ID: 1083894530

View in Genome Browser
Species Human (GRCh38)
Location 11:65613520-65613542
Sequence TCCTGAGATGGCTGCGTCCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 159}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083894523_1083894530 -7 Left 1083894523 11:65613504-65613526 CCCACCAGCCCTCGTCTCCTGAG 0: 1
1: 0
2: 1
3: 17
4: 188
Right 1083894530 11:65613520-65613542 TCCTGAGATGGCTGCGTCCCGGG 0: 1
1: 0
2: 0
3: 14
4: 159
1083894519_1083894530 5 Left 1083894519 11:65613492-65613514 CCACCTGGCCCGCCCACCAGCCC 0: 1
1: 0
2: 4
3: 86
4: 895
Right 1083894530 11:65613520-65613542 TCCTGAGATGGCTGCGTCCCGGG 0: 1
1: 0
2: 0
3: 14
4: 159
1083894517_1083894530 9 Left 1083894517 11:65613488-65613510 CCACCCACCTGGCCCGCCCACCA 0: 1
1: 0
2: 6
3: 174
4: 3477
Right 1083894530 11:65613520-65613542 TCCTGAGATGGCTGCGTCCCGGG 0: 1
1: 0
2: 0
3: 14
4: 159
1083894524_1083894530 -8 Left 1083894524 11:65613505-65613527 CCACCAGCCCTCGTCTCCTGAGA 0: 1
1: 0
2: 1
3: 28
4: 429
Right 1083894530 11:65613520-65613542 TCCTGAGATGGCTGCGTCCCGGG 0: 1
1: 0
2: 0
3: 14
4: 159
1083894514_1083894530 18 Left 1083894514 11:65613479-65613501 CCCACCTGGCCACCCACCTGGCC 0: 1
1: 0
2: 7
3: 82
4: 586
Right 1083894530 11:65613520-65613542 TCCTGAGATGGCTGCGTCCCGGG 0: 1
1: 0
2: 0
3: 14
4: 159
1083894520_1083894530 2 Left 1083894520 11:65613495-65613517 CCTGGCCCGCCCACCAGCCCTCG 0: 1
1: 1
2: 3
3: 28
4: 459
Right 1083894530 11:65613520-65613542 TCCTGAGATGGCTGCGTCCCGGG 0: 1
1: 0
2: 0
3: 14
4: 159
1083894516_1083894530 14 Left 1083894516 11:65613483-65613505 CCTGGCCACCCACCTGGCCCGCC 0: 1
1: 0
2: 1
3: 53
4: 552
Right 1083894530 11:65613520-65613542 TCCTGAGATGGCTGCGTCCCGGG 0: 1
1: 0
2: 0
3: 14
4: 159
1083894518_1083894530 6 Left 1083894518 11:65613491-65613513 CCCACCTGGCCCGCCCACCAGCC 0: 1
1: 0
2: 3
3: 55
4: 587
Right 1083894530 11:65613520-65613542 TCCTGAGATGGCTGCGTCCCGGG 0: 1
1: 0
2: 0
3: 14
4: 159
1083894521_1083894530 -3 Left 1083894521 11:65613500-65613522 CCCGCCCACCAGCCCTCGTCTCC 0: 1
1: 1
2: 9
3: 57
4: 547
Right 1083894530 11:65613520-65613542 TCCTGAGATGGCTGCGTCCCGGG 0: 1
1: 0
2: 0
3: 14
4: 159
1083894515_1083894530 17 Left 1083894515 11:65613480-65613502 CCACCTGGCCACCCACCTGGCCC 0: 1
1: 0
2: 9
3: 94
4: 882
Right 1083894530 11:65613520-65613542 TCCTGAGATGGCTGCGTCCCGGG 0: 1
1: 0
2: 0
3: 14
4: 159
1083894522_1083894530 -4 Left 1083894522 11:65613501-65613523 CCGCCCACCAGCCCTCGTCTCCT 0: 1
1: 1
2: 3
3: 106
4: 1085
Right 1083894530 11:65613520-65613542 TCCTGAGATGGCTGCGTCCCGGG 0: 1
1: 0
2: 0
3: 14
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083894530 Original CRISPR TCCTGAGATGGCTGCGTCCC GGG Exonic
900266529 1:1759964-1759986 TCCTGTGCTTGCTGTGTCCCTGG - Intronic
901061419 1:6473591-6473613 TCCAGATATGTCTGGGTCCCAGG - Intronic
901468720 1:9440846-9440868 TCCTGAGGTGGGTGTGTCTCTGG - Intergenic
903229586 1:21913653-21913675 TCCTAGGATGGCTCCTTCCCTGG - Intronic
