ID: 1083894623

View in Genome Browser
Species Human (GRCh38)
Location 11:65613841-65613863
Sequence GGCCCGGATGCCCAGGTTCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 197}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083894623_1083894640 19 Left 1083894623 11:65613841-65613863 CCCGGAACCTGGGCATCCGGGCC 0: 1
1: 0
2: 0
3: 17
4: 197
Right 1083894640 11:65613883-65613905 CCACGCCTCTCTGGGGAGCCAGG 0: 1
1: 0
2: 4
3: 22
4: 235
1083894623_1083894632 10 Left 1083894623 11:65613841-65613863 CCCGGAACCTGGGCATCCGGGCC 0: 1
1: 0
2: 0
3: 17
4: 197
Right 1083894632 11:65613874-65613896 GCCCCAGACCCACGCCTCTCTGG 0: 1
1: 0
2: 0
3: 29
4: 239
1083894623_1083894636 12 Left 1083894623 11:65613841-65613863 CCCGGAACCTGGGCATCCGGGCC 0: 1
1: 0
2: 0
3: 17
4: 197
Right 1083894636 11:65613876-65613898 CCCAGACCCACGCCTCTCTGGGG 0: 1
1: 0
2: 0
3: 20
4: 247
1083894623_1083894634 11 Left 1083894623 11:65613841-65613863 CCCGGAACCTGGGCATCCGGGCC 0: 1
1: 0
2: 0
3: 17
4: 197
Right 1083894634 11:65613875-65613897 CCCCAGACCCACGCCTCTCTGGG 0: 1
1: 0
2: 0
3: 17
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083894623 Original CRISPR GGCCCGGATGCCCAGGTTCC GGG (reversed) Exonic
900102409 1:967469-967491 TGCCCTGAAGCCCAGGTTCCTGG - Intronic
900613793 1:3555336-3555358 GGCCCTGAGGGCCAGGTTCCAGG + Intronic
900806717 1:4772373-4772395 GGCCCGGGTGCCCAGCAGCCTGG + Exonic
901011636 1:6205879-6205901 GGCCAGGACGCCAAGGCTCCAGG - Intronic
901853727 1:12031321-12031343 GGACCAGAGGTCCAGGTTCCTGG - Exonic
902333760 1:15743254-15743276 GGCCCTGCTGCCCACATTCCGGG - Intronic
903773295 1:25777547-25777569 GGCGCGGCAGCCCAGGTGCCTGG + Intronic
903929897 1:26856113-26856135 GGCCCTGGTGCCCAGGTTGGAGG - Exonic
904746787 1:32716388-32716410 TGGCGGGATGCCCAGGTTTCTGG + Intergenic
905272807 1:36797917-36797939 GGCCAGGATTCCCATCTTCCAGG + Exonic
905922756 1:41730253-41730275 GGGGCAGAGGCCCAGGTTCCTGG - Intronic
907299444 1:53477386-53477408 TCCGTGGATGCCCAGGTTCCAGG + Intergenic
908200824 1:61793688-61793710 GGCTCTGTTGCCCAGGTTGCAGG - Intronic
914806945 1:150998649-150998671 GGTCCGCATGCTCAGGGTCCGGG - Intronic
921047465 1:211487721-211487743 GGCCTCGATGCCCAGGCTCGTGG - Intronic
922742058 1:228019523-228019545 GGGCCGGGTACCCAGGCTCCAGG - Intronic
923053234 1:230403613-230403635 CGCCTGGATTCCCAGGCTCCAGG + Intronic
1067789428 10:49276579-49276601 AGCCAGGATGCCCAGGCTACTGG + Intergenic
1070640326 10:78164231-78164253 GCCCCTGAAGCCCAGGTGCCTGG - Intergenic
1070766873 10:79061781-79061803 AGCCCGGCTGCCCAGGGGCCTGG - Intergenic
1071299784 10:84247802-84247824 GGCCTGGCTGCCCAGGGCCCAGG - Intronic
1073063582 10:100745875-100745897 CTCTCGGATGACCAGGTTCCAGG + Exonic
