ID: 1083895036

View in Genome Browser
Species Human (GRCh38)
Location 11:65615814-65615836
Sequence TTCCGGCCTCCTCCTTAGGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 115}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083895031_1083895036 8 Left 1083895031 11:65615783-65615805 CCACTGCAGGCTGGCGGTTCGCG 0: 1
1: 0
2: 1
3: 5
4: 62
Right 1083895036 11:65615814-65615836 TTCCGGCCTCCTCCTTAGGCCGG 0: 1
1: 0
2: 0
3: 7
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083895036 Original CRISPR TTCCGGCCTCCTCCTTAGGC CGG Exonic
902732561 1:18378905-18378927 TTCAGGCCTCCTCCATGGGTTGG + Intergenic
907892629 1:58650092-58650114 TTACCGTCTCCTCCTTAGGAGGG - Intergenic
912244761 1:107949671-107949693 TTCCTGCTTCCTCCTTAGTGAGG + Intronic
913453476 1:119008098-119008120 GGCCTGCCTCCTCCTTGGGCCGG - Intergenic
913968138 1:143393637-143393659 TTCCGTCCTCCTCCTCGGACAGG + Intergenic
914062519 1:144219227-144219249 TTCCGTCCTCCTCCTCGGACAGG + Intergenic
914116631 1:144747127-144747149 TTCCGTCCTCCTCCTCGGACAGG - Intergenic
915073138 1:153288730-153288752 GCCCTGCCTCCTCATTAGGCAGG + Intergenic
920476060 1:206276679-206276701 TTCCGGGGTTTTCCTTAGGCTGG + Intronic
1062985717 10:1766472-1766494 TCCCTGGCTCCTCCTTGGGCTGG + Intergenic
1066745558 10:38602478-38602500 TTCCCGCTTCCTCCACAGGCAGG - Intergenic
1067474488 10:46556804-46556826 TTCCCGACCCCTCCTCAGGCCGG + Intergenic
1069771407 10:70902861-70902883 TTCCAGTTTCCTCCTTAGGGAGG + Intergenic
1070600592 10:77863907-77863929 TTCCAGCTTCCTCGTAAGGCAGG - Intronic
1071131078 10:82394319-82394341 GCCCAGCCTCCTCCCTAGGCAGG + Intronic
1073076662 10:100828741-100828763 TCCCAGCCTCCTCCTCCGGCAGG + Exonic
1074927831 10:118091815-118091837 TTCCTGCCTCCTTTTTAGGCAGG - Intergenic
1075415176 10:122257485-122257507 TTCCCTCCTCCTCGCTAGGCTGG - Intergenic
1078123056 11:8530060-8530082 GTCCTGCCTGCTCCTTAGGATGG + Intronic
1081599634 11:44484196-44484218 TCCCTCCCTCCTCCTCAGGCTGG - Intergenic
1081799416 11:45847669-45847691 TCGCGGCCTCCTCCTCAGTCGGG + Exonic
1083224547 11:61276676-61276698 CTCTTGCCTCCTCCTCAGGCTGG - Exonic
1083258714 11:61511632-61511654 GCCCAGCCTCCTCCTTAGCCAGG - Intergenic
1083630185 11:64091263-64091285 TCCCAGCCTCCTTCTGAGGCAGG - Intronic
1083895036 11:65615814-65615836 TTCCGGCCTCCTCCTTAGGCCGG + Exonic
1084410632 11:69004240-69004262 CTCAGGCCTCCTCCTGGGGCTGG - Intergenic
1088378309 11:109166134-109166156 TTCCAGCCTCCTCCTTATCCAGG + Intergenic
1091009309 11:131983885-131983907 TTCTGTCCTCTTCCTTTGGCTGG - Intronic
1091796396 12:3299696-3299718 TTCTGGCCTCCCCCTTAGCATGG - Intergenic
1092308132 12:7322741-7322763 TTCCTGCCTCCCCCTTATGCAGG + Intronic
1092764855 12:11843263-11843285 CACAGGCATCCTCCTTAGGCAGG + Intronic
1095261800 12:40106141-40106163 GTCCCGCCCCCTCCTTGGGCGGG + Intergenic
1097825848 12:64173842-64173864 GCCCAGCCTCCTCCTTATGCAGG + Intergenic
1101918736 12:108915948-108915970 TTCCGGCCTGCCCCTGAGGTTGG - Intronic
1103269951 12:119665034-119665056 TTGGGGCCTCCTCCATAGGATGG - Intergenic
1104786003 12:131448336-131448358 TTCTGGCCTCCTCCTGGGTCAGG - Intergenic
