCAACGCTCCTGGCCAGGG - Intronic
949936712 3:9121530-9121552 CAGGCCAGTGCAGCTGGAGGGGG - Intronic
950248513 3:11443686-11443708 TGAGTCACTGCACCTGGCCGAGG + Intronic
950283060 3:11723294-11723316 TAAGCCACTGCGCCTGGCCTAGG - Intergenic
950293684 3:11809002-11809024 TGAGCCACTGCACCTGGCCTGGG + Intronic
950294116 3:11813244-11813266 TGAGCCACTGCACCTGGCCAAGG - Intronic
950699403 3:14729826-14729848 TGAGCCACTGCACCTGGCCTGGG + Intronic
950747542 3:15102426-15102448 CAGACCACAGCAGCTGGCAGAGG - Intergenic
950769822 3:15302409-15302431 CAGCCCAATGCACCAGGCCAGGG + Intronic
951131052 3:19045286-19045308 TGAGCCACTGCACTTGGCCGGGG + Intergenic
951544827 3:23813822-23813844 TGAGCCACTGCACCTGGCCTTGG + Intronic
951873803 3:27397297-27397319 CAAGCCACTGCACCTGGCCTGGG + Intronic
952249680 3:31639594-31639616 TGAGCCACTGCACCTGGCCTAGG + Intergenic
952369481 3:32707518-32707540 TGAGCCACCGCACCTGGCCGAGG - Intronic
952481281 3:33764334-33764356 TAAGCCACTGCACTTGGCCTTGG - Intergenic
952923019 3:38300154-38300176 TGAGCCACTGCACCTGGCCTTGG - Intronic
953144743 3:40264146-40264168 TAAGCCACTGCGCCAGGCCGAGG + Intergenic
953206322 3:40833292-40833314 CAAGCCACTGCACCATGCCTGGG - Intergenic
953807413 3:46082771-46082793 TTAGCCACTGCACCTGGCCTAGG + Intergenic
953946880 3:47156982-47157004 TGAGCCACTGCACCTGGCCCTGG - Intronic
954083853 3:48228564-48228586 TGAGCCACTGCACCTGGCCTTGG + Intergenic
954444590 3:50539903-50539925 CAGGCCTCTGGACCTGGGCAGGG + Intergenic
954575084 3:51671441-51671463 CAGGCCCTCGGACCTGGCCGAGG - Exonic
954962244 3:54576749-54576771 TGAGCCACTGCACCTGGCCCTGG - Intronic
955053705 3:55437641-55437663 TAAGCCACTGCACCTGGCCCAGG - Intergenic
955206721 3:56902695-56902717 CAGGCCAGTGAAGCTGGCCCTGG + Intronic
955360207 3:58267619-58267641 CATGCCACTGCACTTAGCCTGGG + Intronic
956379329 3:68649215-68649237 TGAGCCACTGCACCCGGCCGAGG - Intergenic
956663921 3:71624519-71624541 TGAGCCACTGCACCTGGCCCTGG - Intergenic
956853778 3:73256220-73256242 TAGGCCACTGCACCCAGCCCAGG - Intergenic
956922194 3:73941468-73941490 TAAGCCACTGCACCTGGCCAGGG + Intergenic
957287188 3:78231739-78231761 CAGTCCACTGGAACTGGCCTTGG - Intergenic
958001029 3:87749073-87749095 TGAGCCACAGCACCTGGCCGTGG + Intergenic
958128846 3:89391461-89391483 CACGCCACTGCACCCAGCCTGGG - Intronic
958264507 3:91422345-91422367 TGAGCCACTGCACCTGGCCTAGG - Intergenic
959648171 3:108726084-108726106 TAAGCCACCGCACCTGGCCTGGG - Intergenic
960107037 3:113808964-113808986 TGAGCCACTGCACCTGGCCCAGG - Intronic
960200806 3:114833813-114833835 TAAGCCACTGCACCTGGCCGAGG + Intronic
960377306 3:116918884-116918906 TAGGCCACCGTACCTGGCCATGG + Intronic
960712949 3:120549410-120549432 TGAGCCACTGCACCTGGCCTGGG - Intergenic
961444225 3:126971651-126971673 CATGCCACTGCACCTAGCTTTGG + Intergenic
961492139 3:127263576-127263598 CAGGTCACTGCACCTGGACCAGG - Intergenic
961548972 3:127656304-127656326 TGAGCCACTGCACCTGGCCTGGG - Intronic
961697539 3:128716174-128716196 CATGCCACTGCACCCAGCCTGGG - Intergenic
962356751 3:134700696-134700718 CAAGCAACTGCACCTGGACTAGG - Intronic
962825930 3:139101048-139101070 CAGCCCTCTGCACATGGACGTGG + Intronic
962847149 3:139282709-139282731 CAGGCCACATCTCCTGGCCAGGG - Intronic
963122638 3:141789096-141789118 TGAGCCACTGCACCTGGCCTAGG + Intronic
963241644 3:143009021-143009043 TGAGCCACTGCACCTGGCCCAGG + Intronic
964100861 3:152986648-152986670 CAGGCCACTGCACCTTTAAGGGG + Intergenic
964123694 3:153213625-153213647 CATGCCACTGTACCTGCCCCTGG + Intergenic
964722277 3:159779382-159779404 TGAGCCACTGCACCTGGCCGGGG - Intronic
964949821 3:162276529-162276551 TGAGCCACTGCTCCTGGCCGCGG + Intergenic
966312623 3:178611419-178611441 TGAGCCACTGCACCTGGCCTGGG - Intronic
966523973 3:180901257-180901279 TGTGCCACTGCACCTGGCCTTGG - Intronic