915931133 1:160061713-160061735 TGCTGAGATGCCTGCGGCCGTGG + Intronic
916145467 1:161735254-161735276 TCCTCAGATGGATGTGTCCAGGG + Intergenic
919663198 1:200268241-200268263 CCCTGAGATGGGTGTGTGCCTGG - Intergenic
921076664 1:211705472-211705494 TCTTGAGCTGGCTGCCTGCCTGG + Intergenic
921124490 1:212164989-212165011 TCCTGAGGTGGGTGTGTTCCTGG - Intergenic
921314627 1:213878635-213878657 TTCAGAGAAGGCTCCGTCCCTGG - Intergenic
923617270 1:235548380-235548402 TCCAGGGATGGCAGCGTCCTGGG - Exonic
1063680409 10:8181929-8181951 CCCTGACATGGCTGTGTGCCAGG + Intergenic
1065383584 10:25113358-25113380 TCCTGAGCTGGCCGCTTGCCTGG - Intergenic
1066089363 10:32002737-32002759 TCCTGAAACTGCTGCTTCCCTGG + Intergenic
1069821834 10:71233280-71233302 TCCTGAGGTGGCCCCATCCCGGG + Intronic
1070656845 10:78277531-78277553 GCCTGGGATGGCTGGGGCCCTGG - Intergenic
1070890478 10:79939268-79939290 TCCAGAGAAGGCTGTGCCCCTGG + Intronic
1073606656 10:104902327-104902349 TCCAGAGATGGGTGCTCCCCTGG - Intronic
1074987993 10:118674286-118674308 TCTTGAGATGACTGTGGCCCTGG - Intronic
1076265142 10:129103873-129103895 TCCTGAGCTGCCTGCCTCCTGGG - Intergenic
1076387084 10:130065079-130065101 TCCTGAGCTGGCTGCAGCCCAGG + Intergenic
1077364115 11:2154674-2154696 TCCAGCGATGGCTGCTTCCACGG - Intronic
1079103005 11:17553045-17553067 GCCTGAGAGGGCTGCCTCCCTGG + Intronic
1083764076 11:64833804-64833826 TCCTGAGATGCCAGGGTCCTTGG + Exonic
1083894530 11:65613520-65613542 TCCTGAGATGGCTGCGTCCCGGG + Exonic
1085692612 11:78676117-78676139 TCTGGAGGTGGCTGCGTCCTGGG - Intronic
1088734959 11:112720960-112720982 TCCTGAGATCCCAGCCTCCCTGG - Intergenic
1090331840 11:125938793-125938815 TCCTCAGATGTCTGGGTCACAGG + Intergenic
1090416626 11:126544787-126544809 TCCAGGAATGGCTGCTTCCCAGG - Intronic
1090494155 11:127193428-127193450 TTCTGAGATGGCAATGTCCCAGG + Intergenic
1091240778 11:134050781-134050803 TCCCGAGAAGGGTGCGTCTCAGG + Intergenic
1091562727 12:1627342-1627364 TCTTGAGATGCTTGAGTCCCTGG + Intronic
1093016178 12:14156706-14156728 TCCTGATAAGGCTCCATCCCAGG - Intergenic
1104492886 12:129209699-129209721 TCCTGAGACGGCCCAGTCCCTGG + Intronic
1104905281 12:132210137-132210159 TCCAGAGATGGGTGGGTCCCTGG + Intronic
1105693433 13:22864566-22864588 TCCTGGGAAGGCTGTTTCCCAGG - Intergenic
1105960850 13:25336932-25336954 CCCAGAGATGGCTGTGGCCCTGG - Exonic
1115692424 14:35858660-35858682 CCTTGAGATGACTGCATCCCTGG - Intronic
1117462277 14:55957062-55957084 TTCTGAGATGTCTGTGTACCAGG + Intergenic
1118928666 14:70218447-70218469 TTCTGGTATGGCTGTGTCCCAGG - Intergenic
1121014051 14:90537654-90537676 TCCTGAGATGTCCTCCTCCCAGG + Exonic
1121128079 14:91420801-91420823 TCCTGACATGGCTGTGGCCCAGG - Intergenic
1121742988 14:96267090-96267112 TCCTGAGATGGCTCTGCCTCTGG - Intronic
1122900479 14:104780311-104780333 GCCTGGGATGCCTGAGTCCCAGG + Intronic
1123661834 15:22571512-22571534 TCCTGAGGTGGCTTGGTGCCAGG + Intergenic
1123696611 15:22883366-22883388 TCCTGAGAAGGCAGCTCCCCCGG - Intronic
