ID: 1083896820

View in Genome Browser
Species Human (GRCh38)
Location 11:65624225-65624247
Sequence CAGCAGATGCAGAAGTAGAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 352
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 309}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083896820_1083896823 6 Left 1083896820 11:65624225-65624247 CCTGTCTACTTCTGCATCTGCTG 0: 1
1: 0
2: 3
3: 39
4: 309
Right 1083896823 11:65624254-65624276 CATCTGGCTGCTGGACGCCCTGG 0: 1
1: 0
2: 1
3: 15
4: 211
1083896820_1083896821 -10 Left 1083896820 11:65624225-65624247 CCTGTCTACTTCTGCATCTGCTG 0: 1
1: 0
2: 3
3: 39
4: 309
Right 1083896821 11:65624238-65624260 GCATCTGCTGTCTGCTCATCTGG 0: 1
1: 0
2: 3
3: 14
4: 167
1083896820_1083896822 -3 Left 1083896820 11:65624225-65624247 CCTGTCTACTTCTGCATCTGCTG 0: 1
1: 0
2: 3
3: 39
4: 309
Right 1083896822 11:65624245-65624267 CTGTCTGCTCATCTGGCTGCTGG 0: 1
1: 0
2: 2
3: 27
4: 282
1083896820_1083896824 7 Left 1083896820 11:65624225-65624247 CCTGTCTACTTCTGCATCTGCTG 0: 1
1: 0
2: 3
3: 39
4: 309
Right 1083896824 11:65624255-65624277 ATCTGGCTGCTGGACGCCCTGGG 0: 1
1: 0
2: 0
3: 12
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083896820 Original CRISPR CAGCAGATGCAGAAGTAGAC AGG (reversed) Exonic
901228368 1:7628169-7628191 CAGCACATGGAGAAGGAGAAGGG - Intronic
902390837 1:16104625-16104647 CAGCAGTTGCAAAAGCAGAAGGG - Intergenic
902742243 1:18446914-18446936 CACCAGGTGCAGCAGTAGAGGGG - Intergenic
904546106 1:31274083-31274105 CAGCAGATGATGAGGTAGACAGG + Intronic
905664406 1:39753910-39753932 GAGCAGAGGCAGCAGAAGACCGG - Intronic
905793676 1:40803423-40803445 CAGCAGAGGGAGAAGCAGAAGGG - Intronic
905914922 1:41678194-41678216 CAGCAGATGCAGATGCTGCCAGG - Intronic
906577340 1:46902678-46902700 CAGAAGAAGCAGAAGTACACTGG - Intergenic
906774335 1:48515174-48515196 CAGCAGTTGCAAAAGCAGAAAGG - Intergenic
907721674 1:56977932-56977954 GAGCAGATGCTGGAGCAGACTGG - Intergenic
907833419 1:58086738-58086760 CAGCAGAAGCAGAAGTACAGAGG - Intronic
908699623 1:66884451-66884473 CATCAGATGCAGAAAAAGAAGGG - Intronic
909011679 1:70341956-70341978 TGGCAGAGACAGAAGTAGACTGG + Intronic
909615240 1:77601453-77601475 CAGTAGTTGCAAAAGTATACAGG + Intronic
909679709 1:78278213-78278235 GAGAAGATGGAGAGGTAGACAGG + Intergenic
911136753 1:94448863-94448885 CAGCAGTTGCAAAAGCAGAGGGG + Intronic
912945199 1:114078856-114078878 GAGCAAAGGCAGAAGCAGACAGG - Intergenic
913398157 1:118395846-118395868 CAGCAGATGCACTAGCAGACTGG + Intergenic
914887056 1:151594045-151594067 CAACAGTTAGAGAAGTAGACAGG - Intergenic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
917208240 1:172601162-172601184 CAGCAGGAGCAGAAGCAGACAGG + Intronic
917799324 1:178555917-178555939 CAGCAGTTGCAAAAGCAGAAAGG - Intergenic
918086304 1:181248025-181248047 CAGAAGAGGCAGAAGCATACTGG - Intergenic
918498389 1:185165535-185165557 AAGCAAATGCAGAAGTAGGGAGG - Intronic
920330557 1:205204307-205204329 CCGCAGAAGCAGAATTGGACTGG + Intronic
920744915 1:208617265-208617287 AAGCAGAGGCAGAAGTAAAGGGG + Intergenic
922534295 1:226368410-226368432 CAGCAGGTCCAGAAGTAGCGTGG + Intronic
922943087 1:229485659-229485681 CAACAGATGCATCAGGAGACAGG + Intronic
923174029 1:231445857-231445879 CACCAGTTGCAGTAGTAGAAGGG - Intergenic