966614144 3:181896209-181896231 TGAGCCACTGCACCTGGCCAAGG + Intergenic
966737799 3:183202923-183202945 TGAGCCACTGCACCTGGCCTAGG - Intronic
966867214 3:184265443-184265465 TGAGCCACTGCACCTGGCCCTGG - Intronic
966933354 3:184690126-184690148 TGAGCCACTGCACCTGGCCCAGG + Intergenic
967020653 3:185519550-185519572 TGAGCCACTGCACCTGGCCCTGG - Intronic
967032470 3:185620724-185620746 GGAGCCACCGCACCTGGCCGAGG + Intronic
967071663 3:185967731-185967753 TGAGCCACTGCACCTGGCCCTGG - Intergenic
967108556 3:186273001-186273023 TAAGCCACCGCACCTGGCCAAGG + Intronic
967173768 3:186844426-186844448 TGAGCCACTGCGCCTGGCCGAGG + Intronic
967906138 3:194501889-194501911 CACGCCACTGCACCCAGCCTGGG + Intergenic
968224375 3:196964399-196964421 CGTGCCACTGCACCTAGCCTAGG - Intronic
968338343 3:197933178-197933200 TGAGCCACTGCACCTGGCCTGGG - Intronic
968687240 4:1969414-1969436 CACGCCATTGCACCTGGCTGGGG - Intronic
968785592 4:2619972-2619994 TGAGCCACTGCACCTGGCCTGGG + Intronic
968996696 4:3950332-3950354 AGAGCCACTGCACCTGGCCTAGG - Intergenic
970197321 4:13564472-13564494 TAAGCCACTGCACCCGGCCCCGG + Intergenic
970400239 4:15710249-15710271 CAGGCCACAGTACCTGGCCTTGG + Intronic
970428272 4:15965073-15965095 CGAGCCACTGCGCCTGGCCAAGG + Intronic
971299732 4:25431824-25431846 TAAGCCACTGCACCTGGCCCTGG + Intergenic
971423067 4:26491465-26491487 TGAGCCACTGCACCTGGCCTGGG + Intergenic
971695276 4:29894362-29894384 TGAGCCACTGCACCTGGCCTGGG - Intergenic
971730404 4:30371144-30371166 CATGCCACTGCACTTGGGCCTGG + Intergenic
971902687 4:32682369-32682391 CACGCCATTGCACCTAGCCTGGG + Intergenic
972328627 4:38042536-38042558 TCAGCCACTGCACCTGGCCTTGG + Intronic
972530519 4:39957506-39957528 CAGGCCACTGTGCCTGGCCCAGG - Intronic
972643067 4:40943006-40943028 CAGTCCTCTGCATCTGGCAGTGG - Intronic
973616045 4:52678898-52678920 CGAGCCACAGCACCTGGCCTGGG + Intergenic
973887466 4:55337564-55337586 TGAGCCACTGCACCTGGCCTAGG - Intergenic
973900048 4:55459935-55459957 AGAGCCACTGCACCTGGCCAAGG + Intronic
974036257 4:56821074-56821096 CAAGCCACTACACCTGGCCAAGG + Intronic
974391705 4:61278787-61278809 TGAGCCACTGCACCTGGCCGTGG + Intronic
974437548 4:61875900-61875922 TGAGCCACTGCACCTGGCCTGGG - Intronic
974447254 4:62001065-62001087 TGAGCCACTGCACCTGGCTGAGG + Intronic
975125986 4:70782564-70782586 TGAGCCACTGCACCTGGCCAAGG + Intronic
975646449 4:76550713-76550735 AAAGCCACTGCACCTGGCCATGG - Intronic
976150475 4:82086425-82086447 TGAGCCACCGCACCTGGCCGGGG - Intergenic
976436690 4:85026602-85026624 TGAGCCACTGCACCTGGCCTGGG - Intergenic
976578881 4:86710965-86710987 GATGCCACTGCACCTAGCCTAGG - Intronic
976633492 4:87263985-87264007 TGAGCCACTGCACCTGGCCAAGG + Intergenic
976651028 4:87434900-87434922 TAAGCCACTGCACCCGGCCTAGG + Intronic
976710382 4:88064607-88064629 TGAGCCACTGCCCCTGGCCGAGG - Intronic
976725176 4:88209027-88209049 TAAACCACTGCACCTGGCCAAGG - Intronic
976767224 4:88610169-88610191 TGAGCCACTGCACCTGGCCCAGG - Intronic
977113352 4:92988994-92989016 TGAGCCACTGCACCTGGCCAGGG - Intronic
977129530 4:93218216-93218238 GTAGCCACTGCACCTGGCCATGG - Intronic
977244256 4:94611932-94611954 TGAGCCACTGCACCTGGCCCAGG - Intronic
977316165 4:95450487-95450509 TAAGCCACTGCACCTGGCCTTGG + Intronic
977532371 4:98215674-98215696 TGAGCCACTGCACCTGGCCTTGG - Intergenic
977663300 4:99616108-99616130 TGAGCCACTGCACCTGGCCTGGG - Intronic
977917166 4:102607256-102607278 CACAGCACTGCACCTGGCTGTGG + Exonic
978041083 4:104063100-104063122 CATGCCACTGCACCTGGTTTAGG + Intergenic
978354840 4:107860806-107860828 TGAGCCACTGCACCTGGCCAAGG + Intronic
979619670 4:122784832-122784854 TGAGCCACTGCACCTGGCTGAGG - Intergenic
979653403 4:123163150-123163172 TGAGCCACTGCACCTGGCCCAGG - Intronic
980404273 4:132336427-132336449 CATGCCACAGCACCTAGCCTGGG - Intergenic
980825671 4:138069757-138069779 TAAGCCACTGCACCTGGCTGTGG - Intergenic