1124262376 15:28204033-28204055 TCCTGAGGTGGCTTGGTGCCAGG - Intronic
1124315633 15:28665755-28665777 TCCTGAGGTGGCTTGGTGCCAGG + Intergenic
1130650574 15:85760083-85760105 CACTGAGATGGATGCGGCCCTGG + Exonic
1131175754 15:90208568-90208590 TCCTGAGAGGGCTGCCTTGCAGG - Intronic
1132319946 15:100918596-100918618 TCCTGAGCAGGCTTTGTCCCCGG + Intergenic
1132884751 16:2177747-2177769 TCCTGGCGTGGCTGCGTCCCAGG - Exonic
1134387070 16:13783424-13783446 TCTTGAGATGGCTGCAACTCTGG - Intergenic
1136226570 16:28864099-28864121 TCCCGAGGTGGATGCGGCCCCGG + Intronic
1137293241 16:47066459-47066481 GCCTGTGTTGGCTGGGTCCCTGG + Intergenic
1137977798 16:53045833-53045855 TTCTGAGCTGGCTGCTTACCAGG - Intergenic
1138052878 16:53799722-53799744 TGCTGAAATGGCAGCGTTCCTGG + Intronic
1140860490 16:79013617-79013639 TCCTGTGCTGCCTGGGTCCCGGG + Intronic
1143858353 17:9869538-9869560 CCTTCAGATGGCTGCGGCCCTGG - Intronic
1145960199 17:28882722-28882744 TCCCCAGCTGGCTGGGTCCCTGG - Intronic
1146662729 17:34675322-34675344 TCCTGGGATCCCTGCCTCCCTGG - Intergenic
1150445526 17:65224869-65224891 GCCTGATATGGCTGCCTCCTAGG - Intronic
1150521064 17:65866634-65866656 TTCTGATATGGCTGGGTCCGGGG - Intronic
1153594765 18:6714237-6714259 TCCTGAGATGTCTGCTTCTTGGG + Intergenic
1157053091 18:44192655-44192677 TCCTGAGATGAATGCTTCCAGGG - Intergenic
1157523600 18:48362167-48362189 ACCTGAGATAGCTCTGTCCCAGG - Intronic
1160015637 18:75138318-75138340 TCCAGAGAAGGCAGCGTTCCAGG - Intergenic
1160039841 18:75335383-75335405 TCCTGAGATGTGTGACTCCCAGG + Intergenic
1160043416 18:75365730-75365752 CCCTGAGATGGCTGAATCCTGGG + Intergenic
1161106085 19:2444767-2444789 TCCTGGGATGGCTGGGACCCAGG - Intronic
1161163708 19:2774176-2774198 TCCTGAGATGCCTGCTTGCCAGG - Intronic
1165595935 19:37011329-37011351 TCATGGGATGGCTGCGTGGCTGG + Intronic
1165936992 19:39395435-39395457 TCCTGCCATGGCTGCGCCCTTGG - Intronic
1166357442 19:42235523-42235545 TCCTGACATGGCTGCTTCCTAGG + Intronic
1168154460 19:54465153-54465175 GCCTGGGGGGGCTGCGTCCCGGG + Exonic
926205741 2:10833366-10833388 GCCTGAGAAAGCTGCCTCCCAGG - Intronic
927910352 2:26893387-26893409 TTCTGGGAAGGCTGTGTCCCAGG - Intronic
929404468 2:41625812-41625834 TCTTGAGATGACTGCGTCATTGG - Intergenic
931301242 2:60980457-60980479 ACCTGTGATGGCAGCTTCCCTGG + Intronic
932453315 2:71829992-71830014 GCCTGGGAAGGCTGAGTCCCAGG + Intergenic
938223048 2:129588008-129588030 TCCTGACCGGGCTGTGTCCCAGG + Intergenic
938902059 2:135806897-135806919 TCCTGAGATGGGTGCTTGCAGGG - Intronic
940757416 2:157699184-157699206 TCCTGGGACCGCTGGGTCCCAGG - Intergenic
944685846 2:202117050-202117072 TCTTCAGATGACTGCATCCCTGG + Intronic
947987186 2:234458678-234458700 CCTTGAGATGGCTGCAACCCTGG + Intergenic
948723616 2:239918821-239918843 TCCTGAACTGGCTGTGTCCTTGG - Intronic
948952663 2:241264519-241264541 TCCTGAGAAAGCTGCTTGCCTGG - Exonic
949021691 2:241744453-241744475 TCCAGAGGTGGCTGGGTCCTGGG + Intronic
1168903461 20:1385608-1385630 TCCTGAGATGGGGGAGTCACAGG - Intronic
