ID: 1083894623

View in Genome Browser
Species Human (GRCh38)
Location 11:65613841-65613863
Sequence GGCCCGGATGCCCAGGTTCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 197}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083894623_1083894632 10 Left 1083894623 11:65613841-65613863 CCCGGAACCTGGGCATCCGGGCC 0: 1
1: 0
2: 0
3: 17
4: 197
Right 1083894632 11:65613874-65613896 GCCCCAGACCCACGCCTCTCTGG 0: 1
1: 0
2: 0
3: 29
4: 239
1083894623_1083894640 19 Left 1083894623 11:65613841-65613863 CCCGGAACCTGGGCATCCGGGCC 0: 1
1: 0
2: 0
3: 17
4: 197
Right 1083894640 11:65613883-65613905 CCACGCCTCTCTGGGGAGCCAGG 0: 1
1: 0
2: 4
3: 22
4: 235
1083894623_1083894634 11 Left 1083894623 11:65613841-65613863 CCCGGAACCTGGGCATCCGGGCC 0: 1
1: 0
2: 0
3: 17
4: 197
Right 1083894634 11:65613875-65613897 CCCCAGACCCACGCCTCTCTGGG 0: 1
1: 0
2: 0
3: 17
4: 235
1083894623_1083894636 12 Left 1083894623 11:65613841-65613863 CCCGGAACCTGGGCATCCGGGCC 0: 1
1: 0
2: 0
3: 17
4: 197
Right 1083894636 11:65613876-65613898 CCCAGACCCACGCCTCTCTGGGG 0: 1
1: 0
2: 0
3: 20
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083894623 Original CRISPR GGCCCGGATGCCCAGGTTCC GGG (reversed) Exonic