980900496 4:138900708-138900730 TGAGCCACTGCACCTGGCCTGGG - Intergenic
981244064 4:142513688-142513710 TGAGCCACTGCACCTGGCCTGGG + Intronic
981416554 4:144500575-144500597 TGAGCCACTGCACCTGGCCAAGG - Intergenic
981472370 4:145151350-145151372 TGAGCCACTGCACCTGGCCTTGG - Intronic
981545562 4:145889691-145889713 TGAGCCACTGCACCCGGCCGTGG - Intronic
982033004 4:151319331-151319353 TAAGCCACTGTACCTGGCCCAGG + Intronic
982196448 4:152920228-152920250 TGAGCCACTGCACCTGGCCTGGG + Intergenic
982884616 4:160763007-160763029 TAAGCCACTGCTCCTGGCCCTGG + Intergenic
983226230 4:165088753-165088775 TGAGCCACTGCACCTGGCCTGGG - Intronic
983533332 4:168832784-168832806 CCGGGCACAGCACCCGGCCGGGG - Intronic
983621999 4:169771881-169771903 TGAGCCACTGCACCTGGCCTGGG - Intergenic
983915156 4:173283591-173283613 CATGCCACTGCACTCGGCCTGGG + Intronic
983939182 4:173523437-173523459 CAGGCCCTTGCAACTGGCCCGGG + Intergenic
985077010 4:186225715-186225737 TGAGCCACTGCACCTGGCCGAGG + Intronic
985225296 4:187753496-187753518 TGAGCCACTGCGCCTGGCCGGGG + Intergenic
985941645 5:3141025-3141047 TGAGCCACCGCACCTGGCCGAGG - Intergenic
986528527 5:8708347-8708369 CATGCCACTGCACCCAGCCTGGG - Intergenic
987125976 5:14813195-14813217 CAGGCCACTGCACCTCAGCCTGG + Intronic
987812595 5:22857460-22857482 TGAGCCACTGCACCTGGCCCTGG - Intergenic
988164207 5:27561965-27561987 TGGGCCACTGCGCCTGGCCTAGG - Intergenic
988349742 5:30086458-30086480 TGAGCCACTGCACCTGGCCCAGG + Intergenic
988517338 5:31916379-31916401 CAGGCCTCTACACCTGACTGTGG - Intronic
988959136 5:36351499-36351521 TAAGCCACTGCACCCGGCTGAGG + Intergenic
989016554 5:36942147-36942169 TGAGCCACTGCACCTGGCCAGGG - Intronic
989038133 5:37196879-37196901 CATGCCACTGCACCCAGCCTGGG + Intronic
989054227 5:37351488-37351510 CGGGCCACTGCACCCAGCCTGGG - Intronic
989637227 5:43549215-43549237 CAGGCCACTGCGCCTGGCCCAGG + Intronic
991068140 5:62446683-62446705 TGAGCCACTGCACCTGGCCTAGG - Intronic
991395058 5:66196666-66196688 TGAGCCAGTGCACCTGGCCGAGG + Intergenic
991728935 5:69563495-69563517 GGAGCCACTGCACCTGGCCCTGG + Intronic
991918362 5:71628125-71628147 TGAGCCACTGCACCTGGCCAAGG + Intronic
992432796 5:76726104-76726126 TAAGCCACTGCACCTGGCCAAGG - Intronic
992631735 5:78688154-78688176 TGAGCCACTGCACCTGGCCAAGG - Intronic
993722829 5:91338455-91338477 TGAGCCACTGCACCTGGCCCTGG + Intergenic
994171427 5:96662680-96662702 CAGCGCACTGGACCCGGCCGGGG - Intronic
995143888 5:108764678-108764700 TGAGCCACTGCACCTGGCCGTGG + Intronic
995294147 5:110499333-110499355 CAGGCCTCTGCACTCAGCCGGGG - Intronic
995450247 5:112291957-112291979 TGAGCCACTGCTCCTGGCCGAGG - Intronic
995531716 5:113097804-113097826 TGAGCCACCGCACCTGGCCGAGG + Intronic
995591294 5:113702491-113702513 CATGCCACTGCACCCAGCCTGGG + Intergenic
995770319 5:115662815-115662837 CAAGCCACTGTGCCTGGCCCTGG + Intergenic
995779602 5:115761564-115761586 CAAGCCACCGCACCTGGCCCAGG - Intergenic
995876650 5:116797058-116797080 TAAGCCACTGCACCCGGCCTGGG + Intergenic
996007738 5:118443474-118443496 TGAGCCACTGTACCTGGCCGAGG - Intergenic
996573192 5:124954678-124954700 CAAGCCACTGCACCCGGCCCGGG + Intergenic
996774769 5:127121374-127121396 CAGGGACCTGCACCTGGCCCAGG + Intergenic
997099242 5:130950126-130950148 TGAGCCACTGAACCTGGCCGGGG - Intergenic
997203814 5:132029399-132029421 TTAGCCACTGCACCTGGCCTAGG + Intergenic
997968724 5:138382764-138382786 TGAGCCACTGCACCTGGCCAGGG + Intronic
998548051 5:143048630-143048652 TGAGCCACTGCACCTGGCCTGGG - Intronic
998626287 5:143850066-143850088 CATGCCCCTGCACCTGACCTAGG - Intergenic
998832570 5:146175496-146175518 CATGCCACTGCACCCAGCCTAGG + Intronic
998872618 5:146567748-146567770 TGAGCCACTGCACCTGGCCGTGG + Intergenic
1000002696 5:157154171-157154193 TCAGCCACTGCACCTGGCCTAGG - Intronic