1104983242 12:132583130-132583152 TGGCGGCCTCCTCCTTGGCCGGG - Exonic
1112374472 13:98825873-98825895 TCCCCGGCTCCTCCTCAGGCAGG + Exonic
1112752509 13:102597083-102597105 CTCCGGTCTCCTTCTTCGGCAGG - Exonic
1118349499 14:64963535-64963557 CTCCAGCCTCCTTCTCAGGCAGG + Intronic
1122817644 14:104321451-104321473 TTCCTGCCCCCTCCTGAGTCTGG + Intergenic
1124597256 15:31101697-31101719 TTTCAGCCTCCTCCTTGGCCAGG + Intronic
1129300702 15:74623930-74623952 CTCCGGCCTCCTCCTAAAACAGG - Intronic
1130236154 15:82135679-82135701 TCCCAGCCTCCTTCTTAGGTGGG + Intronic
1131152969 15:90058372-90058394 GTCCTGCCTCCTCCTTGGGGTGG - Intronic
1132814102 16:1817756-1817778 TTCCGGCCTCGGCCTCAGGACGG + Intronic
1135233046 16:20727669-20727691 TTCCTGCCTCCCCCTCATGCAGG + Intronic
1136490620 16:30605385-30605407 TTCGGGGTGCCTCCTTAGGCGGG + Exonic
1136737508 16:32477171-32477193 TTCCCGCTTCCTCCACAGGCAGG + Intergenic
1138284215 16:55795404-55795426 GTCCAGCCTCAACCTTAGGCAGG - Intergenic
1138284787 16:55801583-55801605 GTCCAGCCTCAACCTTAGGCAGG + Intergenic
1203015563 16_KI270728v1_random:352406-352428 TTCCCGCTTCCTCCACAGGCAGG - Intergenic
1203033898 16_KI270728v1_random:625564-625586 TTCCCGCTTCCTCCACAGGCAGG - Intergenic
1143041781 17:4043504-4043526 TCCCAGCCTCCTCCTTATGGTGG - Intronic
1151964874 17:77426031-77426053 TGGAGGCCTCCTCCTGAGGCTGG - Intronic
1155354382 18:24937285-24937307 TTCCAGCCTCCTTCTGAGTCAGG - Intergenic
1163510613 19:17733078-17733100 TTCAGGCCTCCTGCTGAGGAGGG + Intronic
1163871080 19:19821754-19821776 TTCCGGCTTCCGGCTTTGGCGGG - Intergenic
1164946097 19:32294402-32294424 TTCCAGCCTCCTTTCTAGGCAGG - Intergenic
1166097640 19:40551033-40551055 TTTCGGACTGCTCCTTGGGCTGG + Intronic
1166461471 19:42991916-42991938 TTCTGGCTTCCTCCTTGGGAAGG + Intronic
1166534375 19:43563086-43563108 TGCCGGCCTCAGCCTTAGGCAGG - Intronic
1168471423 19:56643482-56643504 TTCCAGCCTCCTCGTGAGGAGGG + Intronic
1202701925 1_KI270712v1_random:171105-171127 TTCCGTCCTCCTCCTCGGACAGG + Intergenic
928236508 2:29546519-29546541 TTCCGTCCTCCTCCTCCAGCAGG - Intronic
929039767 2:37732619-37732641 TTCCTGCTTCCTTCTTTGGCAGG - Intronic
932257658 2:70301521-70301543 TTCCGGCCTCCCCGTTGGCCAGG - Intronic
934172837 2:89554551-89554573 TTCCGTCCTCCTCCTCGGACAGG + Intergenic
934188641 2:89766284-89766306 TTCCCGCTTCCTCCACAGGCAGG + Intergenic
934283151 2:91628904-91628926 TTCCGTCCTCCTCCTCGGACAGG + Intergenic
935590339 2:104842371-104842393 ATCCAGCCTGCTCGTTAGGCTGG - Intergenic
935736962 2:106113957-106113979 TTTCGGCCAACACCTTAGGCTGG + Intronic
937051545 2:118895516-118895538 TTACGGCCTCTACCTGAGGCGGG - Intergenic
942857146 2:180562430-180562452 CTCCAGCCTCATTCTTAGGCTGG - Intergenic
943298743 2:186171514-186171536 TTTTGGCTTCCTACTTAGGCTGG + Intergenic
947700302 2:232228642-232228664 TTACTGCCTCCTGCTCAGGCTGG + Intronic
948605811 2:239134151-239134173 TTCCTGTCTCCTCCAAAGGCAGG + Intronic
948756958 2:240165573-240165595 TTACGGACCCCTCCTTAGCCTGG - Intergenic
1172293670 20:33793114-33793136 TTCCCGCCTCCTCATGAGCCCGG - Intergenic
