ID: 1083894083

View in Genome Browser
Species Human (GRCh38)
Location 11:65611533-65611555
Sequence CAGGGGAACTAGAGGGGAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 254}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083894074_1083894083 0 Left 1083894074 11:65611510-65611532 CCTCCCAGACTCTGAGAGGGAAG 0: 1
1: 1
2: 5
3: 29
4: 265
Right 1083894083 11:65611533-65611555 CAGGGGAACTAGAGGGGAGTAGG 0: 1
1: 0
2: 2
3: 24
4: 254
1083894076_1083894083 -4 Left 1083894076 11:65611514-65611536 CCAGACTCTGAGAGGGAAGCAGG 0: 1
1: 0
2: 5
3: 39
4: 308
Right 1083894083 11:65611533-65611555 CAGGGGAACTAGAGGGGAGTAGG 0: 1
1: 0
2: 2
3: 24
4: 254
1083894070_1083894083 6 Left 1083894070 11:65611504-65611526 CCACCACCTCCCAGACTCTGAGA 0: 1
1: 0
2: 8
3: 85
4: 1029
Right 1083894083 11:65611533-65611555 CAGGGGAACTAGAGGGGAGTAGG 0: 1
1: 0
2: 2
3: 24
4: 254
1083894066_1083894083 22 Left 1083894066 11:65611488-65611510 CCTTGCCTGCCCTTTACCACCAC 0: 1
1: 0
2: 2
3: 32
4: 413
Right 1083894083 11:65611533-65611555 CAGGGGAACTAGAGGGGAGTAGG 0: 1
1: 0
2: 2
3: 24
4: 254
1083894075_1083894083 -3 Left 1083894075 11:65611513-65611535 CCCAGACTCTGAGAGGGAAGCAG 0: 1
1: 0
2: 7
3: 31
4: 299
Right 1083894083 11:65611533-65611555 CAGGGGAACTAGAGGGGAGTAGG 0: 1
1: 0
2: 2
3: 24
4: 254
1083894068_1083894083 13 Left 1083894068 11:65611497-65611519 CCCTTTACCACCACCTCCCAGAC 0: 1
1: 1
2: 2
3: 34
4: 412
Right 1083894083 11:65611533-65611555 CAGGGGAACTAGAGGGGAGTAGG 0: 1
1: 0
2: 2
3: 24
4: 254
1083894072_1083894083 3 Left 1083894072 11:65611507-65611529 CCACCTCCCAGACTCTGAGAGGG 0: 1
1: 0
2: 2
3: 33
4: 351
Right 1083894083 11:65611533-65611555 CAGGGGAACTAGAGGGGAGTAGG 0: 1
1: 0
2: 2
3: 24
4: 254
1083894067_1083894083 17 Left 1083894067 11:65611493-65611515 CCTGCCCTTTACCACCACCTCCC 0: 1
1: 0
2: 2
3: 78
4: 778
Right 1083894083 11:65611533-65611555 CAGGGGAACTAGAGGGGAGTAGG 0: 1
1: 0
2: 2
3: 24
4: 254
1083894069_1083894083 12 Left 1083894069 11:65611498-65611520 CCTTTACCACCACCTCCCAGACT 0: 2
1: 0
2: 4
3: 60
4: 779
Right 1083894083 11:65611533-65611555 CAGGGGAACTAGAGGGGAGTAGG 0: 1
1: 0
2: 2
3: 24
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083894083 Original CRISPR CAGGGGAACTAGAGGGGAGT AGG Intronic
900650475 1:3727784-3727806 CAGGGGAACTGGACGCGTGTGGG + Intronic
901216938 1:7560271-7560293 CAGGGGACCTGAAGGGCAGTGGG - Intronic
901932285 1:12603199-12603221 CAAGCGAACTAGAGGGCATTTGG + Intronic
902099364 1:13973278-13973300 CAGTGGATCTAGAGGGGAAAGGG - Intergenic
903034790 1:20486448-20486470 GAGGGGACCTCGGGGGGAGTGGG + Intergenic
906658312 1:47564770-47564792 CAGAGGAAGTAAAGGGGAGAAGG + Intergenic
907259681 1:53208230-53208252 CAGGGGATTTAGAGAGGAATAGG - Intronic