1073442293 10:103559302-103559324 TGACCGGATGCCCACCTTCCTGG - Intronic
1073535102 10:104269214-104269236 GGTCCGGTTGCCCGAGTTCCCGG + Exonic
1076555878 10:131321104-131321126 GGCCCAGGGGCCCAGGATCCTGG - Intergenic
1076662525 10:132065020-132065042 GGCCTGCACGCCCAGGTTCTGGG - Intergenic
1077147247 11:1051779-1051801 GGCCCAGCTTCCCAGGTGCCAGG - Intergenic
1077283797 11:1757053-1757075 GGCCCAGCTGCCAAGGTCCCAGG + Intronic
1081631750 11:44694158-44694180 TGCCCGGATGCCCCTGTTCAGGG + Intergenic
1083482840 11:62960754-62960776 GGGCCGAAGGCCCAGGCTCCGGG - Intronic
1083805347 11:65070245-65070267 GGCCAGGATGCCAAGGGCCCTGG + Intronic
1083894623 11:65613841-65613863 GGCCCGGATGCCCAGGTTCCGGG - Exonic
1083912809 11:65720076-65720098 GGCCCGGATGCCAAAGTGCGTGG - Exonic
1084213080 11:67632755-67632777 GGCCAAGAGGCCCAGGTGCCAGG - Intronic
1084490546 11:69476096-69476118 GGCCCCGATCCCCATGTTCTGGG - Intergenic
1085442574 11:76577875-76577897 AGCCCGGAGGCCCGGATTCCTGG - Intergenic
1085485560 11:76860659-76860681 GGCCAGGAAGCCCAGGCCCCCGG + Intergenic
1087087201 11:94231903-94231925 GGCCTGGATTGCCAGGTACCAGG + Intergenic
1091279255 11:134372788-134372810 GGCCCTGATCCCCAGGATCCAGG - Intronic
1092531581 12:9349617-9349639 GGCTGGGATGCCCACGATCCAGG + Intergenic
1094607297 12:31959645-31959667 GGGCCCGAGGCCCGGGTTCCGGG - Intronic
1096111435 12:49031504-49031526 GGTCCAGATGCCCAGGTACCAGG + Exonic
1103749712 12:123150668-123150690 CGCCCAGATCCCCAGGTCCCCGG + Intergenic
1104843501 12:131835474-131835496 GGCCAGGCTGCCCAGCTCCCTGG + Intronic
1104966060 12:132509297-132509319 GGCAGGGCTGCCCAGGGTCCGGG - Intronic
1105855276 13:24366307-24366329 GGCCCTGCTGCCCTGGGTCCTGG + Intergenic
1107454996 13:40546617-40546639 GGCCCAGATGCGCAAGCTCCTGG + Intergenic
1108371536 13:49774391-49774413 GGCCTGGATGTCCAGCTGCCTGG + Intronic
1113535606 13:111064054-111064076 GGCCCTGAAGCCCAGGGCCCAGG + Intergenic
1114527508 14:23375950-23375972 GGCCAGGATGCCCAGATGCTTGG + Exonic
1118461910 14:65995146-65995168 GGCCCGACTGGCCAGATTCCAGG - Intronic
1120694038 14:87623967-87623989 GGCCTGGATGACCACTTTCCAGG - Intergenic
1121605085 14:95234614-95234636 GGCCAGGATGCCCAAGTGCCGGG + Intronic
1122203502 14:100136746-100136768 TGCCAGGATGCATAGGTTCCTGG + Intronic
1122543200 14:102509178-102509200 GGCCCGGAGGCCCAGGCTTGGGG - Intronic
1124688256 15:31800368-31800390 GGCACCTATGCCCAGGGTCCTGG + Intronic
1126883585 15:53125426-53125448 GGGCAGGATGCCTGGGTTCCAGG + Intergenic
1132498711 16:275560-275582 GGCCGGGATGCCCCGGATCCGGG + Intronic
1132879391 16:2155216-2155238 GGCCTGGACGCCCAGGGACCTGG + Intergenic
1133139210 16:3731988-3732010 GGCACGGACGCCCAGCTCCCAGG + Intronic