1062786824 10:271763-271785 CAGGAGGTGTAGAAGTAGCCAGG - Intergenic
1062887734 10:1031521-1031543 AAGCATATGCAGAAGAAAACGGG - Intergenic
1062902193 10:1154806-1154828 CAGAAGAGGCAGAGGGAGACTGG - Intergenic
1065447665 10:25819993-25820015 CAGCAAAAGCAGAATTAGAGTGG - Intergenic
1065918737 10:30372999-30373021 AAGCAGGTGAAGAAGCAGACAGG + Intronic
1066402679 10:35090590-35090612 CAGCAGCGGAAGAAGGAGACCGG - Intronic
1066657270 10:37708016-37708038 CAGCAGATGGAGCTGGAGACAGG - Intergenic
1066789195 10:39044214-39044236 CAGAAGAGGCAGAAGCATACTGG - Intergenic
1066801708 10:39199662-39199684 CAGCAGTTGCAAAAGCAGAAAGG - Intergenic
1067257503 10:44658026-44658048 CAGTAGATGCAAAAGAAAACAGG - Intergenic
1068166384 10:53337528-53337550 CAGCAGTTGCAAAAGCAGAAAGG - Intergenic
1070874249 10:79787461-79787483 CAGCTGAAGGAGAATTAGACTGG + Intergenic
1071347118 10:84703343-84703365 CAGCAGAAGCAAAAGTAGCCTGG - Intergenic
1071370463 10:84945886-84945908 CAGCAGATGCTGGAGAAGAGTGG - Intergenic
1072336611 10:94403285-94403307 CAGCAGCTGCAGCAGTAGCGAGG + Exonic
1073354473 10:102843094-102843116 CAGAAGAGGCAGAAGCATACTGG + Intergenic
1073993298 10:109288267-109288289 CAACAAATGCAGAACTAGGCTGG - Intergenic
1074037363 10:109753832-109753854 CATCAGCTGCAGAAGTAGAAGGG + Intergenic
1074297023 10:112199383-112199405 CAGCAGCTGCAGGAGGAGATGGG + Intronic
1074808138 10:117074723-117074745 CAGGAAATGCAGCAGTAGGCAGG + Intronic
1076209957 10:128632433-128632455 AAGCAGATGCAGGAGTGGGCAGG + Intergenic
1077439377 11:2560853-2560875 CAGCAGAGGCAGCAGTGGATGGG + Intronic
1079138945 11:17794965-17794987 CAGCAGATGCAGAAGGGGGCAGG - Intronic
1080103911 11:28491551-28491573 CAGCAGTTGCAAAAATAGAGGGG + Intergenic
1082295811 11:50440069-50440091 CAGCAGGAGCATAAGTATACTGG - Intergenic
1082301587 11:50512493-50512515 CAGCAGTTGCAAAAGCAGAAAGG + Intergenic
1082883253 11:58058754-58058776 CAGCAGCTGCAGAAGCAGATCGG - Intronic
1083896820 11:65624225-65624247 CAGCAGATGCAGAAGTAGACAGG - Exonic
1086454695 11:86949483-86949505 AAGCAGTTGCTGAAGCAGACAGG + Exonic
1087623581 11:100569922-100569944 GAGGATTTGCAGAAGTAGACAGG - Intergenic
1087630843 11:100648285-100648307 CATCAGCTGCAGTAGTATACCGG - Intergenic
1087681104 11:101219339-101219361 CAGAAGAGGCAGAAGTATACTGG + Intergenic
1088238829 11:107753073-107753095 CATCAGATGGAGAACTGGACAGG + Intergenic
1088494224 11:110417543-110417565 CCGCCAATGCAGAAGCAGACAGG - Intergenic
1089391625 11:118106120-118106142 CGGCTGATGCAGCAGTTGACTGG - Intronic
1089609693 11:119662569-119662591 AAGGAGATGCAGGAGGAGACAGG + Exonic
1089997200 11:122919511-122919533 CCACAGCTGAAGAAGTAGACAGG + Intronic
1090234340 11:125136196-125136218 GAGCAGAAGCAGAAGTGGAGAGG - Intergenic
1091730677 12:2877756-2877778 CAGCAGTTGCTCAACTAGACTGG - Intronic
1094483939 12:30909140-30909162 CATCAGATGCAGAAGCAAAGTGG - Intergenic
1095184974 12:39190811-39190833 CAGCAGTTGCAAAAGCAGAAAGG - Intergenic
1095357747 12:41296327-41296349 CAGCCAAAGCAAAAGTAGACAGG + Intronic
1095931567 12:47631435-47631457 ATGCAGTTGCAGAAGTAGATGGG + Intergenic
1096450434 12:51736078-51736100 CAGCAGTTGCAAAAGCAGAAAGG - Intronic
1096956399 12:55530175-55530197 CACCAGCTGCAGTAGTAGAAGGG - Intergenic
1098693621 12:73522803-73522825 TATGAGATGCAGAAGAAGACAGG + Intergenic