911215913 1:95193827-95193849 CTGGTTAACTAGAGGGGGGTAGG + Exonic
912373598 1:109192581-109192603 CAAGGAAACAAGAGGGGAGAGGG - Intronic
912634633 1:111280329-111280351 GAATGGAAATAGAGGGGAGTGGG + Intergenic
912798432 1:112706698-112706720 CAGGGGACCTAGAGTGGGATGGG - Intronic
913445387 1:118945066-118945088 CAGGGGAAAGAGAGGAGAATAGG + Intronic
913660390 1:121001798-121001820 CAGGAGAACCTGATGGGAGTGGG + Intergenic
914650381 1:149693614-149693636 CAGGAGAACCTGATGGGAGTGGG + Intergenic
914916095 1:151820126-151820148 CAGGGGAAGGAGGGGGGAGCAGG - Intronic
915388471 1:155518784-155518806 CAGGAGAGGTAGAGGGGAGACGG + Intronic
916679440 1:167090536-167090558 AAGGGGAACTTGAGGGAAGTAGG - Exonic
916946028 1:169728280-169728302 CAGTGGAACTAGAGAGTACTTGG + Intronic
918722818 1:187875598-187875620 CAGGAGAAATAGAGGGGAGAGGG + Intergenic
920660818 1:207912718-207912740 CTGAGGAAGTTGAGGGGAGTGGG - Intergenic
921694130 1:218187503-218187525 GAAGGGAATTTGAGGGGAGTGGG - Intergenic
923056143 1:230426602-230426624 CCGGGGAACAGGAGGGGAGGGGG + Intergenic
924067159 1:240235823-240235845 CAGAGGAAGAAGAGGGGAGATGG - Intronic
1064457461 10:15501404-15501426 CAGGGGACCTAGACAGGCGTGGG - Intergenic
1065525443 10:26615545-26615567 CTGGGCAACTGTAGGGGAGTTGG + Intergenic
1065960532 10:30730941-30730963 CAGGGAAGCCAGAGGGGTGTGGG + Intergenic
1066367763 10:34793277-34793299 CAAGGGAGCTGGAGGGCAGTAGG + Intronic
1067546015 10:47193172-47193194 CAGGGGAAACAGAGGGCAGGAGG + Intergenic
1067662060 10:48243603-48243625 AAGGGGAACCAGACGGGAGCAGG + Intronic
1070163708 10:73881929-73881951 CAGGAGAAATGGAGGGGAGGGGG + Intergenic
1071223525 10:83498238-83498260 CATGAGAAGTAGAGGGGAGTTGG + Intergenic
1072035030 10:91555351-91555373 GAGGGGAACTGGAGGGGAGCTGG + Intergenic
1077485538 11:2836844-2836866 CAGGGGCCCTAGAGGGAAATGGG + Intronic
1078021112 11:7656638-7656660 CACCGGAACTAGAGGGCACTGGG - Intronic
1078717777 11:13856259-13856281 CAGGGAAGTTAGTGGGGAGTGGG - Intergenic
1079135912 11:17775919-17775941 CAGGGGAAGTAGAGGGGCTGGGG - Intronic
1079366470 11:19814372-19814394 CAGGGGAGGGAGAGGGCAGTGGG - Intronic
1083684636 11:64368938-64368960 GAGTGGAATTTGAGGGGAGTAGG + Intronic
1083894083 11:65611533-65611555 CAGGGGAACTAGAGGGGAGTAGG + Intronic
1084132858 11:67150681-67150703 CTGGGGAATTAGAGGTGAGTTGG + Intronic
1084938324 11:72599156-72599178 GAGGGGAAATAGTTGGGAGTCGG - Intronic
1085314672 11:75537287-75537309 CAGTGGGGCTAGAGGGCAGTGGG + Intergenic
1085331522 11:75655762-75655784 TAGGGGAACATGAGGGGACTTGG + Intronic
1088811238 11:113394163-113394185 CTAGGTAAATAGAGGGGAGTGGG - Intronic
1089567415 11:119379014-119379036 CAGGGGCACTGGATGGGAGCTGG + Intronic
1089576609 11:119448729-119448751 CTGGGGAACTACTGGGGAGCAGG + Intergenic