1000366018 5:160492123-160492145 TGAGCCACTGCACCTGGCCTGGG + Intergenic
1001011941 5:168106775-168106797 TGAGCCACTGCACCTGGCCAGGG - Intronic
1001014789 5:168130612-168130634 TGAGCCACTGCACCTGGCCTAGG - Intronic
1001390729 5:171377103-171377125 CACGCCACCACACCTGGCCCTGG + Intergenic
1001628443 5:173156596-173156618 CATGTGACTGCACCTGGCCTAGG + Intronic
1001887197 5:175303582-175303604 TGAGCCACTGCACCTGGCCAGGG + Intergenic
1002005643 5:176231959-176231981 TAAGCCACTGCACCTGACCCGGG - Intergenic
1002113389 5:176937211-176937233 TGAGCCACCGCACCTGGCCGAGG - Intronic
1002220737 5:177678662-177678684 TAAGCCACTGCACCTGACCCGGG + Intergenic
1002309984 5:178308585-178308607 CAGGCCCATGCTCCTGGCCGAGG + Intronic
1002436889 5:179236969-179236991 TAAGCCACTGCACCTGGCCATGG - Intronic
1002451889 5:179323479-179323501 CAGGCCACAGCACTTGCCAGGGG + Intronic
1002911223 6:1492340-1492362 CACGCCACTGCACCCAGCCCTGG + Intergenic
1003058803 6:2846383-2846405 CAAGCCACCGCGCCTGGCCAGGG + Intergenic
1003080931 6:3021015-3021037 CATGCCACTGCACCCAGCTGGGG - Intergenic
1003194611 6:3903734-3903756 TGAGCCACTGCACCTGGCCTTGG - Intergenic
1003527570 6:6910709-6910731 TGAGCCACTGCACCCGGCCGGGG + Intergenic
1003697475 6:8424541-8424563 TGAGCCACTGCACCTGGCCGGGG + Intronic
1004076366 6:12347521-12347543 TGGGCCACTGCGCCTGGCCCAGG - Intergenic
1004224670 6:13774593-13774615 TGAGCCACTGCACCTGGCCAGGG + Intergenic
1004437762 6:15613647-15613669 TGAGCCACTGCACCTGGCCAAGG + Intronic
1005045501 6:21638360-21638382 TGAGCCACTGCACCTGGCCCAGG + Intergenic
1005061386 6:21780004-21780026 TAAGCCACTGCACTTGGCCCAGG + Intergenic
1005271781 6:24172940-24172962 CATGCCACTGCACCCAGCCTGGG + Exonic
1005757154 6:28935098-28935120 TGAGCCACTGCACCTGGCCTAGG + Intergenic
1005837850 6:29721104-29721126 CATGCCACTGCACTTCACCGTGG + Intergenic
1006013904 6:31065554-31065576 TGAGCCACTGCACCTGGCCTAGG + Intergenic
1006355704 6:33556207-33556229 TAAGCCACCGCACCTGGCTGAGG - Intergenic
1006678750 6:35782033-35782055 TAAGCCACCGCACCTGGCCAGGG + Intronic
1008250149 6:49229843-49229865 TGAGCCACTGCACCTGGCCGAGG + Intergenic
1008826229 6:55697610-55697632 TAAGCCACCGCACCTGGCCTGGG - Intergenic
1008964499 6:57300737-57300759 TGAGCCACTGCACCCGGCCGGGG - Intergenic
1008990934 6:57600637-57600659 TGAGCCACTGCACCTGGCCTAGG + Intronic
1009179456 6:60498878-60498900 TGAGCCACTGCACCTGGCCTAGG + Intergenic
1009444451 6:63724088-63724110 TATGCCACTGCACCTGGCCTTGG + Intronic
1010211650 6:73366993-73367015 TGAGCCACTGCACCTGGCCCTGG - Intergenic
1010315453 6:74443337-74443359 AAGGCCATTGCACCTGGCCATGG + Intergenic
1011256139 6:85423104-85423126 TGAGCCACTGCACCTGGCCCAGG - Intergenic
1011258714 6:85450184-85450206 CAGGCCACAGCACCGCGCCCAGG - Exonic
1011274981 6:85622086-85622108 GAGGCTATTGCACCTGGCCCTGG - Intronic
1011632734 6:89343151-89343173 TGAGCCACTGCACCCGGCCGAGG - Intronic
1011673277 6:89704861-89704883 TGAGCCACCGCACCTGGCCGTGG + Intronic
1012035408 6:94131716-94131738 CATGCCACTGCACTTAGCCTGGG - Intergenic
1012745911 6:103088448-103088470 TGAGCCACTGCACCTGGCCCAGG + Intergenic
1013240740 6:108243252-108243274 CAAACCACTGCACCTGGCTGGGG + Intronic
1013285580 6:108678744-108678766 CACGCCAATGCACCTGGCTTAGG - Intronic
1013495275 6:110691494-110691516 TAAGCCACTGCACCTGGCCTAGG - Intronic
1014073567 6:117211180-117211202 TAAGCCACTGCACCCGGCCTGGG + Intergenic
1014513096 6:122348981-122349003 TGAGCCACTGCACCTGGCCTAGG - Intergenic
1015182238 6:130372475-130372497 CAGGCCATGGCAGCTGGCAGAGG - Intronic
1015585302 6:134770336-134770358 TGAGCCACTGCACCTGGCCGGGG - Intergenic
1016045807 6:139479146-139479168 TGAGCCACCGCACCTGGCCGGGG + Intergenic
1016081518 6:139862856-139862878 TGAGCCACTGCACCTGGCCATGG - Intergenic
1017175700 6:151502884-151502906 TGAGCCACCGCACCTGGCCGCGG - Intronic