1134036253 16:11033436-11033458 TGCCCTGAGGCCCAGGTGCCTGG + Intronic
1134747464 16:16599342-16599364 AGCCTGGATCCCCAGCTTCCTGG - Intergenic
1134831765 16:17329672-17329694 GACCCGGAGGCACAGGTTGCTGG - Intronic
1136456488 16:30382488-30382510 GGCCGAGATGCCCAGGTTTCTGG + Intronic
1138389121 16:56657666-56657688 GGCCAGGATCTCCAGGTACCCGG + Intronic
1138506214 16:57479551-57479573 GGGAAGGATGCCCAGGTGCCTGG + Exonic
1139913562 16:70414156-70414178 GGCAGGGATGCCCAGTTTCCTGG - Intronic
1140094838 16:71866106-71866128 GGCCCAGAAGTCCAGGATCCAGG - Intronic
1142200716 16:88759951-88759973 GGCCCGGATGCCAGGGTGGCTGG - Intronic
1142420399 16:89966286-89966308 GGCCCGGATGCCCTGGTCCAGGG - Exonic
1143568383 17:7739079-7739101 GCCCCGTTTGCCCTGGTTCCTGG - Intronic
1145251431 17:21298883-21298905 GGTCCGGGAGTCCAGGTTCCGGG - Exonic
1146283292 17:31559045-31559067 GGCCCGGGTTCCCAGGTCCCGGG - Intergenic
1147138634 17:38449362-38449384 GTGCGGGGTGCCCAGGTTCCCGG + Intronic
1148076950 17:44942657-44942679 GGGCCGGGTGCCCAGGCACCTGG - Intronic
1148547030 17:48526976-48526998 AGCCCAGATGCCCAGGGGCCAGG - Intergenic
1148958180 17:51371078-51371100 TGCCCGGCTGCCGGGGTTCCTGG - Intergenic
1149076542 17:52602096-52602118 GGTCAGGGTCCCCAGGTTCCAGG - Intergenic
1149560186 17:57603074-57603096 GGCCTGGAGGTCCAGGTGCCAGG - Intronic
1149682804 17:58517652-58517674 AGCCCAGGTGCCCAGGTTCTAGG + Intronic
1150060478 17:62065037-62065059 GGTCCAGATGCCCGAGTTCCCGG - Intronic
1150267306 17:63839774-63839796 GGCCCTCAGGCCCAGGTTCCAGG - Intronic
1151336849 17:73444852-73444874 GGCCTGGATACCCTGGCTCCTGG - Intronic
1151552480 17:74830100-74830122 GGCCCTGATGCTCATGTTCGGGG - Intronic
1151835912 17:76582708-76582730 GTCCCAGATGCCCATCTTCCTGG + Intronic
1152392577 17:80011455-80011477 GGCCCAGGTGCCCAGCTTCATGG + Intronic
1152394731 17:80025541-80025563 GGCCCCGAAGCCCAGGTGCCAGG - Intronic
1152539885 17:80969535-80969557 GGCCCGGGTGCAGGGGTTCCGGG - Intergenic
1152584201 17:81181841-81181863 GGCTCAGAGGCCCAGGCTCCCGG + Intergenic
1152646070 17:81469100-81469122 GGCCGAGGGGCCCAGGTTCCTGG - Intergenic
1153265199 18:3262446-3262468 GGCCCGGACGTCCAGGGGCCGGG + Exonic
1153969678 18:10215067-10215089 GGCCCGGAAGCCCAGGTCAGAGG - Intergenic
1160826617 19:1083178-1083200 GAACACGATGCCCAGGTTCCCGG - Exonic
1161716495 19:5879087-5879109 GGCCCAGGTGCCCAGGTCGCTGG - Intronic
1161837423 19:6657465-6657487 GGCACGGCTGCCCTGGTTCAAGG - Intergenic
1162609655 19:11739115-11739137 GAGCCGGATGAACAGGTTCCAGG + Intergenic
1162664128 19:12195320-12195342 GGACAGGATGCCCGGGGTCCCGG - Intergenic
1163372263 19:16907955-16907977 GGCCAGGATGCCCAAGTGCATGG + Intronic
1163607401 19:18282490-18282512 GGCCTGGACTCCCAGGTTCTAGG - Intergenic