1090250983 11:125251627-125251649 CAGGGGAGCAAGAGGGGAAGGGG + Intronic
1090382558 11:126337364-126337386 CGGGGGAAGTAGAGGAGAGCTGG + Intronic
1090989016 11:131799548-131799570 CAGGGAAACTAGAAGGGCTTTGG + Intronic
1091273221 11:134332284-134332306 CAGGGGAACTCGGGGGTATTGGG - Intronic
1091744360 12:2981774-2981796 CAGGGGTGCTGGAGGGTAGTGGG + Intronic
1092542143 12:9426657-9426679 CATGGGAAGAAGAGGGGAGAAGG + Intergenic
1094510869 12:31095776-31095798 CATGGGAAGAAGAGGGGAGAAGG - Intronic
1096779711 12:53984889-53984911 CAGGGGAGGTAGAGGGGTGGAGG - Intergenic
1097208644 12:57346480-57346502 CATGAGAACTAGAAGGAAGTGGG + Intronic
1098377776 12:69836095-69836117 TGGGGGAACCAGAAGGGAGTTGG + Intronic
1099431525 12:82591913-82591935 CTGGGAAAGTAGAGTGGAGTGGG + Intergenic
1102217381 12:111170981-111171003 CATGGGAATGGGAGGGGAGTGGG + Intronic
1102525070 12:113506467-113506489 GGGAGGAACTAGAGGGGAATGGG - Intergenic
1103131840 12:118475735-118475757 TAGGGGAAGTAGAGGGAAGCTGG + Intergenic
1105810101 13:23987762-23987784 CAGGGGTTGGAGAGGGGAGTGGG - Intronic
1105894888 13:24709349-24709371 GAGGGGATCTAGAGGGGAAGAGG - Exonic
1106223352 13:27765951-27765973 CAGGGGAACTTGTGTGGAGGAGG - Intergenic
1107694045 13:42982760-42982782 CAGGGGAAAAAGATGGGAGAAGG - Intronic
1107697621 13:43015850-43015872 CAGTGGAAGGAGAGGGGAGGAGG - Intergenic
1109038966 13:57306038-57306060 AAGGGGAAACAGAGGGGAGTAGG - Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1112281353 13:98065516-98065538 CAGGGCCACTAGAAGGGAGGTGG + Intergenic
1114217477 14:20667629-20667651 CGGGGGAACGTGAGGGGAATAGG + Intergenic
1114613743 14:24057755-24057777 CAGGGGAGCTGGAAGGGGGTAGG - Intronic
1116385844 14:44328847-44328869 CAGGGGACTTGGAGGGGAGAGGG - Intergenic
1116809105 14:49522313-49522335 CAGTGGAAATAGAGGGGTGAAGG + Intergenic
1117830109 14:59741713-59741735 CAGGGGAGGAAGAGGGAAGTGGG - Intronic
1118876369 14:69788097-69788119 GAGGGGTTCTGGAGGGGAGTGGG + Intronic
1119400510 14:74359221-74359243 CAGGGGGTTTAGAGGGGGGTTGG + Exonic
1119443776 14:74647303-74647325 CAGAGGAAGGAGAAGGGAGTCGG - Intergenic
1119662070 14:76459302-76459324 CAGTGGGACTAGAGAGGAGCTGG + Intronic
1120128907 14:80781662-80781684 GAAAGGAACTAGAGGGAAGTAGG + Intronic
1121270283 14:92633111-92633133 TAGGGGAACCAGAGGGGTGAGGG + Intronic
1121948437 14:98146261-98146283 TTGGGGAACTTGAGGGCAGTGGG + Intergenic
1121970910 14:98354949-98354971 CAGGGGAATTAAACGGGAGACGG + Intergenic
1122283274 14:100636741-100636763 CAGGGGAAGGAGCAGGGAGTGGG - Intergenic
1122888665 14:104722884-104722906 CAGTGGAAGAAGAGGGGACTGGG + Intergenic
1123450851 15:20358105-20358127 CAGGGGAGGAAGAGGGGAGGAGG + Intergenic
1125466696 15:39960358-39960380 CAGGGGAGATAGAGAGGAGAAGG + Intronic