1017291740 6:152745312-152745334 TGAGCCACTGCACCTGGCAGAGG - Intergenic
1017811961 6:157990026-157990048 CAGCCCACAGGACCTGGCCGGGG - Intronic
1018074300 6:160197378-160197400 TGAGCCACCGCACCTGGCCGAGG + Intronic
1018570380 6:165203817-165203839 TGAGCCACTGCACCCGGCCGAGG - Intergenic
1018682180 6:166273656-166273678 TAAGCCACTGCGCCTGGCCTCGG + Intergenic
1019477414 7:1250711-1250733 CGAGCCACTGTACCTGGCCGGGG + Intergenic
1019561440 7:1660861-1660883 TGAGCCACTGCACCCGGCCGGGG - Intergenic
1019565484 7:1676751-1676773 AAGGCCAGTGCAGCTGGCCGTGG + Intergenic
1019569245 7:1702139-1702161 TGAGCCACTGCACCCGGCCGAGG - Intronic
1019722257 7:2580015-2580037 TCAGCCACTGCACCTGGCTGAGG + Intronic
1019803941 7:3108733-3108755 AAAGCCACTGCGCCTGGCCAAGG + Intergenic
1020068111 7:5205257-5205279 CGAGCCACTGCACCCGGCCCTGG + Intronic
1020112806 7:5457045-5457067 TGAGCCACTGCACCTGGCCTAGG + Intronic
1020131921 7:5563500-5563522 CTGGCCCCTGCACCTGGGAGAGG + Intronic
1020273877 7:6613619-6613641 TAAGCCACTGCGCCTGGCCCGGG + Intergenic
1020555273 7:9663203-9663225 TGAGCCACTGCACCTGGCCCAGG - Intergenic
1020683242 7:11262182-11262204 TGAGCCACTGCACCTGGCCCAGG + Intergenic
1020851522 7:13359777-13359799 ATGGCCACGGCACCTGGCCTAGG + Intergenic
1021629428 7:22629939-22629961 CAGGCCACCTCACCAGGCAGTGG - Intronic
1023124624 7:36943151-36943173 CTGGCCACTGCAGCGGGTCGAGG + Intronic
1023175399 7:37431051-37431073 GGAGCCACTGCACCTGGCCAAGG - Intronic
1023356504 7:39372202-39372224 TGAGCCACTGCACCTGGCCAAGG + Intronic
1023463904 7:40432402-40432424 TAAGCCACCGCACCTGGCCAAGG - Intronic
1023800801 7:43832691-43832713 TGAGCCACTGCACCTGGCCTGGG - Intergenic
1023882350 7:44327523-44327545 TGAGCCACTGCACCCGGCCGAGG + Intronic
1023918626 7:44609220-44609242 TAAGCCACTGCGCCTGGCCAAGG - Intronic
1023976071 7:45031097-45031119 TAAGCCACTGCACCTGGGCAAGG - Intronic
1024244953 7:47462399-47462421 TAAGCCACTGCGCCTGGCCGAGG + Intronic
1024275502 7:47673789-47673811 TAAGCCACTGCACCTGGCCCGGG - Intergenic
1024481600 7:49868900-49868922 TGAGCCACTGCACCTGGCCTGGG + Intronic
1024748334 7:52432342-52432364 TGCGCCACTGCACCTGGCCGAGG + Intergenic
1024981767 7:55163073-55163095 TAAGCCACTGCACCTAGCCAAGG + Intronic
1025705961 7:63864195-63864217 TGAGCCACTGCACCTGGCCAGGG + Intergenic
1025908074 7:65804444-65804466 CAAGCCACTGTGCCTGGCCAAGG + Intergenic
1026017541 7:66682686-66682708 CAGACCACAGCCCCCGGCCGCGG + Intronic
1026025587 7:66741240-66741262 CAGACCACAGCCCCCGGCCGCGG + Intronic
1026056001 7:66984289-66984311 CAGGCCACTGCACTCAGCCTAGG - Intergenic
1026063258 7:67045697-67045719 CAGGCCACTGCAGCTTGGCGAGG + Intronic
1026586277 7:71658602-71658624 TGAGCCACCGCACCTGGCCGAGG - Intronic
1026594240 7:71721040-71721062 TGAGCCACTGCACCTGGCCGAGG - Intergenic
1026715087 7:72781800-72781822 CAGACCACTGCAGCTTGGCGAGG - Intronic
1026836653 7:73644179-73644201 TGAGCCACTGCACCTGGCTGAGG + Intergenic
1026910321 7:74087871-74087893 TGAGCCACTGCACCTGGCCTCGG + Intronic
1026974292 7:74487318-74487340 TGAGCCACTGCACCTGGCCAGGG + Intronic
1027330069 7:77083091-77083113 TGAGCCACTGCACCTGGCCAAGG - Intergenic
1027333571 7:77124907-77124929 TGAGCCACTGCACCTGGCCAGGG - Intronic
1027401364 7:77811183-77811205 TGAGCCACTGCACCTGGCCCTGG + Intronic
1027441284 7:78221707-78221729 TGAGCCACTGCACCTGGCCTTGG - Intronic
1028447748 7:90944447-90944469 TGGGGCACTGCACCTGGCCATGG - Intronic
1028576502 7:92357957-92357979 TGAGCCACTGCACCTGGCCGAGG - Intronic
1028612700 7:92730025-92730047 TGAGCCACTGCACCTGGCCTGGG + Intronic
1028719070 7:94008454-94008476 CAGGCCCCTGAACCTGGCCCTGG + Intergenic
1028844619 7:95465775-95465797 AGTGCCACTGCACCTGGCCTTGG - Intergenic
1029089093 7:98034137-98034159 TGAGCCACTGCACCTGGCCCAGG + Intergenic
1029198545 7:98823464-98823486 TAAGCCACTGCACCTGGCCTAGG - Intergenic