1098867907 12:75783527-75783549 CAGCTGGTGCAAAAGGAGACTGG + Intergenic
1099086376 12:78251645-78251667 AAGCAGAAACAGAAGTAGCCTGG + Intergenic
1099497463 12:83368306-83368328 GAGAAGATGCAGAAGTAAGCAGG - Intergenic
1099534304 12:83826422-83826444 CAGCAGAGGCACAGGTACACTGG - Intergenic
1099555844 12:84107564-84107586 CAGAAGGAGCAGAAGTATACTGG + Intergenic
1099977137 12:89557862-89557884 TAGCAGAGGCAGGTGTAGACTGG + Intergenic
1100811005 12:98338334-98338356 CAGCAGATCTATTAGTAGACAGG - Intergenic
1101501124 12:105304694-105304716 CAGCAGTTGCAAAAGCAGAAAGG - Intronic
1101902461 12:108800685-108800707 CTGCAGATGCAGAAGTCGGCTGG - Intronic
1102652745 12:114454296-114454318 AAACATATGCAGAAGTAGAAAGG - Intergenic
1102869094 12:116399478-116399500 CTGCAGCTGCAGAAGGAGAGTGG - Intergenic
1102883453 12:116503940-116503962 CAGCATATGCAAAAGTATACAGG - Intergenic
1103467616 12:121154371-121154393 CACCAGATGCAGCCTTAGACTGG + Intronic
1104079563 12:125417971-125417993 CAGCAGATGCTGATGGGGACAGG + Intronic
1104270091 12:127275578-127275600 CATAAGATGCAGAAGTAAATAGG + Intergenic
1105510242 13:21045724-21045746 CTGCAGCTGCAGAAGTGAACCGG - Exonic
1105610838 13:21968508-21968530 CAGCAGTTGAAGAAGTATCCTGG - Intergenic
1106455293 13:29921465-29921487 CAGGAGAGGCAGAATTAGTCAGG - Intergenic
1107104103 13:36625303-36625325 AAGCACATGTAGAAGTAGACAGG + Intergenic
1108141635 13:47428749-47428771 CTCCAGAAGCAGAAGTTGACAGG - Intergenic
1109464303 13:62708929-62708951 CAACTGAAGCAAAAGTAGACAGG - Intergenic
1110158018 13:72342146-72342168 CACCAGCTGCAGTAGTAGAAGGG + Intergenic
1112039870 13:95536027-95536049 CAGTGGATGGAGAAGTAGATGGG + Intronic
1113184321 13:107670044-107670066 CAGTAGATGGTGAAGTAGAAAGG - Intronic
1114055136 14:18961815-18961837 TAGAAAATGCAGAAGTAGCCTGG - Intergenic
1114107406 14:19439963-19439985 TAGAAAATGCAGAAGTAGCCTGG + Intergenic
1114629373 14:24149344-24149366 CAGCAGATTCAGATGTAGCCTGG + Intronic
1116238252 14:42308984-42309006 CAGCAGTTGCAAAAGCAGAGGGG - Intergenic
1117082995 14:52170695-52170717 CAGCAGTTGCAAAAGCAGAGGGG + Intergenic
1117166164 14:53036112-53036134 CAGCAAATGCAAAGGTAGAGAGG + Intergenic
1117945834 14:61019428-61019450 AAGCAGATGCAGAAGTTGTGAGG - Intronic
1119013745 14:71026147-71026169 CAACATATGCAGAAATAAACTGG - Exonic
1119464403 14:74843683-74843705 CAGCAGAAGCAGAATAAAACAGG + Intronic
1119613943 14:76086081-76086103 CTCCAGATACAGAACTAGACAGG + Intergenic
1120568490 14:86088954-86088976 CAGCTGGTACAGAAGTAGATAGG - Intergenic
1121709451 14:96026780-96026802 CAGCAGAAGGAGAAGGAGATGGG + Intergenic
1122032116 14:98919778-98919800 CAGCAGAGGCACAAGAGGACTGG + Intergenic
1122354610 14:101115306-101115328 AACGAGATGCAGAAGGAGACGGG - Intergenic
1122905053 14:104797775-104797797 CAGCAGCTGCAGAAGGTGACAGG - Intergenic
1123878634 15:24652446-24652468 GTGCAGATGTAGAAGTAGCCTGG + Intergenic
1126519447 15:49574697-49574719 CAGAAGATCCAGAATTAGAAAGG - Intronic
1126589574 15:50325403-50325425 CAGCAGAAACAGAACCAGACAGG - Intronic
1128292505 15:66488723-66488745 CAGCACCTGCAGAAGCAAACCGG - Intronic
1128423527 15:67517864-67517886 CAGAAGATGCAGAAATAAACTGG + Intergenic
1128456480 15:67834228-67834250 CAGGAGTTTCAGAAGTGGACGGG - Exonic