1125898925 15:43327618-43327640 CAGAGGCACCAGAGGGGAATGGG - Exonic
1129258071 15:74345475-74345497 CAGAGGGAGTGGAGGGGAGTTGG - Intronic
1129271327 15:74420799-74420821 GAGGGGAGCAGGAGGGGAGTTGG - Intronic
1129987976 15:79935465-79935487 CAGGGCAACAAGTGGGGAGAAGG + Intergenic
1130234297 15:82119951-82119973 CAAGGGAGCTAGAGAGGAGCTGG - Intergenic
1130577790 15:85107583-85107605 CAGTGGAAGGAGAGGGGAGGGGG + Intronic
1131151433 15:90049714-90049736 GAGGAGAACCAGAGGGCAGTGGG - Intronic
1131927751 15:97404546-97404568 CAAAGGAACTAGATGGTAGTGGG - Intergenic
1132542937 16:519811-519833 CAGGAGAACAAGAGGAGAATGGG + Exonic
1137540920 16:49361076-49361098 CAAGGGGACTAGAAGGGAGAGGG - Intergenic
1137674920 16:50299464-50299486 CAGGGGACCTAGAGGGGAGCGGG - Intronic
1138413916 16:56860351-56860373 CAGAGGAAGGAGAGGGGAGAGGG - Intergenic
1139510563 16:67426046-67426068 TAGGGTAATCAGAGGGGAGTCGG + Intergenic
1139766715 16:69236745-69236767 CAGTGGAAACTGAGGGGAGTAGG + Intronic
1142072418 16:88098535-88098557 CAGGGCATCTAGCGGGGAGCTGG - Intronic
1142809495 17:2388648-2388670 CAGGGAGTCTGGAGGGGAGTGGG - Intronic
1143119165 17:4596602-4596624 CAGGGGACCTGGAGGGCTGTAGG + Intronic
1143836499 17:9696879-9696901 CAGGGGAACCAGAGGGGAAAGGG - Intronic
1145312615 17:21708747-21708769 CAGGGGAAGGATAGGGGAGAGGG + Intergenic
1146453846 17:32994708-32994730 CAGAGGAACTGGAGGGGACTAGG + Intronic
1147545954 17:41402027-41402049 CAGGGGACATGGTGGGGAGTGGG + Intergenic
1147685412 17:42284046-42284068 CATGGGAGCCAGAGGGGAGGTGG - Intergenic
1147793817 17:43028810-43028832 CAGGGGAGCTGGAGGGCAGAAGG + Exonic
1148539914 17:48472179-48472201 CAGAGGAGCTAGAGGCCAGTGGG + Intergenic
1148541401 17:48483516-48483538 CAGTGGAACAGGAGGGGAATTGG - Intergenic
1148581408 17:48746695-48746717 CAGGGGAAAGAGAGTGGAATGGG + Intergenic
1148868904 17:50643977-50643999 CAGGGGCACTGGAGGGCAGAGGG + Intronic
1149583572 17:57768701-57768723 CAGGGGAAGGAGAGTGGGGTGGG + Intergenic
1151540067 17:74760246-74760268 CAGCCGAACTAGCTGGGAGTGGG + Intronic
1151827084 17:76529664-76529686 CAGGGGAAGAGGAGGGGAGGGGG - Intronic
1154323743 18:13375064-13375086 CATGGGAACTAGAAGGGAAGGGG + Intronic
1155205413 18:23553925-23553947 CTGGGGCACTACAGGGGACTGGG + Intronic
1155478747 18:26262354-26262376 GAAGGGAAAGAGAGGGGAGTTGG + Intronic
1156149515 18:34224947-34224969 TGGGGGAAGGAGAGGGGAGTGGG - Intronic
1157481844 18:48060227-48060249 CAGGGGAAGCAGAGGGGAGAAGG + Intronic
1157995777 18:52553700-52553722 AAGGGGGTCTAGAGGAGAGTAGG + Intronic
1158244285 18:55413330-55413352 GAGAGAAACTGGAGGGGAGTGGG + Intronic
1158873197 18:61708851-61708873 CAGGTGAACTAGAGGGATGAAGG - Intergenic
1158965431 18:62618347-62618369 CAGGGGAAATAATGAGGAGTTGG + Intergenic