1029300256 7:99577308-99577330 TGAGCCACTGCACCTGGCCTGGG - Intronic
1029359023 7:100074748-100074770 TGAGCCACTGCACCTGGCCTAGG - Intronic
1029509513 7:100985141-100985163 TGAGCCACTGCACCTGGCCAAGG + Intronic
1029515852 7:101022539-101022561 TGAGCCACTGCACCTGGCCTGGG - Intronic
1029631189 7:101751645-101751667 TGAGCCACTGCACCTGGCCAGGG + Intergenic
1029782223 7:102746417-102746439 TGAGCCACTGCACCTGGCCAGGG + Intergenic
1030169879 7:106590267-106590289 GGGGCCACTGCCCCTGGCCTAGG + Intergenic
1030876351 7:114817868-114817890 TGAGCCACCGCACCTGGCCGAGG + Intergenic
1031085096 7:117294805-117294827 TGAGCCACTGCACCTGGCTGTGG - Intronic
1031981370 7:128127941-128127963 TGAGCCACTGCACCTGGCCCAGG + Intergenic
1032211758 7:129921653-129921675 CACGCCACTGCATCTAGCCTGGG + Intronic
1032214639 7:129948527-129948549 GAGCCCAGTGCACCTGGCCCAGG - Intronic
1032247481 7:130225269-130225291 TGAGCCACTGCACCTGGCCAGGG - Intergenic
1032397181 7:131599045-131599067 TGAGCCACTGCACCTGGCCTTGG - Intergenic
1032679009 7:134162541-134162563 TGAGCCACTGCACCTGGCCGTGG - Intronic
1032827283 7:135583431-135583453 CAAGCCACTGCACCCAGCTGAGG + Intronic
1033090746 7:138383910-138383932 TGAGCCACTGCACCTGGCCTAGG - Intergenic
1033152189 7:138925067-138925089 CAGGCACCTGCACCTCGCCCTGG + Intronic
1033201256 7:139372654-139372676 GGAGCCACTGCACCCGGCCGAGG - Intronic
1033955450 7:146842168-146842190 TGAGCCACTGCACCTGGCCTTGG + Intronic
1034402162 7:150869715-150869737 TGAGCCACTGCACCTGGCCTTGG - Intergenic
1034515925 7:151579303-151579325 TGAGCCACTGCACCTGGCCAGGG + Intronic
1034897779 7:154888506-154888528 GAGGCCAGAGCTCCTGGCCGAGG + Intronic
1035081803 7:156222383-156222405 CAGGCTTGTGCACCTGGCTGGGG + Intergenic
1035681415 8:1491320-1491342 CAGGCCGCTGCTCCTGACCCCGG + Intergenic
1036054422 8:5235073-5235095 GAAGCCACTGCGCCTGGCCTTGG + Intergenic
1037337659 8:17807318-17807340 TGAGCCACTGCACCTGGCCCTGG + Intergenic
1037724874 8:21474760-21474782 TGAGCCACTGCACCTGGCCAAGG - Intergenic
1037761053 8:21741876-21741898 CATGCCACTGCACCCAGCCTGGG + Intronic
1038344037 8:26715588-26715610 TAAGCCACTGCACCCGGCCATGG + Intergenic
1038599541 8:28926013-28926035 TAAGCCACCGCACCTGGCCCAGG - Intronic
1038766017 8:30428302-30428324 TGAGCCACTGCACCTGGCCATGG + Intronic
1038832927 8:31082805-31082827 TGAGCCACTGCACCTGGCCTTGG + Intronic
1039497505 8:37992040-37992062 TGAGCCACTGCACCTGGCCCAGG - Intergenic
1039566066 8:38553520-38553542 CAGGCCCCTGCACCTGGGGTTGG + Intergenic
1039584025 8:38690496-38690518 CAAGCCACTGCACCTGGCTAGGG + Intergenic
1039619449 8:38983251-38983273 TGAGCCACTGCACCTGGCCTGGG - Intronic
1040482118 8:47835804-47835826 CACGCCACTGCACCCTGCCTTGG - Intronic
1040488383 8:47896362-47896384 TCAGCCACTGCACCTGGCCTGGG - Intronic
1040691976 8:49949854-49949876 TGGGCCACTGCGCCTGGCCAAGG - Intronic
1040847852 8:51863497-51863519 TGAGCCACTGCACCTGGCCTGGG - Intronic
1041220286 8:55644165-55644187 TGAGCCACTGCACCTGGCCTGGG + Intergenic
1041736275 8:61113914-61113936 TGAGCCACTGCACCTGGCCCTGG + Intronic
1042260109 8:66849860-66849882 TAAGCCACTGCGCCTGGCCCAGG + Intronic
1042357748 8:67847697-67847719 CATGCCACTGCACCCAGCCTGGG - Intergenic
1042529090 8:69796328-69796350 TGAGCCACTGCACCTGGCCCTGG - Intronic
1042814323 8:72861886-72861908 TGCGCCACTGCACCTGGCCTTGG - Intronic
1043437489 8:80248747-80248769 TGAGCCACTGCACCTGGCCCAGG + Intergenic
1043875418 8:85480564-85480586 TGAGCCACTGCGCCTGGCCGGGG + Intronic
1044208763 8:89523733-89523755 TAAGCCACTGCACCCAGCCGAGG + Intergenic
1044941369 8:97347573-97347595 TGAGCCACTGCACCTGGCCCAGG + Intergenic
1044969994 8:97609942-97609964 TGAGCCACTGCACCTGGCCAAGG + Intergenic
1045217933 8:100167044-100167066 CACACCACTGCACCTGGCTTGGG - Intronic
1045329329 8:101142004-101142026 TGAGCCACTGCACCTGGCCCTGG + Intergenic