1169317994 20:4609126-4609148 ACCTGCCATGGCTGCCTCCCAGG - Intergenic
1170173059 20:13436746-13436768 TCTTGAGTTGGCTGCGTTGCTGG - Intronic
1173598450 20:44275487-44275509 TCCTGTGATGGCTGCTTTCCTGG - Intronic
1173822368 20:46028056-46028078 TCCTGAGATGTCTGCACCACTGG + Intronic
1179788083 21:43741069-43741091 TCCTGCGGGAGCTGCGTCCCAGG - Intronic
1179883654 21:44304302-44304324 TGCTGAGATGGCTGTGACCCTGG + Intronic
1179983675 21:44909560-44909582 GCCTGAGATGGCTGAGTGCAGGG + Intronic
1181138664 22:20787524-20787546 TCTTGAGGTGGCTTCTTCCCTGG - Exonic
1181531450 22:23519796-23519818 TCCGGGGCTGGCTGTGTCCCAGG - Intergenic
1183357743 22:37368595-37368617 TCCAGAGGTGGCTGAGCCCCAGG - Exonic
1185270444 22:49927117-49927139 CCCTTGGATGGCTGCGTCCGGGG + Intronic
950189874 3:10969359-10969381 CCCTGAGATAGCTGCATCCCAGG + Intergenic
950437973 3:12992105-12992127 TCCTGAGAGGGCTGCTTCCTGGG - Intronic
951419848 3:22471464-22471486 TCCTGTTCTGGCTGAGTCCCTGG + Intergenic
952828142 3:37540984-37541006 CCCTGAGATGGCAGAGGCCCAGG + Intronic
953415334 3:42712345-42712367 TTCTGGGATGGCTGACTCCCAGG - Intronic
953876266 3:46668460-46668482 TCCTGTAAGGGCTGAGTCCCAGG - Intergenic
954147165 3:48640199-48640221 TCCCGAGGTGGCTGCCTCCGTGG + Exonic
954198158 3:49008167-49008189 TCCTGAGATGGTTGAGGTCCAGG + Intronic
955940999 3:64147048-64147070 TCCTGAGATCTCAGCCTCCCCGG + Exonic
958958243 3:100484938-100484960 CCCTCAGATGGCTGCTTCACAGG + Intergenic
961684040 3:128617428-128617450 TCCTGTGGTGGGTGCATCCCTGG - Intergenic
963960599 3:151304951-151304973 TGCTGAGATGGCTGTGTGGCTGG + Intronic
964132911 3:153311213-153311235 CCCTGAGATGGCTGCAGACCTGG + Intergenic
965217753 3:165885526-165885548 TCCTGAGGAGGCTGTGTCACGGG - Intergenic
968673839 4:1866422-1866444 GCCTGAGGTGTCTGAGTCCCAGG + Intergenic
968765103 4:2464022-2464044 TGCTGAGATGCCTGCCTTCCTGG - Intronic
969705789 4:8790472-8790494 TCCTGAGATGGGTGGGTCTCAGG + Intergenic
970205924 4:13655307-13655329 TGCTGAGATGTCTGCGTGCTTGG + Intergenic
978809108 4:112831021-112831043 TGGTGAGATGGCTGAGGCCCAGG - Intronic
983017300 4:162628878-162628900 TCCAGAGATGTCTGGGACCCAGG - Intergenic
985103935 4:186483760-186483782 TCCTGAGGTGGCCGCGTTACGGG - Intronic
985103956 4:186483868-186483890 TCCTGAGGTGGCCGCGTTACGGG - Intronic
985103965 4:186483904-186483926 TCCTGAGGTGGCCGCGTTACTGG - Intronic
986074016 5:4315881-4315903 TCCTGAGCTAGGTGCTTCCCTGG + Intergenic
988817702 5:34850947-34850969 TCTTGAGCTGGCTATGTCCCTGG - Intronic
995534292 5:113119772-113119794 TCCTGAGAAGACTGAGTTCCTGG - Intronic
996372935 5:122772493-122772515 TCTTGAGATGACTGCCTACCTGG + Intergenic
998170644 5:139870367-139870389 TCCTCAGCTGGCTTCCTCCCTGG - Intronic
998189577 5:140011692-140011714 GCCTGAGATGACTGCATCCCTGG + Intronic
998562182 5:143181953-143181975 CCCTGACACGGCTGCCTCCCTGG + Intronic
999256348 5:150211811-150211833 TGCTGAGAAGGCTGAGTACCAGG - Intronic
1004025438 6:11813748-11813770 TAATGAGATGGATGTGTCCCTGG - Intergenic