1159345771 18:67201207-67201229 TGGGGGAACCAGAGGGGAGATGG + Intergenic
1160114353 18:76063805-76063827 AAGGGAAACTAGAGGGGAAAAGG - Intergenic
1160736594 19:665430-665452 CAGGGGAAGGAGAGGGGACTTGG - Intergenic
1160774029 19:846597-846619 CTGTGGTCCTAGAGGGGAGTGGG - Intronic
1161112747 19:2479121-2479143 CCTGGGAACTAGGGGGGAGTGGG + Intergenic
1162860890 19:13505514-13505536 CAGGGGAACTATGGGGGCCTTGG - Intronic
1163282954 19:16328243-16328265 CAGGAGACCTACAGGGGAGGAGG - Intergenic
1164537561 19:29097574-29097596 CCTGGGAAGGAGAGGGGAGTGGG - Intergenic
1164587067 19:29482614-29482636 CAGGGGGAAAAGAAGGGAGTTGG - Intergenic
1165460855 19:35943603-35943625 TAGGGGAACCAGAGGGAAATTGG + Intronic
1167173413 19:47848920-47848942 CAGGGGAATTAGCGAGGATTAGG + Intergenic
1167510001 19:49890903-49890925 CAGGGAAAGTAGCAGGGAGTGGG - Intronic
1167939221 19:52932833-52932855 TAGGGGAACAAGTGGGGAGAAGG + Intronic
925198895 2:1950484-1950506 CAGGGGACCAAGATGGGTGTGGG + Intronic
926049858 2:9737720-9737742 CAGGGGTACTAGAGGGAATGGGG - Intergenic
926166162 2:10523082-10523104 CAGGGGCAGCAGAGGGCAGTGGG + Intergenic
926330567 2:11822013-11822035 CTGGGGAATGAGAGGGGAGTGGG - Intronic
928322045 2:30291642-30291664 AAGGGAAACTAGTGGGGAGGAGG + Intronic
928369727 2:30732236-30732258 ATGGGGAACTACAGGGGAGAGGG + Intronic
929931114 2:46256247-46256269 CAGGGGGACCTGAGGAGAGTTGG + Intergenic
930596664 2:53398033-53398055 GAGGGGAAATAGTGGGCAGTAGG - Intergenic
931756988 2:65383294-65383316 CAAGGGAACTAGAGTGAACTTGG - Intronic
932411728 2:71551557-71551579 CAGGGGAGACAGAGGGGAGGAGG - Intronic
934852887 2:97712670-97712692 TTGGGGCACTAGAGGGGAGATGG + Intergenic
935691983 2:105740397-105740419 CAGGGGAACTGGAGAGCAGAAGG + Intergenic
935725211 2:106018122-106018144 CAGGGCAAGGAGTGGGGAGTGGG + Intergenic
937183279 2:120014767-120014789 CAGAGCAAACAGAGGGGAGTAGG + Intronic
938198910 2:129357072-129357094 GAGGGGCATTAGAGGGGAGAAGG - Intergenic
940997185 2:160162476-160162498 CAGGGGAACTAGACCAGAGTTGG + Intronic
943748385 2:191486106-191486128 CAAGGGAAATGGAGAGGAGTGGG - Intergenic
944638892 2:201702033-201702055 TAGGGGAACTAGAAGGGAACAGG - Intronic
946162046 2:217841303-217841325 CAGGGGAGCCAGCAGGGAGTGGG + Intronic
946434457 2:219642535-219642557 CTGGGGGACTTGAGGGGAGCGGG + Intergenic
946593977 2:221285521-221285543 CAGGGGAGAGAGAAGGGAGTTGG - Intergenic
947922666 2:233891692-233891714 CAGGGGAGGTAGAGGGCAGAAGG + Intergenic
948285154 2:236778523-236778545 TAGGGGAGGGAGAGGGGAGTAGG - Intergenic
949042848 2:241857516-241857538 CGGGGGAACCAGAGGGCAGAGGG - Intronic
949075760 2:242056763-242056785 CAGGGGGACTGGAGGGCCGTGGG + Intergenic
1168830242 20:841634-841656 CTGGGGAGCTAGTGGGGAGGGGG + Intronic
1168841541 20:912992-913014 TGGGGGAACAGGAGGGGAGTTGG + Intronic