1133138395 16:3728130-3728152 CAGCAGATGAAGCAGCAGATTGG - Exonic
1133970220 16:10562215-10562237 CAGCAGGTGGAGAAATAGATTGG - Intronic
1134859247 16:17546342-17546364 CTTCATCTGCAGAAGTAGACGGG - Intergenic
1135499980 16:22987221-22987243 AAGCACATACAGAAGTAGAGAGG + Intergenic
1137367356 16:47872339-47872361 AAGCAGAAGCAGAAGCAGAAGGG + Intergenic
1137740230 16:50763057-50763079 ATGCAGAGACAGAAGTAGACTGG - Intronic
1138432252 16:56976367-56976389 AACTAGATGAAGAAGTAGACAGG - Intronic
1138452246 16:57100285-57100307 CAGCATATGCAGAATTAGGGAGG + Intronic
1138462506 16:57159351-57159373 CTGCAAATGCAGAAGTTGGCAGG - Intronic
1138682674 16:58697314-58697336 CAGCAGATGCAAAAGCATAATGG - Intergenic
1138760432 16:59537328-59537350 CATCTGATGATGAAGTAGACAGG + Intergenic
1139663335 16:68437362-68437384 CAGCACATGCTGAACTCGACAGG - Intronic
1142356856 16:89605430-89605452 CAGCAGAGGACGCAGTAGACAGG - Intergenic
1142411540 16:89919472-89919494 CAGCAGATGAAGCAGTACATGGG - Exonic
1142432943 16:90040348-90040370 CAGGAGGTGCAGCAGAAGACAGG + Exonic
1203140168 16_KI270728v1_random:1759438-1759460 CAGCACATCCAGAAGTTGAAAGG + Intergenic
1142523939 17:524780-524802 CATCAGAGTCAGAAGTAAACAGG + Intronic
1143647401 17:8239849-8239871 GAGCAGATGCAGAAGGGGAATGG - Intronic
1145802075 17:27694039-27694061 CAGAAGGAGCAGAAGTATACTGG + Intergenic
1146550336 17:33775333-33775355 CAGAGGATGCAGCAGTACACTGG + Intronic
1147346612 17:39801213-39801235 CAGCAAATGCAAAAGTCAACTGG + Intronic
1148824045 17:50379034-50379056 CAGAAGATACAGAAGAAGACTGG - Intronic
1153843119 18:9024582-9024604 GCTCAGATGCAGAAGTAGAATGG + Intergenic
1153968949 18:10207169-10207191 CAGCAGTTCCAGGAATAGACAGG + Intergenic
1156080286 18:33326251-33326273 CAGCAGATGCTGAAGTACAGGGG + Intronic
1156344728 18:36246822-36246844 CACCAGCTGCAGCAGTAGAAGGG + Intronic
1157740318 18:50087213-50087235 GAGCAGATGGAGGAGTAAACAGG - Intronic
1158179425 18:54697239-54697261 CAGAAGATGCCGAAGTGGCCAGG + Intergenic
1158635365 18:59151577-59151599 CAGCAGGTGCAGAAGGTGGCAGG - Intronic
1159027055 18:63192798-63192820 TTGAAAATGCAGAAGTAGACAGG - Intronic
1160039274 18:75331234-75331256 AAGAAGATGAAGAAGTAGAAGGG - Intergenic
1160047733 18:75402704-75402726 CAGCAGAAGCAGAAATAGAGAGG + Intergenic
1160160520 18:76466804-76466826 CAGCTGATGCAACAGGAGACAGG + Intronic
1160598353 18:79993381-79993403 CCACAGATGCAGCAGCAGACAGG - Intronic
1160936146 19:1596077-1596099 CAGCAGATACAGAAATAGGCAGG + Intergenic
1161010933 19:1959007-1959029 GAGCAGATGGAGATGCAGACTGG - Intronic
1161866679 19:6837430-6837452 CAGCAGAGGCTGGAGTGGACAGG - Intronic
1161921301 19:7268201-7268223 CGGCAGGTGCAGAAGGAGAAAGG + Intronic
1162576295 19:11500949-11500971 CAGAAGTTGGAGAAGTGGACAGG - Intronic
1162652417 19:12100129-12100151 CAGCAGTTGCAAAAGCAGAAAGG - Intronic
1164031806 19:21413918-21413940 CAGCAGTTGCAGAAGGAGACGGG - Intronic
1164289620 19:23855686-23855708 CAGAAGAGGCAGAAGCATACTGG + Intergenic
1164335974 19:24321636-24321658 CAGAAGGAGCAGAAGTATACTGG - Intergenic
1164594858 19:29526160-29526182 GAGCAGAACCAGAAGGAGACAGG + Intergenic
1165098535 19:33424234-33424256 CACCAGAGGCAGAACTTGACTGG + Intronic
1166097547 19:40550449-40550471 CAGCAGATACAGATGTATCCAGG + Intronic