1163632730 19:18425457-18425479 GGCCAGGGTGAGCAGGTTCCAGG - Intronic
1163666505 19:18606309-18606331 GGCCCAGCTGCCCAGGTAACAGG + Intronic
1163766847 19:19168171-19168193 GTCCCGAATGCCCAAGGTCCAGG + Intronic
1164188453 19:22893980-22894002 GGCCCGGCGGCCCCTGTTCCAGG + Intergenic
1165102582 19:33447580-33447602 GGCCTAGATGCCCAGGAGCCAGG - Intronic
1165408181 19:35643164-35643186 GGCCCGGCTGACCCGGATCCAGG - Intronic
1166670148 19:44704653-44704675 GCCCCGGAGGCCGAGGTTGCAGG + Intronic
1166702536 19:44890688-44890710 GGCCCGGCTGCCGCGGTGCCTGG + Intronic
1167110791 19:47459878-47459900 TGCCCAGCTGCCCAGGTGCCAGG + Intronic
1167387393 19:49171857-49171879 GGCCTGGACTTCCAGGTTCCGGG + Intronic
1167722029 19:51185728-51185750 GGCCGGGATGCCTGGGTCCCTGG + Intergenic
1167756081 19:51414791-51414813 CGCCTGGATGCCAAGGTTCTTGG - Intronic
1167921670 19:52787310-52787332 GGCCTGGACCCCCAGGTTCAGGG - Intronic
1168316395 19:55486562-55486584 GGCCCGCAGGCCCAGCTTCACGG - Exonic
925341880 2:3143336-3143358 GGCTCAGATGCCCATTTTCCTGG - Intergenic
926004117 2:9358771-9358793 GGTCAGGATGCCCAGGTTGGTGG - Exonic
927716458 2:25356253-25356275 GGCCCTGGTGCCCACCTTCCTGG - Intergenic
928363989 2:30687716-30687738 GTCCAGGATGCCCTGGTTCTAGG - Intergenic
929543600 2:42841403-42841425 GTCCTGCATGCCCAGCTTCCAGG - Intergenic
932750432 2:74368147-74368169 TGCTCTGAGGCCCAGGTTCCTGG - Intronic
932797793 2:74712507-74712529 GTCCCAGATGCCCAGGTCACCGG - Intergenic
936463013 2:112725520-112725542 GGCCCAGATGTCCAGCTCCCAGG - Exonic
938295575 2:130176898-130176920 GGCTGTGATGCCCAGGATCCTGG + Intronic
938461048 2:131496926-131496948 GGCTGTGATGCCCAGGATCCTGG - Intergenic
938463417 2:131512041-131512063 GCCCTGGCTGTCCAGGTTCCCGG + Intergenic
940289888 2:152068162-152068184 TGCCCAGATGCCCTGATTCCAGG - Intronic
944937427 2:204583940-204583962 GGCCTGCTTGCCCAAGTTCCTGG + Intronic
946765316 2:223035383-223035405 GGTCTGGATGCCTGGGTTCCAGG - Intergenic
947590016 2:231380140-231380162 TGCCCTGAAGCCCAAGTTCCAGG - Intergenic
947739053 2:232476611-232476633 GGCCCTGATGTCCAGGACCCTGG - Intergenic
1168848830 20:962746-962768 GCCCCGGGTGGCCTGGTTCCAGG + Intronic
1168890867 20:1294728-1294750 GGCTGGGATGACCAGGCTCCGGG + Intronic
1170006555 20:11676125-11676147 GGCCCGGATGACTTGGTTCCTGG + Intergenic
1173723770 20:45282566-45282588 GGCCGTGATGCCCAGGGCCCAGG + Intergenic
1174112928 20:48208525-48208547 GTCCAGGATGCCCACGATCCAGG + Intergenic
1175108226 20:56629217-56629239 GGCGCGGAGGCCCAGGCGCCGGG - Intergenic
1176232706 20:64040273-64040295 GTCCAGGCTGCCCAGGGTCCTGG + Intronic
1179994822 21:44969157-44969179 GGCCCAGCTGCCCAGGCTCGAGG + Intronic