1171753227 20:29076155-29076177 CAGGACTACTAGAGGGGAGAAGG - Intergenic
1171789027 20:29501405-29501427 CAGGACTACTAGAGGGGAGAAGG + Intergenic
1171858501 20:30373093-30373115 CAGGACTACTAGAGGGGAGAAGG - Intergenic
1172785222 20:37464297-37464319 CAGGGGAACAAGGGGGGAATGGG - Intergenic
1174100236 20:48121640-48121662 CTGGAGAACCAGAGGGGAGCTGG - Intergenic
1175541661 20:59751677-59751699 CACAGGAACGAGAGGGGAGGGGG - Intronic
1176668888 21:9713517-9713539 CAGGGAAGCTAAAGGAGAGTGGG + Intergenic
1177297963 21:19201813-19201835 TAGAGGAACTACAGGGGAGCAGG - Intergenic
1179714525 21:43280399-43280421 GAGGGGAGGTGGAGGGGAGTTGG + Intergenic
1179714546 21:43280449-43280471 GAGGGGAGGTGGAGGGGAGTTGG + Intergenic
1180728824 22:17966037-17966059 CACATGAACTAGAGAGGAGTCGG + Intronic
1181496081 22:23288340-23288362 CAGGGGAACAAGAGGGCTGGGGG - Intronic
1183284749 22:36954817-36954839 CAGGGGAAGTAGAGGTGTGACGG - Intergenic
1183954734 22:41372700-41372722 CAGGGGAGCAAGAGTAGAGTTGG - Intronic
1185108780 22:48889340-48889362 CGGGGGCACTGGAGGGGAGAGGG - Intergenic
950527520 3:13533098-13533120 CAGGGGACCCTGATGGGAGTAGG - Intergenic
952505651 3:34004726-34004748 CAGGGGAGCTAAAGGGGTGTTGG + Intergenic
952724657 3:36571375-36571397 CAGTGGATCAAGTGGGGAGTTGG - Intergenic
953404132 3:42652227-42652249 GCAGGGAACTAGAGGGGATTTGG - Intergenic
953607342 3:44420453-44420475 CAGGAACACTAGAGAGGAGTGGG - Intergenic
957311556 3:78526151-78526173 CTGGGGAAGGAGAGGGGAGGAGG - Intergenic
960640443 3:119817664-119817686 GAGGGGAACGAGTGGGAAGTGGG - Exonic
961105212 3:124234967-124234989 CAGGGGAGCGGGAGGGGAGCTGG + Intronic
962809886 3:138950729-138950751 AGGGAGAACTAGAGGGGATTTGG - Exonic
963454067 3:145521733-145521755 CAGGGCAACTAGAAGGGGGGTGG + Intergenic
964383822 3:156126232-156126254 CAGGAGAACAAGAGGAGAGGAGG + Intronic
965410606 3:168326059-168326081 CAGAGGAAGCAGAGTGGAGTTGG + Intergenic
965513252 3:169592515-169592537 TAGGGGAACTAGAGAGGAGAGGG - Intronic
967082228 3:186060886-186060908 CAGGCAAACTAGGAGGGAGTGGG - Intronic
967459776 3:189732252-189732274 CAGGGGTGGTGGAGGGGAGTTGG - Intronic
967962822 3:194939406-194939428 CAGGGGAGGTAGAGGGGAGACGG + Intergenic
968435169 4:581680-581702 AAGGAGAACTTGGGGGGAGTTGG - Intergenic
969512941 4:7629987-7630009 TAGGAGAACTGGAGGGGAGAGGG - Intronic
969629933 4:8330117-8330139 CAGGGGACTGAGAGGGAAGTGGG + Intergenic
969707442 4:8819594-8819616 CAGGGGAAGGGGAAGGGAGTAGG + Intergenic
969872161 4:10111398-10111420 CAGGGGAAGCAGAGGGTGGTGGG - Intronic
971825859 4:31621764-31621786 TAAGGGAACTAGAGGGGGTTGGG + Intergenic
972614366 4:40683986-40684008 AAGGGGAACTATTGGTGAGTGGG - Intergenic
976130225 4:81876326-81876348 GAGGGGAAGGGGAGGGGAGTGGG - Intronic