1166564657 19:43756222-43756244 CAGCAGCTCCAGAAGGAAACCGG - Intergenic
1166868032 19:45852917-45852939 GAGCAGAAGCAGAAGGAGAGTGG - Intronic
1166885965 19:45961051-45961073 GTGCAGCTGCAGAAGGAGACCGG - Exonic
1167917233 19:52751397-52751419 CAGCAGTTGCAAAAGCAGAAAGG - Intergenic
926875011 2:17466336-17466358 CAACAGATGCTGGAGAAGACAGG + Intergenic
927374581 2:22398992-22399014 CAGAAGAGGTAGATGTAGACAGG - Intergenic
928103468 2:28452784-28452806 CAGCAGACGCAAAAAGAGACTGG + Intergenic
930290916 2:49491425-49491447 TAGCAGTTGCAGCAGTAGGCTGG - Intergenic
932265100 2:70361096-70361118 CTGCAGATGAAAAAGTTGACTGG - Intergenic
933014975 2:77113653-77113675 CAGAAGAGGCAGAAGTGCACTGG + Intronic
934737668 2:96698184-96698206 CAGAAGGTGCACAAGGAGACAGG - Intergenic
935834671 2:107037365-107037387 CAGCAGATGCAGTAGCAGAGAGG - Intergenic
935954817 2:108365484-108365506 CATCAGATACCGAAGTGGACTGG - Intergenic
936004083 2:108866479-108866501 CAGCAGATACACATGTAAACTGG - Intronic
936930858 2:117787453-117787475 CATCAGATACTGAAGTTGACTGG + Intergenic
937861353 2:126713951-126713973 CTGAAGATGCAGACTTAGACAGG + Intergenic
938248707 2:129797670-129797692 CAGCAGGGGCAGAAGTGGATAGG + Intergenic
938473146 2:131584604-131584626 TAGAAAATGCAGAAGTAGCCTGG - Intergenic
940310665 2:152275433-152275455 CAGCAGTTGCAAAAGCAGAAAGG - Intergenic
940894834 2:159071084-159071106 CAGAAGGGACAGAAGTAGACAGG - Intronic
941779191 2:169426526-169426548 CAGCAAATGCAGAATTGGCCAGG + Intergenic
942371970 2:175294952-175294974 CAGTAGAAGCAGAAGCACACAGG - Intergenic
943848907 2:192690488-192690510 AGGCAGATGCAGAAATAGAATGG - Intergenic
948361240 2:237422016-237422038 CAGCAGGCGCAGAAGTGGAGGGG + Intronic
1168835315 20:873721-873743 CAGCAGATGGAGAGCTATACTGG - Intronic
1168928620 20:1603402-1603424 CAGCAGATGCAGGAGTCTGCAGG + Intronic
1169065234 20:2691495-2691517 CAGGAGATGGAGAAAGAGACTGG + Intergenic
1170160606 20:13306540-13306562 CAGCAAATGGAGAAGGAGAAAGG + Intergenic
1171049680 20:21843769-21843791 CAGCTCATCCAGAGGTAGACGGG - Intergenic
1171229502 20:23472122-23472144 CAGCAGCTGCAAAAGCAGAAGGG + Intergenic
1171311502 20:24148804-24148826 CAGCTGATGCAGCAGTTGGCTGG + Intergenic
1171494644 20:25547288-25547310 CAGCAGATGAAGAGGTGGATGGG - Intronic
1173151357 20:40569069-40569091 CTGCAGATGGAGATGTAGAAAGG - Intergenic
1173311821 20:41903537-41903559 CATGAGATGCAGAAGCAGATTGG - Intergenic
1173756866 20:45524507-45524529 CAGCAGATGCTGAAGAAAATGGG - Intergenic
1175034335 20:55985354-55985376 CAGTAGAAGCAGCAGGAGACTGG + Intergenic
1178320595 21:31602255-31602277 CAGCAGCAGCAGAAGAAAACTGG + Intergenic
1179086457 21:38222603-38222625 CTGCTGATGCAGAAGCAGACAGG + Intronic
1179874264 21:44259696-44259718 CAGCAGATGCAGATGTCTAAAGG + Exonic
1180473618 22:15684365-15684387 TAGAAAATGCAGAAGTAGCCTGG - Intergenic
1180991096 22:19936702-19936724 CAGAAGAGGCAGAAGCATACTGG - Intronic
1181464920 22:23105840-23105862 CAGCTGAAACAGAAGTGGACTGG + Intronic
1181766172 22:25093886-25093908 AAGCAGAAGCAGAAGCAGAAGGG - Intronic
1181967633 22:26668071-26668093 CCTCAGATGCAGAATTAGGCTGG + Intergenic
1182509115 22:30806484-30806506 CAGCAGCCGCAGCAGTAAACAGG + Intronic
1183841638 22:40502732-40502754 CAGCGGCTGGAGAAGCAGACGGG - Intronic
1184192754 22:42905867-42905889 CAGCAGCTGCAGAATTGGCCTGG - Intronic