1180057665 21:45367236-45367258 GGGCCGGATGCCCATGGGCCGGG - Intergenic
1180155337 21:45974705-45974727 GGCCGCCATGCCCAGGTGCCGGG + Intergenic
1181078715 22:20400040-20400062 GGCCAGGATGCCCAGGCCCAGGG + Intronic
1183956302 22:41382323-41382345 GGCCTGGATGACCAGGAGCCTGG + Intronic
1185210876 22:49569875-49569897 GGCCCGAGTGCCCGGGGTCCTGG + Intronic
1185388966 22:50548757-50548779 GCCCCGGAAGCCCAGCTCCCGGG + Exonic
950634291 3:14304065-14304087 GGCCTGCAAGCCCAGGTTGCTGG + Intergenic
953173097 3:40525133-40525155 GGCCCAGATGCCCACGGTCCGGG - Exonic
954082494 3:48220828-48220850 GTCCAGGCTTCCCAGGTTCCAGG - Intergenic
954370476 3:50167373-50167395 GGCATGGATCCCCTGGTTCCCGG + Intronic
959064253 3:101640964-101640986 GGCACGGCTGCCCTGGTTCAGGG + Intergenic
961175756 3:124833934-124833956 GGTCAGGATGCCCTGGCTCCAGG - Intronic
965722431 3:171676550-171676572 TGCCCAGATGCCCAGGCACCCGG + Intronic
967976975 3:195040948-195040970 GCCCAGGCTCCCCAGGTTCCTGG + Intergenic
968235808 3:197029580-197029602 GGCCCGGCTGAGCAGGTCCCGGG - Intronic
968520094 4:1031286-1031308 GGCCCCCAGACCCAGGTTCCTGG + Intergenic
969040341 4:4290570-4290592 GACCCAGACGGCCAGGTTCCGGG + Intronic
969258671 4:6020386-6020408 GGCCAGGCTGCCTGGGTTCCAGG + Intergenic
976708683 4:88045466-88045488 GTCCTGTATGCTCAGGTTCCAGG + Intronic
986437589 5:7749042-7749064 GGCAGGGATGCCCATGTTCATGG + Intronic
986814214 5:11390682-11390704 GGCCCGGCTGCCCAGCATCCTGG - Intronic
990925889 5:61022148-61022170 GGCCATGATACCCAGATTCCTGG - Intronic
1003244767 6:4374499-4374521 GGCCCGGCTGGCCATGTTCACGG - Intergenic
1003313983 6:4994804-4994826 GGCCAGGATGTCCAGGGACCGGG - Exonic
1004262032 6:14117386-14117408 CGCTCGGATGGCCCGGTTCCCGG + Intronic
1006182706 6:32163743-32163765 GGCCTGGGTGCCCAGATGCCTGG + Intronic
1014944029 6:127475788-127475810 GCCGCGGATGCCCAGGTGCGAGG + Exonic
1015868718 6:137754092-137754114 TGCCCAGAAGCCCAGGCTCCGGG - Intergenic
1016050679 6:139526879-139526901 GGCCAGGAAGCCCAGGATCAAGG - Intergenic
1016738732 6:147507690-147507712 GGCTCGGATTCCCGGGCTCCAGG + Intergenic
1018784261 6:167095922-167095944 GGCCCCCATGCATAGGTTCCTGG + Intergenic
1019276810 7:180136-180158 GCCCCGGAGCCCCAGGTCCCTGG + Intergenic
1019410555 7:904830-904852 CGCCCGGCCGCCCAGGCTCCTGG + Intronic
1021175164 7:17441399-17441421 GGGCCTGATTCCCAGGTTCCAGG - Intergenic
1022261906 7:28714002-28714024 TGCCCAGGTTCCCAGGTTCCAGG + Intronic
1022358378 7:29637469-29637491 GGCACGGCTGCCCTGGTTCAGGG - Intergenic
1022473240 7:30694458-30694480 GGGCCAGACCCCCAGGTTCCAGG - Intronic
1023943483 7:44785233-44785255 GGCCCAGTTCTCCAGGTTCCTGG - Intergenic
1024035669 7:45505836-45505858 GGCCCGGATGTCCTGTCTCCTGG + Intergenic