1045724936 8:105161096-105161118 CAGGCCACTGTCCATGGCCTAGG - Intronic
1045994657 8:108348812-108348834 GAGACCACTGGACCTGGCAGAGG + Intronic
1046134569 8:110010138-110010160 TGAGCCACTGCACCTGGCCCAGG + Intergenic
1046222074 8:111229294-111229316 ATGGCCACTGCACATGGCAGGGG - Intergenic
1046677530 8:117127084-117127106 GAGGCCACTGGACCTGTCCTTGG + Intronic
1046905537 8:119568642-119568664 CAGGCCACTGCACTTCACCCTGG - Intronic
1047489047 8:125359221-125359243 CATGCCACTGCACCCAGCCTGGG + Intronic
1047738506 8:127788031-127788053 TGAGCCACTGCACCTGGCCCTGG + Intergenic
1047753728 8:127901883-127901905 TGAGCCACTGCACCTGGCCAAGG + Intergenic
1048573766 8:135675536-135675558 TGTGCCACTGCACCTGGCCAAGG + Intergenic
1049360816 8:142211823-142211845 CAGGGCACTGCTCCTTGCCTGGG - Intergenic
1049711573 8:144066300-144066322 TGAGCCACTGCACCTGGCCCGGG + Intergenic
1049770532 8:144378594-144378616 TAAGCCACCGCACCTGGCCTGGG - Intronic
1049771956 8:144387007-144387029 TAGGCCCCTGCACTTGGCCCAGG - Intronic
1050571371 9:6942907-6942929 CATGCCACTGCACTCAGCCGAGG - Intronic
1051872785 9:21758157-21758179 TGAGCCACTGCACCTGGCCTTGG - Intergenic
1052582813 9:30382445-30382467 TAAGCCATTGCACCTGGCCTAGG - Intergenic
1052837432 9:33262371-33262393 TGAGCCACTGCACCTGGCCAAGG - Intronic
1053396180 9:37776610-37776632 TGAGCCACTGCACCTGGCCAAGG - Intronic
1053542035 9:38983548-38983570 TGAGCCACTGCACCTGGCTGGGG + Intergenic
1053806376 9:41806177-41806199 TGAGCCACTGCACCTGGCTGGGG + Intergenic
1054624105 9:67380362-67380384 TGAGCCACTGCACCTGGCTGGGG - Intergenic
1055049060 9:71961276-71961298 TGAGCCACTGCGCCTGGCCGTGG - Intronic
1055500457 9:76897697-76897719 TGAGCCACTGCACCTGGCCTGGG + Intronic
1055545175 9:77363885-77363907 CAGGCCTCTGAAGCTGGCGGTGG + Intronic
1055730464 9:79275145-79275167 AAGGCCACAGCACCTGTCCCTGG - Intergenic
1056296553 9:85198949-85198971 CAGGCAAATGCACCAGGCTGTGG - Intergenic
1056362183 9:85869660-85869682 TGAGCCACTGCGCCTGGCCGAGG + Intergenic
1056593894 9:87989325-87989347 CAGGCCACTGCACCTGGCTGAGG + Intergenic
1056683851 9:88743552-88743574 TGAGCCACTGCACCTGGCCCTGG + Intergenic
1057238982 9:93392049-93392071 CTGGCCACTGTACCTGGGGGTGG - Intergenic
1057395735 9:94678428-94678450 CAGGCCATTGCTTCTGCCCGTGG + Intergenic
1057472102 9:95367191-95367213 TAAACCACTGCACCTGGCCTGGG - Intergenic
1057826225 9:98374140-98374162 AGAGCCACTGCACCTGGCCTTGG + Intronic
1057835918 9:98445271-98445293 CAGGCTACTGCAACTGGCAGGGG + Intronic
1058434694 9:104951547-104951569 CATGCCACTGCACTTTGCCTGGG + Intergenic
1059122718 9:111656869-111656891 CAAGCCACTGCACTCGGCCTGGG - Intronic
1059135961 9:111806786-111806808 TAAGCCACTGCACCTGGCAAGGG - Intergenic
1059176170 9:112171910-112171932 TAAGCCACTGCTCCTGGCCTCGG - Intronic
1059179486 9:112198356-112198378 TGAGCCACTGCACCTGGCCTAGG + Intergenic
1059483555 9:114610936-114610958 TGAGCCACCGCACCTGGCCGGGG - Intergenic
1060182560 9:121544573-121544595 CAGGCAGGTGCACCTGGCTGAGG - Intergenic
1060401068 9:123349903-123349925 GAGGCCACTGGACTTGGGCGAGG + Intergenic
1060502417 9:124170971-124170993 TAAGCCACCACACCTGGCCGAGG + Intergenic
1060650783 9:125324939-125324961 CGAGCCACTGTACCTGGCCAAGG - Intronic
1060761094 9:126249469-126249491 CATGCCACTGCACCCAGCCTGGG - Intergenic
1060823379 9:126673908-126673930 CAGGCCTGTGTACCTGGCCACGG - Intronic
1060923142 9:127436771-127436793 TGAGCCACTGCACCTGGCCCAGG - Intronic
1060979834 9:127785725-127785747 CAGGGCACTGCGGCTGGCCCCGG + Intronic
1061082649 9:128381411-128381433 TGAGCCACTGCACCTGGCCTTGG - Intronic
1061167251 9:128930664-128930686 TAAGCCACTGCACCCGGCCGAGG - Intronic
1061611871 9:131752122-131752144 TAAGCCACTGCACCTGGCTGAGG + Intergenic
1061725966 9:132582233-132582255 CATGACTCTCCACCTGGCCGGGG - Exonic
1062114946 9:134803349-134803371 TGAGCCACTGCACCTGGCTGGGG - Intronic