949772296 3:7592538-7592560 CAGCGCATGCAGAATCAGACTGG + Intronic
950187986 3:10957235-10957257 CAGCAGATGCAGAAGCAGGAGGG + Intergenic
950405191 3:12799924-12799946 CAACAGATGAAGAAGAAGAGCGG + Intronic
952217254 3:31289901-31289923 CAGCAGAGGCAGGAGTTGGCAGG - Intergenic
952435512 3:33269290-33269312 CACCAGCTGCAGTAGTAGAAGGG + Intergenic
953200856 3:40777368-40777390 CTGCAGATGGAGTAGTAGTCAGG + Intergenic
953785428 3:45907433-45907455 CAGCAGATGCAGGAAGAGACAGG - Intronic
955416432 3:58696323-58696345 GAGCTGAAGCAGAACTAGACAGG + Intergenic
955766717 3:62351947-62351969 CATCAGTTGCAGAAGGAGAGTGG - Intergenic
955819557 3:62881715-62881737 CAGCAGAGGCAGAAGCAGGAAGG - Intergenic
957194112 3:77045799-77045821 CCACAGAGGCAGAAGTAGAGTGG - Intronic
957230645 3:77509921-77509943 CAGCATAAGCAGAAGTAGTTGGG + Intronic
957507707 3:81145736-81145758 AAGCTGATGCATATGTAGACAGG + Intergenic
958853407 3:99355682-99355704 CAGCGGATGCATGAGTAGAAGGG + Intergenic
959563665 3:107812468-107812490 CAGTATATGCAGAAGTAGAGAGG + Intergenic
960409979 3:117311056-117311078 AAGCAGATGCAGAAACAGAGAGG - Intergenic
960977821 3:123193512-123193534 CAGCAGAGGAATAAGAAGACTGG - Intronic
961923471 3:130451385-130451407 CAGAAGGAGCAGAAGTATACTGG + Intronic
962737746 3:138340691-138340713 CTGCAGATGCCAGAGTAGACAGG - Intergenic
965100359 3:164290129-164290151 TAGCAGAAGCAGAAGTAGTTAGG - Intergenic
966371595 3:179256110-179256132 GAGCAAATACAGAAGTAAACAGG + Intronic
966978634 3:185109098-185109120 CAGCAGTTGCAAAAGCAGAAAGG + Intronic
968890874 4:3367761-3367783 CAGCAGCTGCAGAAAAGGACAGG + Intronic
971094686 4:23387419-23387441 CAGGAGATGTAGAAGTAAATAGG - Intergenic
971234970 4:24832971-24832993 CAGAAGTTGCAGATGTAGAATGG - Intronic
971899981 4:32646794-32646816 CAGAAGGAGCAGAAGTATACTGG - Intergenic
972344831 4:38183947-38183969 CTGCACATCCAGATGTAGACAGG + Intergenic
975893289 4:79054938-79054960 CAATAGATGCAAAAATAGACAGG - Intergenic
976977493 4:91182506-91182528 CAGCAGTTGCAAAAGCAGAAAGG - Intronic
977652692 4:99488307-99488329 CAGCAGTTGCAAAAGCAGACAGG - Intergenic
978177874 4:105756091-105756113 CAACAGATGAAGAAATACACAGG + Intronic
980119109 4:128709455-128709477 CACCGGATGCACAAGAAGACAGG + Intergenic
980970074 4:139559304-139559326 CAGCAGCAGCAGAAGTAGTGTGG + Intronic
981633846 4:146852409-146852431 TAGCAGATGCAGAGCCAGACAGG - Intronic
981898693 4:149835729-149835751 CACCAGCTTCAGAAGTAGACTGG + Intergenic
984839306 4:184053184-184053206 CAGCACATTCAGAAGTAGAGAGG + Intergenic
984956055 4:185046596-185046618 CAGCAGTTGCAAAAGCAGAAGGG - Intergenic
985501222 5:247926-247948 CAGCAGCTGCAAAAGTAAAAGGG + Intronic
985735665 5:1579716-1579738 CAGCAGTTGCAGAAGCAAAAGGG - Intergenic
987619263 5:20319039-20319061 CATGAGATGAACAAGTAGACTGG - Intronic
988492896 5:31719950-31719972 CAGCAGAGGCAGAATTGGCCTGG + Intronic
989318071 5:40104897-40104919 CAGAAGGAGCAGAAGTATACTGG - Intergenic
989365312 5:40649392-40649414 GAGCATATGCAGAAGTAAAATGG - Intergenic
990306641 5:54500073-54500095 CAGCAGTTGCAAAAGCAGAAAGG - Intergenic
990758972 5:59107598-59107620 CAGTAGAAGGAGAAGTAGAGGGG + Intronic
990856424 5:60272326-60272348 CAGCAAATGAATAAGTATACGGG - Intronic
991455815 5:66802975-66802997 CAGCAGATGATGAAAAAGACTGG + Intronic