977756949 4:100682782-100682804 CAGGGGAGCCAGAAGGGAGATGG - Intronic
982271914 4:153599195-153599217 CAGGAGCACGAGAGGGGAGAAGG + Intronic
983227102 4:165095491-165095513 CATGAGAACTAGAGGTGAGCAGG + Intronic
984261249 4:177445337-177445359 CGGGGGAACCAGAAGGGAGACGG - Intergenic
985658205 5:1142872-1142894 CAGGGGAGGTAAGGGGGAGTAGG + Intergenic
986264627 5:6181314-6181336 CAGGGGAACCACCAGGGAGTTGG - Intergenic
989111235 5:37908153-37908175 CAGGTGATCTGGCGGGGAGTTGG + Intergenic
990291745 5:54359352-54359374 CAGGGGAAGAAGAGGGGTCTAGG - Intergenic
990493223 5:56321815-56321837 GAGGTGAACTAAAGGTGAGTGGG - Intergenic
990695532 5:58412303-58412325 CAGGAGAACTTGCCGGGAGTTGG - Intergenic
992149011 5:73882700-73882722 CAGGGGAAGAAGAAGGGAGGTGG + Intronic
992547836 5:77832483-77832505 CAGTGGGACTAGAGGCGAGGAGG - Intronic
995238801 5:109861757-109861779 CATGGGAACAAGAAGGGAGAGGG + Intronic
995941536 5:117591836-117591858 AAGGGGAAAGAGAGGGAAGTGGG - Intergenic
997365269 5:133321502-133321524 CAGGGGCACCAGGGAGGAGTGGG - Intronic
998374833 5:141683276-141683298 CAGGGGAAGAAGAGGGGAGTGGG + Intergenic
1001427406 5:171632351-171632373 GAGGTGAACGAGAGGAGAGTGGG + Intergenic
1001734622 5:173988660-173988682 CAGGGGAGATGGAGGGAAGTGGG - Intronic
1001925546 5:175633605-175633627 GAGGGCAACTAGAGGTGAGAGGG + Intergenic
1002666645 5:180830424-180830446 AAGGGGCACAAGAGGGGAGTAGG + Intergenic
1003912359 6:10753917-10753939 CAGGGAAACTAGAGGGTACATGG - Intronic
1004332940 6:14737843-14737865 CAGGGCAAGGGGAGGGGAGTGGG + Intergenic
1004902058 6:20204156-20204178 GAGGGAAATTAGAGGGGAGAGGG - Intronic
1004979964 6:21012396-21012418 CAGGGTAACTAGATGGGACTGGG - Intronic
1006042445 6:31267612-31267634 CAGGTGGGCTTGAGGGGAGTGGG - Intergenic
1006052033 6:31352701-31352723 CAGGTGGGCTTGAGGGGAGTGGG - Intronic
1006193693 6:32224180-32224202 CTGGGGAAGTAGGGGGAAGTAGG + Intergenic
1006517000 6:34550717-34550739 TGGGGGAAGTACAGGGGAGTGGG + Intronic
1007345175 6:41223690-41223712 CAGGGGATTTGGAGGGCAGTGGG - Intergenic
1007400722 6:41600807-41600829 CAGGGGAACCGGAGGTGGGTGGG - Exonic
1007842842 6:44730799-44730821 CAGGGGGGCTGGAGGGAAGTAGG - Intergenic
1008248086 6:49203763-49203785 GAGGGGAACTGGAGAGGGGTTGG - Intergenic
1010623595 6:78107427-78107449 CAGTGGAGCTAGAGGTGGGTAGG - Intergenic
1011550031 6:88523200-88523222 CAGGGCAATTAGACGGGAGAAGG - Intergenic
1018921614 6:168179705-168179727 CAGGGGAATTGGAGGGGAATTGG + Intergenic
1018994296 6:168699449-168699471 CAGAGGAACCAGAGGGGACTGGG + Intergenic
1019345191 7:526331-526353 CAGGGCAGCTGGAAGGGAGTGGG + Intergenic
1019559703 7:1649895-1649917 CAGGAGAGGTAGAGGGGAGATGG + Intergenic
1020963012 7:14829471-14829493 CAGGGAAACTAGAAGGGAGGAGG + Intronic