1011544022 6:88465140-88465162 CCCTGAGATGACTGCAGCCCTGG - Intergenic
1016906152 6:149152599-149152621 TCCTGAGAGGTCTGAGCCCCTGG - Intergenic
1017770819 6:157643208-157643230 TCCTGAGTCAGCTGGGTCCCAGG + Intronic
1019234063 6:170594643-170594665 TCTTGAGATGGCTGCAACCAGGG + Intergenic
1019718709 7:2555235-2555257 GCCCGGGAAGGCTGCGTCCCGGG + Intronic
1020354975 7:7266013-7266035 TGCTCAGATGGCTACGTGCCTGG + Intergenic
1020457910 7:8395094-8395116 TCCTGAGATGGCGGAGACTCAGG - Intergenic
1024626667 7:51213667-51213689 TTCTGAGAGGCCTGGGTCCCGGG + Intronic
1025101455 7:56138757-56138779 TCCTGAGATGTCAGAGTTCCTGG - Intergenic
1026239069 7:68556107-68556129 TCCTGAGATCCCTGGGTCCTTGG + Intergenic
1027565124 7:79782068-79782090 TCCTGGTATTGCTGCCTCCCAGG + Intergenic
1027931057 7:84535730-84535752 TCCAGAGATTGCTGTGTCCTGGG + Intergenic
1029420892 7:100471330-100471352 TACTGGGATGCCTGTGTCCCAGG - Intronic
1031436024 7:121732963-121732985 CCCTGAGAAGTCTGCGACCCTGG + Intergenic
1035074843 7:156170415-156170437 TTCTGAGATGTCTGCCTGCCGGG + Intergenic
1035370780 7:158377603-158377625 GCCTGTGATTGCTGAGTCCCGGG - Intronic
1035659336 8:1334953-1334975 GCCTGCGAGGGCTGGGTCCCGGG - Intergenic
1036645969 8:10611591-10611613 TCTTGGGCCGGCTGCGTCCCAGG + Exonic
1036711377 8:11081550-11081572 TCCTGAGATGGAAGAGCCCCAGG - Intronic
1038388379 8:27171582-27171604 TCCAGAGAAGGCTATGTCCCGGG - Intergenic
1038455921 8:27671927-27671949 TCCCGAGGTAGCTGCCTCCCTGG - Exonic
1042039249 8:64575732-64575754 CGCTGAGAAGGCTGCCTCCCGGG + Intergenic
1042144007 8:65708613-65708635 TTCTGAGATGCCTGCCTCTCTGG - Intronic
1046950890 8:120018783-120018805 GCCTGAGATGGCAGCTTCTCAGG + Intronic
1047187331 8:122645869-122645891 CCCTGAGATTGCTGCAACCCAGG + Intergenic
1047255121 8:123208318-123208340 TCCTCAGCTAGCTGCATCCCTGG - Exonic
1047802217 8:128321922-128321944 TCCTGCCATGCCTGAGTCCCTGG + Intergenic
1048870299 8:138791686-138791708 CTCTGAGAAGGCTGCATCCCAGG + Intronic
1049468656 8:142765268-142765290 TCCTGAGAGGGCTGGATCACAGG - Intronic
1049621096 8:143598650-143598672 TCCGGAGCAGGCTGCGCCCCCGG + Exonic
1055500064 9:76894423-76894445 CCCTGAGAAGGCAGTGTCCCTGG - Intronic
1060751215 9:126170696-126170718 TCTTGACATGGCAGCATCCCAGG + Intergenic
1062440288 9:136566605-136566627 GCCAGAGGTGGCTGCGCCCCAGG - Intergenic
1062524019 9:136971001-136971023 TTCTGAGCTGGCTGCTTCTCCGG - Exonic
1188199792 X:27283964-27283986 CCCTGAGATGGCTGGATCCACGG + Intergenic
1189125162 X:38437983-38438005 TCCTGAGATGTCTGAGCCCTTGG - Intronic
1192687230 X:73319771-73319793 TCTTGACATGGCTGCAACCCAGG + Intergenic
1193574772 X:83184143-83184165 TCCTGAGATGGCTGCGAGGAGGG + Intergenic
1200701437 Y:6405941-6405963 TCCTGGGGTGGCTGTCTCCCAGG - Intergenic
1201032674 Y:9758757-9758779 TCCTGGGGTGGCTGTCTCCCAGG + Intergenic
1202176230 Y:22101387-22101409 TCCTGGGGTGGCTGTCTCCCAGG - Intergenic
1202215131 Y:22484997-22485019 TCCTGGGGTGGCTGTCTCCCAGG + Intergenic