991722440 5:69506335-69506357 CACCAGATGAAGAGGTGGACAGG + Intronic
992882393 5:81123372-81123394 CAGCAGATGTTAAAGTAAACGGG - Intronic
993406271 5:87515419-87515441 CAGCAGTTGCAAAAGCAGAAAGG + Intergenic
996013730 5:118508074-118508096 CAGGACATGCTGAAGTAGGCAGG + Intergenic
996551625 5:124736399-124736421 CAGGAAATCCAGAAGTAAACTGG + Intronic
997012963 5:129901366-129901388 CAGCAGAGGCCAAAGTAGATTGG - Intergenic
997338367 5:133123450-133123472 GAGCTCATGCAGAAGTAGAAAGG + Intergenic
998747988 5:145283511-145283533 CAGCAAATGCAGAGGGAGAGGGG - Intergenic
1000341727 5:160282169-160282191 CAGCAGATCCAGGACTAGAAAGG + Intronic
1000996462 5:167964139-167964161 CAGCAGAGGAAGGAGTAGATAGG - Intronic
1002038326 5:176490565-176490587 CAGCAGCTGCATAAGTACAAGGG + Intronic
1002940924 6:1715088-1715110 CAGCAGAAACATAAGGAGACAGG + Intronic
1002972143 6:2034828-2034850 CACCAAATGCAGAAGCAGATAGG + Intronic
1004117213 6:12781303-12781325 CAGCAGGTGCACAAGTTGTCTGG - Intronic
1004583812 6:16980007-16980029 CAGCAGCTGCAGCAAGAGACTGG - Intergenic
1005222944 6:23608735-23608757 CAACAGATGTAGAAGGAGTCTGG + Intergenic
1005857932 6:29877430-29877452 CAGCAGTTGCAAAAGCAGAAAGG - Intergenic
1007235360 6:40387373-40387395 CAGAAGATACAGAAGTACTCAGG + Intergenic
1007400169 6:41598815-41598837 CAGCAGAGGCAGAGGAAGACAGG + Exonic
1008730706 6:54479458-54479480 CAGTCAATGCAGAAGTAGATAGG + Intergenic
1011888357 6:92126116-92126138 CAGCAAATGCACAAGGAGAAGGG - Intergenic
1012154980 6:95807865-95807887 CAGTAGATGCAGAAAGAGACAGG + Intergenic
1012869862 6:104659695-104659717 CACCAGCTGCAGTAGTAGAAGGG - Intergenic
1012902001 6:105017393-105017415 CAGCAGATAGGGAAGCAGACTGG + Intronic
1012966202 6:105676191-105676213 CAGGAGATGCTGAAGGAGACAGG + Intergenic
1013033107 6:106355470-106355492 CAGCAGCTGGAGACGTAGAAGGG - Intergenic
1014878066 6:126685533-126685555 CACCAGTTGCAGTAGTAGAAAGG - Intergenic
1015610601 6:135013914-135013936 CAGATGATGTAGAAGTATACAGG + Intronic
1016306388 6:142688830-142688852 CAACAAAAGCAAAAGTAGACTGG + Intergenic
1018285385 6:162232189-162232211 CAGGAGATGCAGAAATTGTCAGG - Intronic
1018548729 6:164967385-164967407 GAGCAGCGGCGGAAGTAGACAGG + Intergenic
1019356768 7:584218-584240 CAGCAAAGGGAGAAGCAGACAGG + Intronic
1020985020 7:15122345-15122367 CTGCAGATACAGAAGTACACAGG - Intergenic
1021564996 7:22008202-22008224 CAGGAGAAGCAGCAGTAGACAGG + Intergenic
1022589088 7:31643774-31643796 CAGCAGATGCAGCAGTGGGCAGG - Exonic
1024101833 7:46040062-46040084 CAGCAGTTGCAAAAGCAGAAAGG - Intergenic
1024332631 7:48171302-48171324 CAGCAGATGCCGAACAAGAGGGG + Intergenic
1024911596 7:54453243-54453265 CAGCAGTTGCAAAAGCAGAAAGG + Intergenic
1025102643 7:56149009-56149031 CAGCAGTTGCAAAAGCAGAAAGG + Intergenic
1026279765 7:68911837-68911859 AAACATATGCAGAAGTATACTGG + Intergenic
1027427905 7:78080725-78080747 CAGCAGTAGAAGCAGTAGACAGG + Intronic
1030165758 7:106553411-106553433 CAGCAGATGAAGAATTAAAGAGG - Intergenic
1030541946 7:110842184-110842206 CAGCAGATTCAAAAGTGGAGAGG - Intronic
1032954631 7:136956547-136956569 CATCAGTTGCAAAAGAAGACAGG + Intronic
1033885840 7:145943502-145943524 CAGCAGTGGCAGCAGTAGATTGG - Intergenic
1034923276 7:155100877-155100899 CAGCAGAAGCGGAATTACACAGG - Intergenic