1174423835 20:50418148-50418170 TTCCTGCCTCTTCCTAAGACTGG - Intergenic
1180535041 22:16388752-16388774 TTCCCGCTTCCTCCACAGGCAGG - Intergenic
1181134050 22:20751859-20751881 TCCCGACCTCCTCCTTCAGCTGG - Intronic
1183350006 22:37329806-37329828 TGCCAGCCTTCTCCTTTGGCCGG + Intergenic
950672350 3:14534904-14534926 TTCCAGCCACCCGCTTAGGCAGG - Intronic
954214589 3:49117238-49117260 TCCGGGCCTCCTGCTTAGCCCGG + Exonic
956881873 3:73519249-73519271 CTCTGGCCTCCTCTTTACGCTGG - Intronic
958702023 3:97604084-97604106 TTATAGCCTCCTCCTTAGGGTGG - Intronic
961469189 3:127100816-127100838 TTCCCGCCTCCTCCGTGGCCTGG - Intergenic
963140433 3:141942211-141942233 TTCCGGCCTCTCCCTGAGACAGG + Intergenic
967705828 3:192649670-192649692 TTCCGCACTCCTACTTAGGAAGG - Intronic
967991059 3:195131107-195131129 TGCCGGCCTGCTCCATTGGCCGG + Intronic
968880842 4:3299166-3299188 TTCCGGCTGCCTCCTTCTGCTGG + Intronic
968896732 4:3408699-3408721 TTCTGTCCTGATCCTTAGGCAGG + Intronic
969438315 4:7201174-7201196 TTCCAACCTCCTCCTCAGCCCGG - Intronic
978122305 4:105094473-105094495 TTCTGGCCTTCTCCATAGTCTGG - Intergenic
985073553 4:186191466-186191488 TTCCGGCCGCCTCCGGATGCGGG - Intergenic
990976472 5:61565643-61565665 TTCCTGCCTTTTCCTCAGGCCGG + Intergenic
993040588 5:82810383-82810405 TTCCTGCCTCCTGCCTAGCCAGG + Intergenic
995780541 5:115770543-115770565 TACCCCCCTTCTCCTTAGGCTGG - Intergenic
997209643 5:132069839-132069861 GTCCGGCCTCCACCTGAGTCAGG - Intergenic
999206120 5:149849280-149849302 TTCCGGCCTTGTCCATGGGCTGG - Exonic
1000197919 5:158977847-158977869 CTCCTCCCTCCTCCTAAGGCAGG - Intronic
1000712990 5:164604087-164604109 TTCCCCCATCCTCCATAGGCGGG + Intergenic
1001395690 5:171418756-171418778 TTCCGGCCTCCTCCCAAAACCGG - Intergenic
1003456393 6:6286545-6286567 TTCTTGCCTCCTCATAAGGCAGG - Intronic
1006801146 6:36760375-36760397 TTCCACCCACCTCCTTAGCCTGG - Intronic
1010185495 6:73139086-73139108 TGCCTGCCTCCTCCTCAGGCTGG + Intronic
1013175515 6:107673411-107673433 TTTCGGCCTCCCCCTCGGGCTGG - Intergenic
1013465271 6:110412511-110412533 TTCTGGCCTCCTGCTGAGGGTGG + Intronic
1014755881 6:125301765-125301787 TTCCGGCCTCCCCGCTCGGCCGG - Intronic
1023708488 7:42967072-42967094 TTCCTTCCTCCTCCTTTGGGAGG + Intergenic
1023956637 7:44891876-44891898 TTGCAGCCTCCTCCTTAGTGTGG - Intergenic
1027245742 7:76366076-76366098 TTCTGGCTTCCTCCTGTGGCTGG + Intergenic
1032174478 7:129612096-129612118 TTCCGGCCTCCTCCGCCGCCTGG + Intronic
1039723022 8:40185168-40185190 TTCAGGTTTCCTCCTTAGGCTGG + Intergenic
1041143871 8:54850545-54850567 TTCAGTCCTTCTCCTTGGGCAGG - Intergenic
1043874041 8:85464451-85464473 TTCCCGCCTCCTCCTAGGTCCGG - Intronic
1049641146 8:143716554-143716576 GTCCTGCCTCCTCCGTAGGCGGG + Intronic
1061284613 9:129615046-129615068 TTCTGGGCACCTCCTCAGGCAGG + Intronic
1061434681 9:130553808-130553830 TTCCTGCTTTCTGCTTAGGCAGG + Intergenic
1062043178 9:134413524-134413546 TTCTGGCCTCCTCTTAAGGGTGG - Intronic
1192121613 X:68461576-68461598 TTCTGGTCTCCTACTGAGGCAGG - Intergenic
1198309994 X:135421706-135421728 TTCCGGGCGCCTCCGGAGGCTGG - Intergenic