1022663193 7:32385733-32385755 CAGGGGAACCAGAGAGAATTTGG + Intergenic
1024032583 7:45476106-45476128 CAGGGGAACGAGAGATGAGTAGG + Intergenic
1024197206 7:47071083-47071105 CAGGGAAACAAGAGAGGAGAGGG + Intergenic
1024294201 7:47829978-47830000 CAGGGGACCTAGATGGGAAGGGG - Intronic
1028903208 7:96123947-96123969 CAGGGGAGCAAGAGGAGACTGGG + Intronic
1029419760 7:100466633-100466655 CAAGGGAACAAGATGGGGGTGGG + Exonic
1031787753 7:126056298-126056320 TAGGGGAAGTAAAGGGTAGTGGG + Intergenic
1032009360 7:128332854-128332876 CAGGAAAACTAGGTGGGAGTGGG - Intronic
1032077087 7:128841090-128841112 GAGGGCAGCTAGAGGGGAGCTGG + Intronic
1032490107 7:132318141-132318163 CAGGGGGACTGGAGCGGAGAGGG + Intronic
1037581960 8:20250689-20250711 CAGGAGAATCAGAGGGGAGGCGG - Intronic
1038053687 8:23837677-23837699 GAGGGGAAGCAGAGGGGAGCAGG + Intergenic
1038483030 8:27914778-27914800 GAGGGGAGCATGAGGGGAGTGGG - Intronic
1040661134 8:49577190-49577212 CAGGGCAAACAGAGGGGATTTGG + Intergenic
1041131073 8:54701001-54701023 CTGGGGAACTAGAGGGAGATGGG + Intergenic
1041624821 8:60013682-60013704 CAGGGAAACTTTAGAGGAGTTGG - Intergenic
1043357912 8:79435471-79435493 CAAGTGAACGAGAGGGGATTGGG + Intergenic
1043437915 8:80252414-80252436 CAGTGGAACTTCAGGGGAATGGG - Intergenic
1047255258 8:123209110-123209132 CTGGGGAGCCAGAGGGGAGCAGG + Exonic
1048375122 8:133816565-133816587 CAGTGGAACCAGAGGGAATTTGG + Intergenic
1049777004 8:144411034-144411056 CAGGGCAACAAGTGGGGAGAAGG - Intronic
1051693354 9:19741285-19741307 AAGGGGAGCTAGAGGGAAGTGGG + Intronic
1052231940 9:26164710-26164732 ATGGGGAACTAGAGAGGAGAGGG - Intergenic
1054755367 9:68952033-68952055 CAGGGAAACTGGAAGGGTGTAGG - Intronic
1055357751 9:75454791-75454813 CAGGGGGACTATGGGGAAGTTGG - Intergenic
1058718849 9:107745347-107745369 CAGGAGAACTTGTGGGTAGTTGG + Intergenic
1060698631 9:125731460-125731482 CTGGGGAAGTAGAGGGGATGGGG - Intergenic
1060822326 9:126668798-126668820 TAGGGGGACAAGAGGTGAGTGGG - Intronic
1061389623 9:130310201-130310223 CAGGGGAAGTCCAGGGGAGGCGG + Intronic
1061932487 9:133840412-133840434 CAGGGGCAGGAGTGGGGAGTGGG - Intronic
1203656978 Un_KI270753v1:7418-7440 CAGGGAAGCTAAAGGAGAGTGGG - Intergenic
1185511526 X:668006-668028 AAGGGGAAGGAGAGGGGAGGAGG - Intergenic
1188344053 X:29042340-29042362 AATGGGAACTAGAGAAGAGTGGG - Intronic
1195367292 X:104138711-104138733 CGGGGGAACCAGAAGGGAGATGG + Intronic
1196002067 X:110796327-110796349 CAGGGGAGTCAGAGGGTAGTCGG - Intergenic
1196388133 X:115181179-115181201 CAGTGTAACTAGAGGGAAATGGG + Intronic
1198841806 X:140865283-140865305 CTGGCGAATTAGTGGGGAGTGGG - Intergenic
1199412730 X:147543375-147543397 CAGAGGATATAGTGGGGAGTGGG + Intergenic
1200141199 X:153903919-153903941 CAGGGGAAGGAGAGAGGTGTTGG + Intronic