1024472192 7:49775546-49775568 GGCCCGGCTGCTCTGGTGCCTGG - Exonic
1025024994 7:55509327-55509349 GGCTGGGATGCCCAGGATCAAGG + Intronic
1025144537 7:56492688-56492710 GCCCCGGATGTCCAGGTCCATGG + Intergenic
1025260139 7:57413163-57413185 GCCCCGGATGTCCAGGTCCATGG + Intergenic
1027177603 7:75914832-75914854 GGGCCGGCTGCCCACCTTCCCGG - Intronic
1029483299 7:100825326-100825348 GGACAGGATGCCCGGGTTCTGGG + Intronic
1031520651 7:122761295-122761317 GGCCTGGCTGCCCATGTTCCAGG - Intronic
1032787281 7:135211131-135211153 AGCCCCGATGCCCCGGCTCCTGG - Intronic
1035633251 8:1124846-1124868 GGCCCGGAACCCCAGGCTCTGGG + Intergenic
1036648212 8:10625364-10625386 ATCCCGAAGGCCCAGGTTCCTGG - Intronic
1037801218 8:22036967-22036989 GGCCCGGGTGCACCGGTTCAAGG - Intergenic
1048055092 8:130855541-130855563 AGCCTTGATGCCCTGGTTCCTGG - Intronic
1048265707 8:132983889-132983911 AGCCCAGGTGCCCAGGTGCCCGG + Intronic
1048329716 8:133463506-133463528 GAGCTGCATGCCCAGGTTCCTGG - Intronic
1049251023 8:141588998-141589020 AGCCCGGCTGCCCAGGACCCTGG - Intergenic
1049718263 8:144103839-144103861 CGCCCGGAACCCCAGGTTCGCGG - Exonic
1049733649 8:144192058-144192080 GACCAAGAGGCCCAGGTTCCTGG - Intronic
1050388556 9:5113619-5113641 GGCCAGGCAGCCCAGGTTCATGG - Intronic
1050554358 9:6776385-6776407 GGCCCGTATTCCCAGCTTCTCGG - Intronic
1056590641 9:87963644-87963666 GGCAGGGATGGCCAGGCTCCAGG - Intergenic
1056687611 9:88779309-88779331 GGCCTGGATGCCAAGTTCCCTGG + Intergenic
1058703398 9:107619536-107619558 GGCCTGGATTCCAAGGATCCAGG - Intergenic
1061231920 9:129320334-129320356 GGAGGGGAGGCCCAGGTTCCCGG + Intergenic
1061816408 9:133199914-133199936 GGCCGGGGTGCCCAGGTCTCAGG - Intergenic
1062050413 9:134444095-134444117 GGACTGTAGGCCCAGGTTCCAGG + Intergenic
1062566641 9:137166627-137166649 GGCCTGGCTGCTCAGCTTCCTGG + Intronic
1185450781 X:280194-280216 CCTCCGGATGCCCAGGGTCCCGG - Intronic
1192383026 X:70636771-70636793 GGCCTGGATGCCTAGGTCCATGG - Intronic
1197335450 X:125205262-125205284 TGCCTGGCCGCCCAGGTTCCTGG + Intergenic
1197800204 X:130340040-130340062 GGCCGGGCTGGCCTGGTTCCCGG + Intronic
1199855364 X:151755081-151755103 GGGCCGGAAACCCAGGTTTCTGG + Intergenic
1200989865 Y:9337278-9337300 TGCCCGGATGCCTAGCTACCCGG + Intergenic
1200992533 Y:9357611-9357633 TGCCCGGATGCCTAGCTACCCGG + Intergenic
1200995185 Y:9377889-9377911 TGCCCGGATGCCTAGCTACCCGG + Intronic
1200997850 Y:9398235-9398257 TGCCCGGATGCCTAGCTACCCGG + Intergenic
1201000359 Y:9466768-9466790 TGCCCGGATGCCTAGCTACCCGG + Intergenic
1201003021 Y:9487081-9487103 TGCCCGGATGCCTAGCTACCCGG + Intronic
1201005680 Y:9507364-9507386 TGCCCGGATGCCTAGCTACCCGG + Intergenic
1201008340 Y:9527694-9527716 TGCCCGGATGCCTAGCTACCCGG + Intergenic