1062235488 9:135505883-135505905 CTGGCCCCTGCACCTGGCACAGG + Intergenic
1062285926 9:135772450-135772472 GAGGCCACAGCAGCTGGCCTGGG + Intronic
1062326406 9:136014571-136014593 AGGGGCACTGCACCTGGCCTAGG + Intronic
1062442964 9:136579265-136579287 CTGGCCACTGAGCATGGCCGGGG + Intergenic
1062570190 9:137181390-137181412 CCCGCCACTGCACCTGGCAGAGG - Intronic
1062686677 9:137817194-137817216 CAAGTCACTGGTCCTGGCCGTGG - Intronic
1185596311 X:1308942-1308964 TGAGCCACTGCACCTGGCCATGG - Intronic
1185997274 X:4965757-4965779 TGAGTCACTGCACCTGGCCGTGG - Intergenic
1186151022 X:6674851-6674873 CAGGCCACCGAACCTGGCTGAGG + Intergenic
1186185422 X:7015616-7015638 CAGGCCACTGCACTTTACCCTGG - Intergenic
1186221621 X:7355186-7355208 TGAGCCACTGCACCTGGCCATGG + Intergenic
1186465848 X:9784448-9784470 CTGGCCACTGCAGCTAGCAGTGG - Intronic
1186483010 X:9910531-9910553 TGAGCCACTGCACCTGGCCAGGG - Intronic
1186688209 X:11947801-11947823 TGAGCCACTGCACCTGGCCGAGG - Intergenic
1187015997 X:15329799-15329821 TGAGCCACTGCACCTGGCCAAGG - Intronic
1187364272 X:18653683-18653705 TGAGCCACTGCACCTGGCCCTGG - Intronic
1187402875 X:18977876-18977898 TGAGCCACTGCACCTGGCCCAGG - Intronic
1187422626 X:19149373-19149395 TGAGCCACTGCACCTGGCCTTGG - Intergenic
1187860474 X:23677987-23678009 CAGGCCACTGTGCCCGGCTGGGG - Intronic
1187950178 X:24463885-24463907 TGAGCCACCGCACCTGGCCGAGG + Intergenic
1187968619 X:24637618-24637640 CATGCCACTGCACCCAGCCTGGG + Intronic
1188245087 X:27829611-27829633 CACGCCACTGCACCCAGCCTGGG + Intergenic
1188384409 X:29538619-29538641 TAAGCCACTGCTCCTGGCCAAGG + Intronic
1188536217 X:31199980-31200002 ACCGCCAGTGCACCTGGCCGAGG + Intronic
1189162310 X:38822142-38822164 TGAGCCACTGCACCCGGCCGAGG - Intergenic
1189416829 X:40822675-40822697 TGAGCCACTGCACCTGGCTGGGG - Intergenic
1190080798 X:47355332-47355354 TGAGCCACTGCACCTGGCCAAGG + Intergenic
1190093437 X:47459963-47459985 TGAGCCACTGCACCTGGCCTTGG - Intronic
1190274054 X:48889066-48889088 CGAGCCACTGCGCCCGGCCGTGG + Intergenic
1190280592 X:48926634-48926656 TGAGCCACTGCACCTGGCCCTGG + Intronic
1190297247 X:49035025-49035047 TGAGCCACTGCACCTGGCCCTGG - Intronic
1190402417 X:50050943-50050965 TGAGCCACTGCGCCTGGCCGTGG + Intronic
1190768255 X:53493629-53493651 TGAGCCACTGCACCTGGCCAGGG - Intergenic
1191169551 X:57429050-57429072 TGAGCCACTGCACCTGGCCTTGG - Intronic
1191771701 X:64767528-64767550 TGAGCCACTGCACCTGGCCCAGG - Intergenic
1192481057 X:71486400-71486422 CAGGCCACTGCACCCCAGCGTGG - Intronic
1192576713 X:72248592-72248614 TGAGCCACTGCACCTGGCTGAGG - Intronic
1192595975 X:72408687-72408709 TGAGCCACTGTACCTGGCCGGGG + Intronic
1193262719 X:79427793-79427815 TAAGCCACTGTGCCTGGCCGGGG + Intergenic
1194331081 X:92583382-92583404 TGAGCCACTGCACCTGGCCTTGG + Intronic
1194524926 X:94967090-94967112 CAGGCCACTGCATCCAGCCTGGG + Intergenic
1196753293 X:119136541-119136563 TGAGCCACTGCACCTGGCCATGG - Intronic
1197740209 X:129885704-129885726 CATGCCACTGCACTTAGCCTTGG + Intergenic
1197808905 X:130423870-130423892 CCTGCCACTGCATCTGGCCTGGG - Intergenic
1198056509 X:133001110-133001132 TAAGCCACTGCACCTGGCCTGGG - Intergenic
1198678395 X:139155565-139155587 CAGGACACTGCAGCTAACCGTGG + Intronic
1199863090 X:151819795-151819817 GAGGCTACTGCAGCTGGCCTAGG + Intergenic
1199900747 X:152169618-152169640 TAGGCCACTGCATTTGGCCTGGG - Intronic
1199900871 X:152170597-152170619 CAAGCCACTACACCTGGCCAAGG + Intronic
1200400099 X:156014865-156014887 CAGGCCACTGCATTTAGCCTGGG - Intergenic
1200639780 Y:5702446-5702468 TGAGCCACTGCACCTGGCCTTGG + Intronic
1201056287 Y:9995458-9995480 TGAGCCACTGCACCTGGCCTGGG - Intergenic
1201145387 Y:11062291-11062313 CAGGGAGCTGGACCTGGCCGAGG + Intergenic
1202083125 Y:21105457-21105479 TGAGCCACTGCACCTGGCCGTGG + Intergenic