1034942516 7:155240017-155240039 CAGCAGTTGCAAAAGCAGAAAGG - Intergenic
1034959344 7:155355352-155355374 CAGCAGATGCAGAAGATGGGAGG + Intergenic
1035165257 7:156985584-156985606 CAGCAGATGCAGGAGCAGCAGGG - Intergenic
1035327688 7:158075508-158075530 CAGCAGGTCCAGCAGGAGACGGG + Intronic
1036127970 8:6081221-6081243 CAGCAGGTGAGGAAGTAGAAGGG - Intergenic
1037833696 8:22203950-22203972 CAGCAGATGGAAAGGTAAACAGG - Intronic
1037874998 8:22539879-22539901 GAGCAGAGGCAGAAGTAGACTGG + Intronic
1040528570 8:48246299-48246321 CAGCAGTTGCAAAAGCAGAAAGG - Intergenic
1041065099 8:54075083-54075105 CAGCAGTTGCAAAAGCAGAAAGG + Intronic
1044142861 8:88675952-88675974 CAGGAGAAGCAGAAGTATACTGG + Intergenic
1047163457 8:122408523-122408545 CAACAGATGCTGGAGTAGAAAGG + Intergenic
1048266095 8:132988412-132988434 CAACAGGTGCAGAAGAGGACCGG + Intronic
1048371670 8:133784044-133784066 CACCAGCTGCAGTAGTAGAAAGG + Intergenic
1049784805 8:144445209-144445231 CTTCAGCTGCAGAAGTAGCCCGG + Intergenic
1051822249 9:21181591-21181613 CTGCAGAGGCAGTGGTAGACAGG - Intergenic
1051827281 9:21234247-21234269 CTGCAGAGGCAGTGGTAGACAGG - Intronic
1052687337 9:31772567-31772589 CAGAAGAGGCAGAAGCATACTGG - Intergenic
1053014541 9:34654457-34654479 CAGCAGATGGAAATGGAGACAGG - Intronic
1057711222 9:97446947-97446969 CAGCAGAAGCAGAAGTGAAGAGG + Intronic
1058784537 9:108374403-108374425 CACCAGCTGCAGTAGTAGAAGGG + Intergenic
1059404869 9:114093302-114093324 CAGCAGGGGCAGGAGTAGAGGGG + Exonic
1060586650 9:124790730-124790752 CGGCAGAGGCAGTAGGAGACAGG + Intronic
1061016170 9:127981813-127981835 CACCAGGTGGAGAAGCAGACAGG + Intergenic
1061602951 9:131684509-131684531 CAGCAGTTGCAAAAGCAGAAAGG + Intronic
1062295687 9:135824937-135824959 CAGCAAATGCACAAGTGTACAGG + Intronic
1062605221 9:137344479-137344501 CCGCAGATGCTGAAGTGGACAGG - Intronic
1185555437 X:1017477-1017499 CAGCACATCCAGAAGTTGAAAGG - Intergenic
1187256564 X:17648366-17648388 CAGCAGAAGCAGAAGTTGCAAGG + Intronic
1189400138 X:40660303-40660325 CAGCATATACAGAAGTAGAATGG - Intronic
1191665942 X:63702765-63702787 CAGAAAATGCAGAAGTAGCCTGG + Intronic
1192490900 X:71576817-71576839 CAGGAGGAGCTGAAGTAGACTGG - Intergenic
1192687274 X:73320124-73320146 CAGCAGTTGCAAAAGCAGAAAGG - Intergenic
1192876031 X:75230438-75230460 CACCAGCTGCAGTAGTAGAAGGG - Intergenic
1193048819 X:77079989-77080011 CAGCAGTTGCAAAAGCAGAAAGG + Intergenic
1193767623 X:85550078-85550100 GACCAGAGACAGAAGTAGACAGG + Intergenic
1194247668 X:91536033-91536055 ATGCAGATCTAGAAGTAGACAGG - Intergenic
1195016363 X:100785588-100785610 CTGCATATGCAGAAGCAGACAGG - Intergenic
1195752530 X:108172818-108172840 CAGAAAATGCAGAAGATGACAGG + Intronic
1197079425 X:122394352-122394374 CACCAGCTGCAGTAGTAGAAGGG - Intergenic
1197128885 X:122980626-122980648 CAGAAGATGAAAAAGAAGACAGG + Intergenic
1198809629 X:140522581-140522603 CAGCAGCTGCTGAAGTAGACAGG + Intergenic
1199242930 X:145569154-145569176 CAGCAGTGGCAGTAGTGGACTGG - Intergenic
1199575825 X:149312782-149312804 CAGCAGAAGCAGATGTATGCAGG - Intergenic
1200566688 Y:4777563-4777585 ATGCAGATCTAGAAGTAGACAGG - Intergenic
1202140546 Y:21717167-21717189 CAGCAGTTGCAAAAGCAGAAAGG + Intergenic
1202146319 Y:21786630-21786652 CAGCAGTTGCAAAAGCAGAAAGG - Intergenic